Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Stouffs, K.
Right arrow Articles by Liebaers, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stouffs, K.
Right arrow Articles by Liebaers, I.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Human Reproduction, Vol. 10, No. 1, pp. 15-21, 2004
© European Society of Human Reproduction and Embryology 2004

Expression pattern of the Y-linked PRY gene suggests a function in apoptosis but not in spermatogenesis

Katrien Stouffs1,4, Willy Lissens1, Greta Verheyen2, Lisbet Van Landuyt2, Annieta Goossens3, Herman Tournaye2, André Van Steirteghem2 and Inge Liebaers1

1Center for Medical Genetics, 2Center for Reproductive Medicine and 3Department of Pathology, University Hospital, Dutch-speaking Brussels Free University (Vrije Universiteit Brussel), Laarbeeklaan 101, 1090 Brussels, Belgium

4 To whom correspondence should be addressed: katrien.stouffs@az.vub.ac.be


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
In this study, we aimed at analysing the expression of the PRY (PTPN-13 like on the Y chromosome) gene, located on the Y chromosome, in order to define the function of this gene. Active copies of the PRY gene (PRY1 and PRY2) are located in the AZFb region. PCR amplification of PRY cDNA indicated that the PRY gene is expressed in testicular tissue and ejaculated sperm, but not in Percoll-treated sperm. Furthermore, immunocytochemistry on testicular tissue showed the expression of the PRY gene in a small number of spermatozoa and spermatids. In the ejaculate of the male partner of 18 infertile couples, the PRY protein was found in 1.5–51.2% of spermatozoa and in most of the sperm precursor cells. The percentage of spermatozoa showing DNA fragmentation was also determined in 13 of these samples, by using the TdT (terminal deoxynucleotidyl transferase)-mediated dUDP nick-end labelling (TUNEL) reaction. These data correlated with the percentage of PRY-positive cells. When double labelling for PRY and DNA fragmentation was performed to assess whether PRY-positive cells also show DNA fragmentation, we saw that 27–48% of the PRY-positive spermatozoa were also positive for the TUNEL reaction. The overall data of RNA analysis, immunocytochemistry and the TUNEL reaction indicate that the role of the PRY gene in spermatogenesis can be questioned, but suggest its involvement in apoptosis of spermatids and spermatozoa.

Key words: Key words: apoptosis/male infertility/PRY/Y chromosome


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Microdeletions on the long arm of the Y chromosome are observed in ~6.5% of patients with idiopathic azoospermia or oligozoospermia (a review of >70 studies reporting Yq microdeletions published between 1992 and 2003). No Yq microdeletions were observed in the DNA of men with proven fertility. Several genes are known to be located within these deleted regions. A possible role of these genes in spermatogenesis has been suggested. However, it is not yet known which of these genes are involved in azoospermia or oligozoospermia. In a previous paper (Stouffs et al., 2001), we studied the PRY [PTPN-13 (protein tyrosine phosphatase-non-receptor type 13) like on the Y chromosome] gene, first reported by Lahn and Page (1997). Four possible functional copies of the PRY gene (PRY1PRY4) were mapped on Yq. PRY1 and PRY2, consisting of five exons, are located in AZFb, while PRY3 and PRY4, containing exons 3, 4 and 5, are located in AZFc. We could not make a distinction between PRY3 and PRY4 based on the sequence. PRY1 and PRY2 differ in one base pair, PRY1 and PRY3/PRY4 also in one base pair and PRY2 and PRY3/PRY4 in two base pairs. Amplification of cDNA isolated from a cDNA library showed that PRY1 and/or PRY2 are alternatively spliced: an extra exon was observed between exon 4 and exon 5.

In this study, we have analysed the expression of the PRY gene in testicular tissues and ejaculated sperm at the RNA and protein level. Since the expression pattern of the PRY gene indicated that PRY probably has no function in spermatogenesis, we investigated a possible function in apoptosis of mature sperm. We compared the percentage of apoptotic spermatozoa and the percentage of PRY-positive sperm. It has also been determined whether DNA fragmentation and the expression of PRY were present in the same cell.


    Materials and methods
 Top
 ABSTRACT
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Testicular tissue and sperm samples
The study was approved by the Commission of Medical Ethics of the University Hospital. Fresh testicular tissue was obtained from three patients who came to the hospital for vasectomy repair and who signed an informed consent. The histology was determined on a second biopsy and showed normal spermatogenesis. Two of these samples were used for RNA extraction and one sample for immunocytochemistry. For immunocytochemistry, we also used two samples that were obtained from autopsy. Both patients died of cancer before the age of 50 years. Histology of a testicular biopsy of one patient, who was being treated by chemotherapy, showed maturation arrest at the stage of spermatocytes whereas a testicular biopsy of the second patient showed a normal histology.

Semen was obtained from the male partners of 27 couples with fertility problems who came to the laboratory of andrology for diagnostic semen analysis. For RT–PCR, RNA was extracted from semen without any further treatment (two samples) or was extracted from a pool of three samples of ejaculated sperm after selection on a density gradient of Percoll (90–45%). These semen samples had normal parameters.

For immunocytochemistry, samples with different semen parameters were used. Results of semen analysis are summarized in Table I. Twenty semen samples were used without any purification, while two semen samples (samples 7 and 8) were first treated by swim-up purification in order to select progressively motile sperm.


View this table:
[in this window]
[in a new window]
 
Table I. Characterization of semen samples
 
Testicular tissues for RNA extraction were transferred to cryo-tubes and frozen by plunging into liquid N2.

Testicular tissues for immunocytochemistry were fixed in formalin and embedded in paraffin wax. Since the fixation had to be adapted for each procedure, semen samples were prepared according to three different procedures. (i) In the first series, samples 1–5 were used for immunocytochemistry only. These samples were washed three times in 5 ml phosphate-buffered saline (PBS) and once in 1 ml PBS and spread on at least two polylysine slides. Fixation was performed by incubation in ice-cold methanol. (ii) In the second series (samples 6–18), samples were used for immunocytochemistry and the TdT (terminal deoxynucleotidyl transferase)-mediated dUDP nick-end labelling (TUNEL) reaction, and at least three slides were prepared for each sample. These samples were washed three times in 5 ml PBS and once in 1 ml PBS after which an overnight incubation at –20°C in acetic acid:methanol (1:3) was performed. The next day, samples were fixed again in acetic acid:methanol (1:3) and spread on polylysine slides. (iii) In the third series, samples 19–22 were washed three times in 5 ml PBS and once in 1 ml PBS and spread on a polylysine slide. Fixation was performed by incubation in 4% paraformaldehyde. These four samples were used for the combination of immunocytochemistry and the TUNEL reaction.

Ovarian tissue from archival tissues for immunocytochemistry was provided by the Department of Pathology and used as control tissue. Ovarian tissue for RNA analysis was obtained from autopsy.

RNA extraction and RT–PCR
RNA was extracted from normal testicular tissues, ejaculated sperm with normal semen parameters, ejaculated sperm after Percoll treatment, ovarian tissue (control) and white blood cells isolated from blood from a healthy donor by using the Rneasy Mini Kit (Qiagen, The Netherlands) according to the instructions of the manufacturer. Testicular tissues and ovarian tissue were first incubated in RLT lysis buffer (Qiagen), ground with a pestle and homogenized with QIAshredder (Qiagen). Ejaculated sperm and white blood cells were lysed by adding RLT lysis buffer and homogenized with QIAshredder. The concentration of RNA was determined by spectrophotometry (GeneQuant II; Amersham Pharmacia Biotech Inc., The Netherlands).

RT–PCR was performed by using the First-Strand cDNA synthesis Kit (Amersham Pharmacia Biotech Inc.) according to the instructions of the manufacturer.

cDNA analysis
The presence of good quality RNA in the different tissues was confirmed by amplification of GAPDH-specific cDNA with primer pair GAPDH1–GAPDH2. The presence of PRY-specific cDNA was determined by PCR amplification with primer pair PRYP13–PRYP37 or PRYP1a–PRYP18. All primers for PCR amplification and sequencing are listed in Table II.


View this table:
[in this window]
[in a new window]
 
Table II. Sequences of the primers used for cDNA analysis and the localization in the PRY gene
 
Since the sequence of the PRY gene that we had found by amplifying fragments isolated from a commercially available cDNA library was different from the published sequence, we analysed cDNA from fresh testicular tissue. cDNA from testicular tissue was amplified with primer pair PRYP25–PRYP3, amplifying most of the gene and sequenced on the ABI310 (Applied Biosystems, The Netherlands) with primers PRYP9, PRYP15 and PRYP17.

The distinction between the four PRY genes and the presence of the alternatively spliced form was determined by PCR amplification with primer pair PRYP1a–PRYP37 for testicular tissue and primer pair PRYP13–PRYP37 for non-purified ejaculated sperm. When two fragments were obtained on agarose gel electrophoresis, these fragments were purified using the QIAEXII Gel Extraction kit (Qiagen), reamplified by using primer pair PRYP8–PRYP37 and sequenced with primers PRYP8 and PRYP37.

All PCR reactions were performed in a 50 µl mix containing 1xPCR buffer II (Applied Biosystems, Belgium), 2 mmol/l of MgCl2 (Applied Biosystems), 0.2 mmol/l of each dNTP (Amersham Pharmacia Biotech Inc.), 1 µmol/l of each primer, 2.5 units of Taq polymerase (Applied Biosystems) and 1–4 µl of cDNA (depending on the concentration). Thermocycling conditions consisted of an initial denaturation of 5 min at 94°C, 35 cycles of 1 min at 94°C, 1 min at a varying annealing temperature (60°C for PRYP25–PRYP3, PRYP8–PRYP37, PRYP1a–PRYP18 and GAPDH1–GAPDH2, 58°C for PRYP13–PRYP37 and 55°C for PRYP1a–PRYP37) and 2 min at 72°C and a final extension at 72°C.

Immunocytochemistry
A peptide of the PRY gene, SLNRGLEARRKKDLKD, was made by Eurogentec (Belgium). Antibodies against this peptide were generated in rabbit by Eurogentec.

Immunocytochemistry was performed by using the rabbit ABC staining kit system from SanverTECH (Belgium) according to the instructions of the manufacturer. Tissues were deparaffinized in xylene, hydrated in ethanol and pretreated with pepsin to unmask antigens. Ejaculated sperm cells were permeabilized in 0.1 mol/l sodium citrate at 70°C or used without any permeabilization. The PRY antibody or preimmune serum was used in a 1:100 dilution when fixed in methanol/acetic acid or paraformaldehyde and in a 1:300 dilution when fixed in methanol. The detection was performed by an avidin–biotin–horseradish peroxidase (ABC–HRP) system and diaminobenzidine (DAB). Sections were counterstained using haematoxylin or Methyl Green and analysed by light microscopy. Testicular tissues and ejaculated sperm were also analysed by using an automatic immunostainer (Ventana Nexes, France) which uses alkaline phosphatase and Fast Red for the detection of antibodies. These samples were counterstained with haematoxylin–eosin.

Peptide preparation for immunoblot analysis
To check the specificity of the antibody, a peptide of the PRY gene was generated by using the pCR T7/NT-TOPO TA Cloning Kit from Invitrogen (Belgium). A fragment of cDNA was amplified from a cDNA library (Clontech; BD Biosciences, Belgium) with a forward primer (ACGGGGAGCATGTGTTCTGAAC) in frame with the open reading frame (ORF) and a reverse primer (GGTGTCTTTTCCTCACTTG) located after the stop codon. The amplified fragment is located in exon 4 and exon 5 of the PRY gene and contains the sequence encoding the peptide against which the antibody is generated. PCR fragments were cloned in a TA vector and grown in TOP10F' cells, analysed and subcloned in BL21(DE3)pLysS cells. Expression was induced with IPTG. Samples from an induced and an uninduced culture were taken every hour for 6 h.

Immunoblot analysis
Peptides were resolved on 12% sodium dodecyl sulphate–polyacrylamide gel and blotted onto a nitrocellulose membrane. Blots were incubated in Ponceau S (Sigma–Aldrich, Belgium) to visualize proteins, washed with Tris-buffered saline (TBS)–0.1% Tween 20 (Merck-Eurolab, Belgium) and blocked with TBS–non-fat dry milk (NFDM)–Nonidet P-40 (NP-40) (Sigma–Aldrich), after which blots were incubated with the PRY antibody diluted in TBS–NFDM–NP-40 (NP40) for 1 h. After several wash steps with TBS–Tween 20 and TBS–NFDM–NP-40, blots were incubated with a secondary antibody (Amersham Pharmacia Biotech Inc.) conjugated with horseradish peroxidase after which a chemiluminiscence detection was performed by using Lumigen PS-3 acridan (Amersham Pharmacia Biotech Inc.) which generates an acridinium ester.

TUNEL reaction
Apoptosis in ejaculated sperm was detected by using the in-situ cell death detection kit (Roche, Belgium) according to the instructions of the manufacturer. Ejaculated sperm cells were permeabilized in 0.1 mol/l sodium citrate for 30 min at 70°C, incubated in the TUNEL reaction mixture, after which the detection with converter-alkaline phosphatase and NBT-BCIP (Roche) was performed. Sections were counterstained using Methyl Green and analysed by light microscopy.

Double labelling
By using a combination of immunocytochemistry with antibodies against the PRY gene and the TUNEL reaction, we were able to see if DNA fragmentation was present in the same cells where PRY was present.

Samples were permeabilized in 0.1 mol/l sodium citrate during 30 min at 70°C. First, immunocytochemistry with antibodies against PRY was performed, after which samples were stained for DNA fragmentation by the TUNEL reaction. The procedures for both techniques are described above.


    Results
 Top
 ABSTRACT
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
RNA analysis
In a previous study we amplified and sequenced cDNA sequences isolated from a testis-specific cDNA library. Since sequence analysis showed a sequence that was different from that originally published (Lahn and Page, 1997), we determined the cDNA sequence of the PRY gene in fresh testicular tissue. PCR amplification and sequencing confirmed the sequence previously determined in our laboratory (data not shown).

We have also analysed RNA isolated from semen with normal sperm parameters and Percoll-treated ejaculated sperm, RNA isolated from leukocytes to exclude background expression from leukocytes and RNA isolated from ovarian tissue. A fragment of the GAPDH gene could be amplified in all samples analysed, which indicates the presence of RNA in all samples. We have observed RNA from the PRY gene in testicular tissue and in untreated semen. Amplification of a PRY-specific fragment was not possible either in the sample with RNA isolated from Percoll-treated sperm, nor in the sample with RNA isolated from ovarian tissue. No expression of the PRY gene was observed in white blood cells either. From this, one may assume that the PRY mRNA found in the ejaculate is present in that fraction excluded by Percoll treatment, but not in white blood cells (data not shown).

To determine whether all four PRY genes are expressed in testicular tissue and whether PRY1 as well as PRY2 is alternatively spliced, we have amplified a region containing the alternatively spliced fragment and the region where a distinction between the four PRY genes can be made (Figure 1). Amplification showed two fragments on agarose gel electrophoresis, which were extracted from the gel and purified. Reamplification and sequencing of these fragments showed the expression of both PRY1 and PRY2. PRY1 and PRY2 are alternatively spliced.



View larger version (5K):
[in this window]
[in a new window]
 
Figure 1. Structure of the PRY gene. The five exons (1–5) and the alternative fragment (A) are indicated. The primers used to analyse cDNA sequences of the PRY gene are mentioned. Forward or reverse primers are indicated by arrows. x = two base pairs by which a distinction between the different copies of the PRY gene can be made.

 
Analysis of the RNA isolated from semen with normal sperm parameters showed the expression of PRY1 and PRY2; both are alternatively spliced.

Protein analysis
Immunocytochemistry on testicular tissues with normal spermatogenesis with an antibody specific for the PRY protein showed the presence of the PRY protein in a minor part of spermatids and spermatozoa (Figure 2). In one biopsy, with maturation arrest at the level of spermatocytes, no signal was observed. Control experiments with ovarian tissue were also negative, as well as control experiments with preimmune serum or when the primary antibody was omitted. Specificity of the antibody was confirmed by immunoblot analysis with an in-vitro-generated peptide against which the antibody was designed (Burry, 2000).



View larger version (130K):
[in this window]
[in a new window]
 
Figure 2. Immunocytochemistry with the PRY antibody (A, B, C, E) or preimmune serum (D) on testicular tissue with normal spermatogenesis (A) and testicular tissue with maturation arrest at the level of spermatocytes (B); ejaculated sperm and round cells (C, D, E). Staining was performed by using alkaline phosphatase–Fast Red (A, B) or the avidin–biotin–horseradish peroxidase method (C, D, E). Counterstaining was performed by using haematoxylin–eosin (A, B) or Methyl Green (C, D, E). The TUNEL reaction on ejaculated sperm showed apoptosis in sperm and round cells. Counterstaining was performed by using Methyl Green (F).

 
To investigate the localization of the protein in more detail, immunocytochemistry on a smear of ejaculated sperm was performed. At first, semen samples from the male partner of five infertile couples were analysed. A signal was observed in most of the spermatocytes or spermatids but only in a few spermatozoa (Figure 2). The percentage of cells that were positive for the PRY gene differed from patient to patient (Table I) and varied from 2.5 to 14.7%. Due to the staining procedure, the difference between elongating spermatids and sperm is hard to see and therefore some elongating spermatids might have been counted as sperm.

Since only a limited number of spermatozoa were stained and the percentage of positive cells was lower in patients with good sperm quality compared to patients with bad sperm quality, we thought that the PRY protein might be involved in apoptosis. Therefore, the number of PRY-positive sperm cells and the number of cells with DNA fragmentation was analysed to assess whether an association between PRY and apoptosis of germ cells does exist. At least three slides were prepared from semen samples of the male partner of 13 infertile couples (samples 6–18). Two slides were used for immunocytochemistry, while the third slide was used to detect DNA fragmentation by the TUNEL reaction. Two of these samples were first treated by swim-up purification (samples 7 and 8), in order to obtain a selection of mature and rapid progressively moving sperm. In this series, the percentage of PRY-positive cells varied from 1.5 to 51.2%, while the percentage of germ cells with DNA fragmentation ranged from 1.8 to 51.9% (Table III). The percentage of apoptotic cells correlated with the percentage of PRY-positive cells (P < 0.0001, r = 0.954). DNA fragmentation was also observed in sperm precursor cells.


View this table:
[in this window]
[in a new window]
 
Table III. The percentage of PRY-positive spermatozoa and the percentage of apoptotic spermatozoa
 
In a third series, immunocytochemistry and the TUNEL reaction were performed successively on the same slide to determine whether a population of spermatozoa simultaneously are positive for PRY and the TUNEL reaction. Some spermatozoa that were positive for the TUNEL reaction also expressed PRY, but most spermatozoa were either positive for the TUNEL reaction or for PRY (Table IV). Between 27 and 48% of the PRY-positive spermatozoa were also positive for the TUNEL reaction. On the other hand, 50–68% of the spermatozoa that were positive for the TUNEL reaction did not express PRY.


View this table:
[in this window]
[in a new window]
 
Table IV. Double staining of PRY and the TUNEL reaction
 
The two samples from series 2 that were purified by swim-up showed a low percentage of PRY-positive cells (1.5 and 1.7%), while the samples with a low concentration, low percentage of motile sperm or a low percentage of sperm with normal morphology showed high proportions of PRY-positive cells (Table I). Table V shows the (median) percentage of PRY-positive spermatozoa for samples with normal and abnormal semen parameters. Samples with normal concentration, >25% progressively motile sperm or >10% sperm with normal morphology according to the strict criteria showed 5.4, 4.8 and 5.1% positive spermatozoa respectively. On the other hand, samples with a low concentration, low motility rate or <10% normal sperm showed 18.8, 11.0 or 8.2% positive cells respectively. A significant difference was observed for the concentration and motility.


View this table:
[in this window]
[in a new window]
 
Table V. The median percentage (interquartile range) of PRY-positive cells for samples with normal or abnormal concentration, normal or abnormal percentage of rapid progressive sperm and normal or abnormal percentage of sperm cells with good morphology
 

    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
In a previous report, we characterized the PRY gene at the genomic level and sequenced cDNA sequences isolated from a testis-specific cDNA library (Stouffs et al., 2001). In this study, cDNA sequences isolated from fresh testicular tissues and ejaculated sperm have been analysed. We observed that only PRY1 and PRY2 are expressed in vivo and that both copies are alternatively spliced.

We have found PRY RNA in testicular tissue, from which it was first isolated (Lahn and Page, 1997) and in ejaculated sperm. However, no PRY mRNA was observed in Percoll-purified ejaculated sperm. This could indicate that the PRY gene is expressed in that fraction of the ejaculate that had been removed by the selection procedure on a density gradient. This fraction includes epithelial cells, abnormally shaped sperm, death cells, precursor cells and white blood cells. In white blood cells, no RNA from the PRY gene was observed.

These observations are supported by the results of immunocytochemistry, where a signal was observed in a small number of spermatids and spermatozoa in testicular tissue. In the ejaculates, a signal was observed in some spermatozoa and in a large number of spermatids. Ejaculates with normal semen parameters showed a low percentage of PRY-positive cells, while ejaculates with abnormal semen parameters showed a higher percentage of PRY-positive cells. In the literature, similar results were reported for apoptotic markers. This might suggest that the PRY gene is involved in apoptosis of germ cells. Therefore, we have assessed on separate slides with ejaculated sperm the proportion of cells with DNA fragmentation by using the TUNEL reaction and the proportion of cells that are positive for PRY. Since only a few apoptotic genes have so far been analysed in mature sperm (Sakkas et al., 1999, 2002; Weng et al., 2002), and since the specificity of Annexin V staining in mature sperm has been questioned in recent research (Gadella and Harrison, 2002; Kotwicka et al., 2002), we decided to assess apoptosis by using the TUNEL reaction, by which DNA fragmentation can be detected.

The percentage of cells with DNA fragmentation correlated with the percentage of PRY-positive cells. The percentage of apoptotic cells or PRY-positive cells in our study ranged from 1.5% in the case of swim-up-purified sperm to 52% for one sample with abnormal semen parameters, which is in accordance with the literature, reporting 1% apoptotic cells of swim-up-purified sperm (Younglai et al., 2001) to 96% in the case of testicular sperm from men with non-obstructive azoospermia (Tesarik et al., 2001). Several authors also described a correlation between apoptotic markers (DNA fragmentation, phosphatidyl serine externalization and FAS expression) and semen parameters, such as concentration, motility and morphology (Sakkas et al., 1999; Gandini et al., 2000; Oosterhuis et al., 2000; Ricci et al., 2002).

Apoptosis might be divided into three main stages: an initiator phase, an effector phase and a degradation phase. In the initiator phase, apoptosis is induced, e.g. by interaction of Fas with FasL, which leads to activation of the apoptotic cascade (the effector phase). The apoptotic cascade eventually results in degradation of the cell, of which DNA degradation is an important mechanism. Genes involved in induction or regulation of apoptosis are thus functional before DNA degradation occurs. Double labelling of PRY and the TUNEL reaction showed DNA fragmentation in an average of ~40% of the PRY-positive cells. Probably the PRY gene is involved in the initiatior or effector phase of apoptosis and thus expressed before DNA fragmentation occurs. This might explain why not all spermatozoa were positive for both PRY and the TUNEL reaction. The results of double labelling were sometimes difficult to interpret since the intensity of the TUNEL reaction and the immunocytochemistry was less than when compared to the single procedure. Cells that stained positive for both also showed a less intense staining compared to cells that were positive for either PRY or DNA fragmentation. Assuming that PRY is expressed before DNA fragmentation occurs, one might expect that the expression of PRY is fading away, while DNA fragmentation has just started. Sakkas et al. (2002) also described a limited number of spermatozoa that were positive for both Bcl-x and the TUNEL reaction or p53 and the TUNEL reaction.

It is not well understood whether apoptosis of sperm originates in testis or after the sperm has left the testis. Probably both mechanisms take place, since apoptosis can be induced in ejaculated sperm (Lopes et al., 1998; Gorga et al., 2001).

Apoptosis of sperm might be an important mechanism to eliminate abnormal or damaged sperm cells or possibly sperm cells with chromosome abnormalities. From this, one might presume that a defect in apoptosis might result in a low fertilization rate or a high miscarriage rate.

Also non-spermatogenic cells are stained by the TUNEL reaction and immunocytochemistry with an antibody against the PRY gene. Based on their morphological characteristics, presumably they are round spermatids in apoptosis. Since these cells are not in their natural environment in the ejaculate and since apoptosis eliminates misplaced cells, one may expect spermatids to be undergoing apoptosis.

The results of RNA analysis and immunocytochemistry show that the PRY gene is present in a few spermatids and spermatozoa in testis tissue and in most of the sperm precursor cells in ejaculates. PRY is also present in ejaculates in a percentage of spermatozoa that varies from patient to patient. This percentage is dependent on the quality of the ejaculate. From these overall results, we may conclude that the PRY gene probably has no function in spermatogenesis. In contrast, a function in apoptosis of spermatogenic cells is suggested. Therefore, we have determined the percentage of cells with DNA fragmentation in which apoptosis results. The proportion of sperm cells that expresses PRY is in the same range as the proportion of sperm cells with DNA fragmentation. The percentage of the cells that expresses PRY seems to correlate with the quality of the ejaculate. Although these results suggest a function in apoptosis, more direct functional analysis is necessary to prove a function of the PRY gene in apoptosis.


    Acknowledgements
 
We wish to thank the laboratory, clinical and paramedical staff of the centres for Medical Genetics, Reproductive Medicine and the Department of Pathology for their assistance. We also wish to thank Michael Whitburn of the Language Education Center for proof-reading the manuscript. The work was supported by grants from the Fund for Scientific Research (FWO-Vlaanderen) and from the Research Council and a Concerted Action of the Free University of Brussels (Vrije Universiteit Brussel).


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Burry RW (2000) Specificity controls for immunocytochemistry. J Histochem Cytochem 48,163–165.[Abstract/Free Full Text]

Gadella BM and Harrison RA (2002) Capacitation induces cyclic adenosine 3',5'-monophosphate-dependent, but apoptosis-unrelated, exposure of aminophospholipids at the apical head plasma membrane of boar sperm cells. Biol Reprod 67,340–350.[Abstract/Free Full Text]

Gandini L, Lombardo F, Paoli D, Caponecchia L, Familiari G, Verlengia C, Dondero F and Lenzi A (2000) Study of apoptotic DNA fragmentation in human spermatozoa. Hum Reprod 15,830–839.[Abstract/Free Full Text]

Gorga F, Galdiero M, Buommino E and Galdiero E (2001) Porins and lipopolysaccharide induce apoptosis in human spermatozoa. Clin Diagn Lab Immunol 8,206–208.[Abstract/Free Full Text]

Kotwicka M, Jendraszak M and Warchol JB (2002) Plasma membrane translocation of phosphatidylserine in human spermatozoa. Fol Histochem Cytobiol 40,111–112.

Lahn BT and Page DC (1997) Functional coherence of the Y chromosome. Science 278,675–680.[Abstract/Free Full Text]

Lopes S, Jurisicova A, Sun JG and Casper RF (1998) Reactive oxygen species: potential cause for DNA fragmentation in human spermatozoa. Hum Reprod 13,896–900.[Abstract/Free Full Text]

Oosterhuis GJ, Mulder AB, Kalsbeek-Batenburg E, Lambalk CB, Schoemaker J and Vermes I (2000) Measuring apoptosis in human spermatozoa: a biological assay for semen quality? Fertil Steril 74,245–250.[CrossRef][Web of Science][Medline]

Ricci G, Perticarari S, Fragonas E, Giolo E, Canova S, Pozzobon C, Guaschino S and Presani G (2002) Apoptosis in human sperm: its correlation with semen quality and the presence of leukocytes. Hum Reprod 17,2665–2672.[Abstract/Free Full Text]

Sakkas D, Mariethoz E and St John JC (1999) Abnormal sperm parameters in humans are indicative of an abortive apoptotic mechanism linked to the Fas-mediated pathway. Exp Cell Res 251,350–355.[CrossRef][Web of Science][Medline]

Sakkas D, Moffatt O, Manicardi GC, Mariethoz E, Tarozzi N and Bizzaro D (2002) Nature of DNA damage in ejaculated human spermatozoa and the possible involvement of apoptosis. Biol Reprod 66,1061–1067.[Abstract/Free Full Text]

Stouffs K, Lissens W, Van Landuyt L, Tournaye H, Van Steirteghem A and Liebaers I (2001) Characterization of the genomic organization, localization and expression of four PRY genes (PRY1, PRY2, PRY3 and PRY4). Mol Hum Reprod 7,603–610.[Abstract/Free Full Text]

Tesarik J, Greco E and Mendoza C (2001) Assisted reproduction with in-vitro-cultured testicular spermatozoa in cases of severe germ cell apoptosis: a pilot study. Hum Reprod 16,2640–2645.[Abstract/Free Full Text]

Weng S-L, Taylor SL, Morshedi M, Schuffner A, Duran EH, Beebe S and Oehninger S (2002) Caspase activity and apoptotic markers in ejaculated human sperm. Mol Hum Reprod 8,984–991.[Abstract/Free Full Text]

15 World Health Organization (1999) WHO Laboratory Manual for the Examination of Human Semen and Semen–Cervical Mucus Interaction, 4th edn. Cambridge University Press, Cambridge.

Younglai EV, Holt D, Brown P, Jurisicova A and Casper RF (2001) Sperm swim-up techniques and DNA fragmentation. Hum Reprod 16,1950–1953.[Abstract/Free Full Text]

Submitted on July 30, 2003; resubmitted on September 10, 2003; accepted on September 12, 2003.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Hum ReprodHome page
S.E. Kleiman, L. Yogev, R. Hauser, A. Botchan, B.B.-S. Maymon, G. Paz, and H. Yavetz
Expression profile of AZF genes in testicular biopsies of azoospermic men
Hum. Reprod., January 1, 2007; 22(1): 151 - 158.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
F. Brugnon, E. Van Assche, G. Verheyen, B. Sion, D. Boucher, J.L. Pouly, L. Janny, P. Devroey, I. Liebaers, and A. Van Steirteghem
Study of two markers of apoptosis and meiotic segregation in ejaculated sperm of chromosomal translocation carrier patients
Hum. Reprod., March 1, 2006; 21(3): 685 - 693.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Stouffs, K.
Right arrow Articles by Liebaers, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stouffs, K.
Right arrow Articles by Liebaers, I.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?