Skip Navigation


Mol. Hum. Reprod. Advance Access originally published online on September 10, 2004
Molecular Human Reproduction 2004 10(11):799-805; doi:10.1093/molehr/gah103
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
10/11/799    most recent
gah103v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Slater, D. M.
Right arrow Articles by Thornton, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Slater, D. M.
Right arrow Articles by Thornton, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Human Reproduction vol. 10 no. 11 © European Society of Human Reproduction and Embryology 2004; all rights reserved

Labour is associated with increased expression of type-IIA secretory phospholipase A2 but not type-IV cytosolic phospholipase A2 in human myometrium

Donna M. Slater1,4, Shirley Astle1, Phillip R. Bennett3 and Steven Thornton2

1Biomedical Research Institute, Department of Biological Sciences, 2Warwick Medical School, University of Warwick, Coventry CV4 7AL and 3Parturition Research Group, Institute of Developmental and Reproductive Biology, Imperial College School of Medicine, London W12 0NN, UK

4 To whom correspondence should be addressed at: Biomedical Research Institute, Department of Biological Sciences, University of Warwick, Coventry, CV4 7AL, UK. Email: d.m.slater{at}warwick.ac.uk


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Human labour is associated with increased prostaglandin synthesis within the uterus. The aim of this study was to examine the expression of the type-IV cytosolic phospholipase A2 (cPLA2-IV) and the type IIA secretory phospholipase A2 (sPLA2-IIA) in myometrium in association with labour onset at term and preterm deliveries. These enzymes are important for the release of the prostaglandin precursor, arachidonic acid, from phospholipid membrane stores. RT–PCR was used to determine differences in gene expression between non-labour and labour groups. Expression of sPLA2-IIA in human myometrium was significantly increased with pregnancy, and with labour, both at term and preterm. Expression of cPLA2-IV in myometrium was not significantly altered with respect to pregnancy or labour. Immunohistochemical analysis demonstrated differences in the spatial localization of cPLA2-IV and sPLA2-IIA protein in upper and lower segment myometrium. cPLA2-IV was predominantly in vascular endothelial cells, while sPLA2-IIA was observed in vascular, endothelial and smooth muscle cells. In addition, sPLA2-IIA showed a distinct nuclear or perinuclear localization in myometrial smooth muscle cells of the lower segment. We postulate that the increased expression of sPLA2-IIA rather than cPLA2-IV in the myometrium may play a role in the onset and/or maintenance of human parturition.

Key words: cPLA2/labour/myometrium/preterm/sPLA2


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The molecular mechanisms for the onset and maintenance of labour at term are not fully understood; however, prostaglandins are strongly implicated (Skinner and Challis, 1985Go). The synthesis of prostaglandins can be divided into three main stages, each of which may be rate-limiting. The first involves the mobilization of the precursor arachidonic acid from membrane phospholipids, by phospholipase enzymes. The free arachidonic acid is then converted to the prostaglandin intermediate, prostaglandin H2 (PGH2) in the second step by the action of cyclo-oxygenase (COX). Finally PGH2 is converted to prostaglandins of the E, F, thromboxane, and prostacyclin series by specific PG synthase enzymes.

Two isoforms of COX, coded by two distinct genes, have been described; the constitutively expressed COX-1 and the inducible COX-2 (Hla et al., 1986Go; Hla and Neilson, 1992Go). COX-2, but not COX-1, expression increases in association with labour in fetal membranes and myometrium, and is thus likely to play a role in the increased prostaglandin synthesis observed within the uterus at term (Hirst et al., 1995Go; Slater et al., 1995Go, 1999Go; Smieja et al., 1993Go). Any increases in COX activity may also require a concomitant increase in the release of the prostaglandin precursor, arachidonic acid. This step is catalysed by the action of one or more phospholipase A2 (PLA2) enzymes, which release arachidonic acid from the sn-2 position of intracellular membrane phospholipids. Numerous distinct PLA2 isoforms have been identified, differing in molecular size, cellular localization, Ca2+ dependence and substrate specificity (Balsinde et al., 1999Go). They are broadly categorized into two classes; the secretory phospholipases (ranging from 13 to 18 kDa) which require millimolar Ca2+ for catalysis, and the larger cytosolic forms (ranging from 30 to 110 kDa) with no catalytic requirement for Ca2+. The secretory PLA2 (sPLA2) enzymes are further classified into groups I, II, III, V and X, and the cytosolic PLA2 (cPLA2) enzymes into groups IV, VI, VII and VIII (review: Six and Dennis, 2000Go; Gelb et al., 2000Go).

To date, only sPLA2 type-IIA, sPLA2 type-V and cPLA2-type-IV have been identified within the human uterus (Lappas and Rice, 2004Go). Human labour is not associated with changes in sPLA2-IIA expression or activity in human fetal membranes or placenta (Okazaki et al., 1981Go; Lopez Bernal et al., 1992Go; Aitken et al., 1990Go, 1996Go; Bennett et al., 1994Go; Freed et al., 1997Go). However, cPLA2-IV activity, in fetal amnion, is highest prior to labour and decreases following labour onset, suggesting that cPLA2-IV mobilization of arachidonic acid is highest immediately prior to and in anticipation of labour, but becomes depleted during labour (Skannal et al., 1997aGo). Both cPLA2-IV and sPLA2-IIA protein has been identified in lower segment pregnant human myometrium (Skannal et al., 1997bGo), but there is no available data on gestational or labour-associated changes.

The aims of this study therefore were to determine whether there were any changes in the mRNA expression of cPLA2 type-IV and or sPLA2 type-IIA in human myometrium, in association with labour at term or preterm. To determine if there were any differences in the spatial localization of cPLA2-IV or sPLA2-IIA between upper and lower segment myometrial samples, we have performed immunohistochemical localization. In order to verify that mRNA expression levels correlate positively to those of the protein, we also analysed the relative abundance of cPLA2-IV and/or sPLA2-IIA mRNA and protein levels in fetal membranes and placenta by RT–PCR and western analysis respectively.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Patient samples
All tissues were collected following informed written consent and institutional Ethics Committee approval (Walsgrave Hospital Trust, Coventry, UK). Myometrial samples were collected from the upper edge of the uterine incision during lower segment Caesarean section (lower segment samples) and paired samples were collected from the upper uterine segment with biopsy forceps (upper segment samples). Myometrial tissue was separated from any serosal or decidual components using a dissection microscope. Paired (upper and lower segment) myometrial biopsies were collected from women undergoing Caesarean section (CS) at term, not in labour (TNL) or in labour (TL), and preterm, not in labour (PTNL) or preterm in labour (PTL). The TNL group (n=14) comprised a gestational age range of 37–40 weeks; reasons for CS were: maternal request, breech presentation or previous Caesarean section. The TL group (n=9) comprised a gestational age range of 38–41 weeks and all with spontaneous onset of labour. All patients had regular contractions and cervical dilatation (dilation ≥3 cm n=2, 4–5 cm n=2, 6 cm n=1, 7 cm n=1, 9 cm n=2, full n=1). Reasons for CS were: fetal distress (n=5), previous section combined with high head and large baby (n=1), interauterine growth retardation (IUGR) (n=1), all without oxytocin or prostaglandin administration. Two patients had oxytocin administration and were delivered for failure to progress. The PTNL group (n=7) had a gestational age range of 28–35 weeks. There was no evidence of uterine contractions or cervical change and reasons for CS were: fetal distress, twin pregnancy or IUGR. The preterm PTL group (n=4) comprised gestation ages of 27–35 weeks; reasons for CS were: fetal distress, transverse or breech presentation. Non-pregnant myometrium was obtained (n=4) with consent from women undergoing hysterectomy for dysmenorrhoea. Fetal membranes and placenta were also collected at term at elective Caesarean section prior to labour (in cases of breech presentation of previous Caesarean section) or following spontaneous vaginal delivery. Tissues were rinsed in phosphate-buffered saline (PBS), snap-frozen in liquid nitrogen and stored at –80°C prior to RNA or protein isolation. Paired upper and lower segment myometrium was also collected for immunohistochemical analysis. Myometrial samples were separated from serosal or decidual components, viewed under a dissection microscope

RT–PCR
RNA was isolated using an SV Total RNA Isolation System (Promega, UK). RT–PCR was used for semiquantitative analysis of RNA expression. Reverse transcription was carried out using random hexanucleotide primers, and the resultant complementary DNA (cDNA) used as template for PCR, using gene-specific primers. Total RNA (100–500 ng) was first denatured at 70°C for 5 min, followed by reverse transcription with Superscript II (Gibco BRL) at 37°C for 60 min. The resultant cDNA was utilized for subsequent PCR amplification as described previously (Slater et al., 1995Go). PCR primers (5'–3') were: cPLA2-IV (GenBank accession number D38178) GAGCTGATGTTTGCAGATTGGGTTG (sense), GTCACTCAAAGGAGACAGTGGATAAGA (antisense) (Clark et al., 1991Go; Sharp et al., 1991Go); sPLA2-IIA (accession number NM 000300) GCTGTGTCACTCATGACTGTT (sense), GGAGTACAGCTTCTTTGGTAA (antisense) (Seilhamer et al., 1989Go); glyceraldehyde-3-phosphatedehydrogenase (GAPDH), CCACCCATGGCAAATTCCATGGCA (sense), TCTAGACGGCAGGTCAGGTCCACC (antisense). Product sizes were 509, 478 and 598 base pairs respectively. Cycling parameters were: denaturing, 94°C, 30 s; 55°C, annealing 30 s; extension, 72°C, 30 s for an appropriate number of cycles and followed by a 72°C, 5 min extension. Following amplification, PCR products were analysed by agarose gel electrophoresis, subcloned into the pGEM®-T Easy vector (Promega, UK) and verified by sequencing.

For each target gene to be analysed, a ‘cycle profile’ was performed to determine the linear range of amplification where product formation is related to starting template. An aliquot from each myometrial cDNA sample was taken and pooled. This ‘pooled’ sample was then used as template for PCR cycle profiles. Cycles were carried out from 20 to 36, at two cycle intervals. Following amplification, 10 µl aliquots of the reactions were subject to agarose gel electrophoresis and PCR products stained with ethidium bromide and visualized under UV light. Abundance of amplified product was performed by densitometric analysis of the gel using Total Lab software (Newcastle upon Tyne). Densitometric units were plotted against cycle number to establish the exponential phase of amplification. The appropriate cycle number within the linear range of amplification was chosen for subsequent analysis of each gene. The number of PCR cycles within the linear range of amplification was 30–36 and so 33 cycles were used for subsequent experiments to determine the relative abundance of either sPLA2-IIA or cPLA2-IV within the myometrium. Expression levels of cPLA2-IV and sPLA2-IIA mRNA were normalized to GAPDH.

Western blotting
Protein extracts were prepared from fetal membrane and placenta by homogenization in T-wash (50 mmol/l Tris buffer, 10 mmol/l EDTA pH 8.0, 1% Triton-100 with 10 mmol/l phenylmethylsulphonyl fluoride, 4 µg/ml pepstatin and 0.5 µg/ml leupeptin. Proteins (20 µg) were separated on a 10% sodium dodecyl sulphate–polyacrylamide gel and transferred onto Hybond ECL nitrocellulose membranes (Amersham). Transfer efficiency and equal loading of proteins was assessed by staining with Ponceau Red solution (Sigma). After transfer, membranes were washed with PBS-T (PBS, 0.1% Tween-20; Sigma) and following an incubation in blocking buffer, subsequently incubated overnight at 4°C, with cPLA2-IV (Santa Cruz) (dilution 1/1000) or sPLA2-IIA (Cayman Chemical) (dilution 1/1000) primary antibody. After incubation with the primary antibody, membranes were washed and incubated (1 h room temperature) with an IgG horseradish peroxidase-conjugated secondary antibody (dilution1/10 000). Thereafter membranes were washed in PBS-T and protein bands visualized by enhanced chemiluminescence western blotting detection (Amersham Pharmacia Biotech Ltd).

Immunohistochemistry
Myometrial tissue sections (5 mm) were deparaffinized in xylene and rehydrated by passing through a graded alcohol series. Antigen retrieval was performed using 1% antigen unmasking solution (Vector Laboratories) incubated at 96°C for 60 min. To localize the phospholipases the Vectastain Elite ABC detection kit (Vector) was used following the manufacturer's protocol. Briefly, endogenous peroxidase activity was quenched by incubation in 3% hydrogen peroxide, tissue sections were then blocked in 10% antibody host serum in PBS at room temperature for 60 min and incubated overnight with the desired polyclonal primary antibody at 4°C. Primary antibodies, sPLA2-IIA (Cayman Chemicals) and cPLA2-IV (Santa Cruz) were diluted 1:100 in 10% serum/PBS. Incubation of the sections with pre-absorbed antibody or omitting of the primary antibody gave no staining. The colour reaction was developed with a biotinylated secondary antibody (30 min room temperature), addition of avidin/biotinylated complex (30 min room temperature) followed by incubation with 3,3'-diaminobenzide tetrahydrochloride (DAB) solution with metal enhancer (Sigma). Sections were counterstained using Harris haematoxylin (Sigma), dehydrated in an increasing ethanol series, cleared in xylene and the coverslips mounted in DPX mounting media (BDH).

Statistics
Data were analysed within groups, estimating the mean and SE. Statistical significance was determined using analysis of variance, followed by a post-hoc test with the StatView 4.5 statistics software (Abacus Concepts Inc., Berkeley, USA).


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
cPLA2-IV mRNA was expressed in all pregnant and non-pregnant myometrial samples, while sPLA2-IIA was only expressed in pregnant myometrium (Figure 1).



View larger version (48K):
[in this window]
[in a new window]
 
Figure 1. Representative data demonstrating expression of (a) type-IV cytosolic phospholipase A2 (cPLA2-IV), (b) type IIA secretory phospholipase A2 (sPLA2-IIA), (c) glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA in pregnant and non-pregnant myometrium by RT–PCR. Lane 1: pregnant myometrium; lane 3: non-pregnant myometrium; lanes 2 and 4: negative control RT–PCR reactions for 1 and 3 respectively. Lane 5 contains a 1 kb DNA marker.

 
There were no significant changes in the expression of cPLA2-IV mRNA with gestational age or labour in either upper or lower segment samples (Figure 2). By contrast, in lower segment myometrium, expression of sPLA2-IIA was significantly increased in association with labour both at term and preterm (Figure 3a). Expression of sPLA2-IIA was significantly higher in the PTL compared to PTNL (P<0.05) and in the TL group compared to the TNL group (P<0.05). In the upper segment samples, expression of sPLA2-IIA was significantly higher in the PTL group compared to the PTNL (P<0.05). There was also a non-significant increase of sPLA2-IIA expression in TL compared to TNL samples (Figure 3b).



View larger version (11K):
[in this window]
[in a new window]
 
Figure 2. Type-IV cytosolic phospholipase A2 (cPLA2-IV) mRNA expression in lower segment (left panel) and upper segment myometrium (right panel) during labour at term and preterm. Graph shows results expressed as mean and SE of individual ratio of densitometric units over glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Groups are preterm non-labour (PTNL) n=7, preterm labour (PTL) n=4, term non-labour (TNL) n=14 and term labour (TL) n=9.

 


View larger version (12K):
[in this window]
[in a new window]
 
Figure 3. Type IIA secretory phospholipase A2 (sPLA2-IIA) mRNA expression in lower segment (left panel) and upper segment myometrium (right panel), during labour at term and preterm. Graph shows results expressed as mean and SE of individual ratio of densitometric units over glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Groups are preterm non-labour (PTNL) n=7, preterm labour (PTL) n=4, term non-labour (TNL) n=14 and term labour (TL) n=9. Significance was *P<0.05 and **P<0.005.

 
In both lower and upper segment myometrium samples, cPLA2-IV protein was most abundantly localized by immunohistochemical staining within the endothelial cells of blood vessels (Figure 4a). A faint and diffuse cytoplasmic distribution of cPLA2-IV expression was observed in lower segment myometrial smooth muscle cells (Figure 4b). Expression of cPLA2-IV protein was also found in decidual cells with a distinct pattern of staining observed around the periphery (Figure 4c).



View larger version (132K):
[in this window]
[in a new window]
 
Figure 4. Representative immunolocalization of type-IV cytosolic phospholipase A2 (cPLA2-IV) protein in lower segment (a), (b), (d), and upper segment (c), myometrium at term. cPLA2-IV protein was localized to (a) endothelial cells of myometrial vessels, (b) myometrial smooth muscle cells and (c) decidual cells. No immunostaining was observed when myometrial tissue sections were incubated with pre-absorbed primary antibodies. Panels (d), (e) and (f) show control incubations of (a), (b) and (c) respectively.

 
Strong immunostaining for sPLA2-IIA was observed in both the endothelial and smooth muscle cells of the myometrial vessels (Figure 5a). In myometrial smooth muscle cells of lower segment samples, sPLA2-IIA tended to be localized on and around the nucleus, while in the upper segment myometrial smooth muscle, there appeared to be less nuclear but more cytoplasmic staining (Figure 5b LS and 5d US). Staining for sPLA2-IIA was also observed in lower segment stromal cells (Figure 5c) and in glandular epithelial cells of the upper segment (Figure 5e). In general the expression of sPLA2-IIA had a more distinct cellular localization compared to cPLA2-IV which was much more diffuse (except for that found around the periphery of the decidual cells). Exclusion of primary antibody, or pre-absorption with the antigen peptide, eliminated positive staining (Figures 4d–f and 5f–j).



View larger version (94K):
[in this window]
[in a new window]
 
Figure 5. Representative immunolocalization of type IIA secretory phospholipase A2 (sPLA2-IIA) protein in lower segment (a), (b), (c), and upper segment (d) and (e) myometrium at term. Panels (f), (g), (h), (i) and (j) show control incubations of (a), (b), (c), (d) and (e) respectively.

 
In fetal membranes and placenta, expression of cPLA2-IV and sPLA2-IIA mRNA correlated with that of the protein, as determined by RT–PCR and western analysis respectively (n=6 each). Expression of cPLA2-IV mRNA and protein was highest in the amnion and chorio-decidua compared to placenta (Figure 6a). By contrast, levels of sPLA2-IIA mRNA and protein were highest in chorio-decidua and placenta compared to the amnion (Figure 6b).



View larger version (43K):
[in this window]
[in a new window]
 
Figure 6. Representative data showing positive correlation of (a) type-IV cytosolic phospholipase A2 (cPLA2-IV) and (b) sPLA2-IIA mRNA with protein expression in fetal amnion (Am) and chorio-decidua (Ch) membranes and placenta (Pl) by RT–PCR and western blotting (c) shows glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RT–PCR used to normalize mRNA levels.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
We have demonstrated that expression of sPLA2-IIA is significantly up-regulated in pregnant compared to non-pregnant, and in labour, both at term and preterm, compared to non-labour myometrium. In contrast, cPLA2-IV expression was not significantly different in non-pregnant compared to pregnant or in labouring compared to non-labouring myometrium. We have also compared localization of cPLA2-IV and sPLA2-IIA between upper and lower segment myometrial samples.

Prostaglandins have long been implicated in the process of parturition. Inhibition of prostaglandin synthesis can lengthen gestation and delay labour in several species including humans (Lewis and Schulman, 1972Go). Previous studies have demonstrated that the COX-2 enzyme is up-regulated in fetal membranes and myometrium in late pregnancy and in association with labour (Hirst et al., 1995Go; Slater et al., 1995Go, 1999Go; Erkinheimo et al., 2000Go). However, prior to its utilization by COX, arachidonic acid must be released from membrane phospholipid stores by the action of phospholipases. Using RT–PCR to determine the relative abundance of cPLA2-IV and sPLA2-IIA, we have demonstrated increased expression of sPLA2-IIA 2, but not cPLA2-IV, in association with pregnancy and labour in human myometrium. This suggests that sPLA2-IIA, in addition to COX-2, may be one of the ‘pro-labour’ factors associated with late pregnancy, thus implying a role for sPLA2-IIA in the increased prostaglandin synthesis associated with the process of human parturition. By contrast, we were unable to detect any changes in the expression of cPLA2-IV mRNA either with increasing gestation or in association with labour. This is in concordance with data in the sheep whereby cPLA2-IV mRNA and protein were detected in myometrium but did not alter in association with labour (Zhang et al., 1996Go).

To verify whether the changes in mRNA are likely to predict changes in the corresponding protein, we examined the expression of both mRNA and protein by RT–PCR and western analysis respectively in fetal membranes and placenta. Levels of sPLA2-IIA mRNA were predictive of protein levels, with the highest expression in the placenta and chorio-decidua, compared to amnion. A positive correlation between mRNA and protein for cPLA2-IV was also shown, with expression highest in amnion and chorio-decidua and low in placenta. This positive correlation of mRNA and protein expression for both the sPLA2-IIA and the cPLA2-IV is important as it was not always possible to obtain enough myometrial tissue to analyse both mRNA and protein in the same samples. We are therefore confident that the increased expression of sPLA2-IIA mRNA observed during labour both at term and preterm in human myometrium is likely to result in increased expression of sPLA2-IIA protein.

No labour-associated changes of sPLA2-IIA expression have been shown in amnion, chorio-decidua or placenta (Munns et al., 1999Go); however, increased sPLA2-IIA levels may be associated with the spontaneous rupture of membranes (Lappas et al., 2001Go). Koyama et al. (2000)Go demonstrated increased levels of sPLA2-IIA in serum and amniotic fluid of women in preterm labour with and without chorio-amnionitis and suggested that measurement of sPLA2-IIA might be useful for preterm labour prediction. Indeed sPLA2 is considered a potent mediator of inflammation. It is up-regulated by cytokines, such as interleukin-1, which increases throughout gestation and in association with labour in fetal membranes (Keelan et al., 1999Go; Elliott et al., 2001Go) and amniotic fluid (Romero et al., 1992Go). Recent studies have demonstrated that inhibition of sPLA2-IIA mRNA expression, enzyme activity and prostaglandin production in placental explant cultures can be achieved using anti-sense oligonucleotides directed against the sPLA2 gene (Lappas et al., 2001Go). Thus as myometrial sPLA2 mRNA levels are increased in association with preterm labour, the use of anti-sense technology for inhibition of this enzyme may provide novel therapeutic intervention.

Although we have identified that myometrial expression of sPLA2-IIA increases during labour, the question remains as to what is the precise function of the enzyme. Beside its role in the release of arachidonic acid for generation of prostaglandins and other second messengers, sPLA2-IIA has also been attributed to additional functions, including regulation of apoptosis, anticoagulation, exocytosis and cell migration. It also has a number of antibacterial properties, apparently most effective against Gram-positive bacteria (review Kudo and Murakami, 2002Go; Lappas and Rice, 2004Go). It should be noted that whilst great care was taken to remove decidual and serosal components from myometrial biopsies using a dissection microscope, some of this tissue remained. Indeed, the immunohistochemistry results demonstrate that in addition to being localized in myometrial smooth muscle and endothelial cells of myometrial vessels, sPLA2-IIA was localized to glands and cPLA2-IV to decidual cells of the upper segment myometrium. Perhaps the answer, as to the role of sPLA2-IIA in human myometrial tissue, lies more with the precise cellular and intracellular localization of this enzyme. Production of sPLA2-IIA by endothelial cells of myometrial vessels may lead to increased prostacyclin production (Murakami et al., 1993Go), while the production of sPLA2-IIA by the glands in upper segment may have an exocrine role. The distinct localization of sPLA2-IIA to the nuclear and perinuclear region of myometrial smooth muscle cells has implications for downstream genomic effects. Further evidence in support of this is emerging, and suggests that a number of enzymes involved in prostaglandin synthesis, such as cPLA2, COX-1, COX-2, microsomal prostaglandin E2 synthase and possibly the prostaglandin receptors themselves, do localize to nuclear and perinuclear regions under various conditions and in distinct cell types. Taken together these data add to the complexity by which the various prostaglandins may elicit their effects (Bhattacharya et al., 1998Go; Freeman et al., 1998Go; Gobeil et al., 2003Go; Helliwell et al., 2004Go).

The precise function(s) of the different isoforms of sPLA2 within the uterus, is further complicated by the recent molecular cloning of a gene encoding a large sPLA2 receptor protein, which can exist as a membrane-bound or a secreted soluble form, both with the ability to bind sPLA2. A number of functions of this receptor have been proposed and investigated. These include cell proliferation, hormone release, prostaglandin production and internalization of sPLA2. Thus, in the case of sPLA2 internalization, binding to the receptor may increase clearance of circulating sPLA2 and lead ultimately to inhibition of its catalytic activity (Ancian et al., 1995Go; review: Hanasaki and Arita, 2002Go). The sPLA2-receptor is expressed in human amnion, chorion-decidua and placenta with highest expression being observed in the placenta (Moses et al., 1998Go). It is also the placenta that demonstrates the highest levels of sPLA2-IIA mRNA (Freed et al., 1997Go; Figure 6). In addition we have identified the sPLA2-receptor in pregnant and non-pregnant myometrium (Zervou et al., 2001). The presence of a sPLA2-receptor mRNA in human myometrium has implications for a non-catalytic pathway contributing to the regulation of sPLA2 enzymes in this tissue. However, its function within gestational tissues is at present unclear.

In conclusion, this study demonstrates up-regulation of sPLA2-IIA in human myometrium both at term and preterm. Future studies should address the transcriptional regulation of sPLA2 within the various distinct cell types and also to determine whether the sPLA2 receptor, via interactions with sPLA2-IIA, does indeed have a functional role within the pregnant human myometrium.


    Acknowledgements
 
This work was supported by grants from Wellbeing and the Research Teaching Development Fund (University of Warwick). We would like to thank Dr J.Marsh, Department of Statistics, University of Warwick for statistical advice.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Aitken MA, Rice GE and Brennecke SP (1990) Gestational tissue phospholipase A2 mRNA content and the onset of spontaneous labour in humans. Reprod Fertil Dev 2, 575–580.[CrossRef][Medline]

Aitken MA, Thomas T, Brennecke SP, Scott KF and Rice GE (1996) Localization of type II phospholipase A2 messenger RNA and immunoactivity in human placenta and fetal membranes. Placenta 17, 423–429.[CrossRef][Web of Science][Medline]

Ancian P, Lambeua G, Mattei M and Lazdunski M (1995) The human 180-kDa receptor for secretory phospholipases A2. J Biol Chem 270, 8963–8970.[Abstract/Free Full Text]

Balsinde J, Balboa MA, Insel PA and Dennis EA (1999) Regulation and inhibition of phospholipase A2. Annu Rev Pharmacol Toxicol 39, 175–189.[CrossRef][Web of Science][Medline]

Bennett PR, Slater DM and Moore G (1994) Changes in the expression of phospholipase A2 and lipocortins (annexins) I, II, and V in placenta and fetal membranes at term. Prostaglandins 48, 81–89.[CrossRef][Web of Science][Medline]

Bhattacharya M, Peri KG, Almazan G et al. (1998) Nuclear localization of prostaglandin E2 receptors. Proc Natl Acad Sci USA 95, 15792–15797.[Abstract/Free Full Text]

Clark JD, Lin LL, Kriz RW et al. (1991) A novel arachidonic acid-selective cytosolic PLA2 contains a Ca2+ dependent translocation domain with homology to PKC and GAP. Cell 65, 1043–1051.[CrossRef][Web of Science][Medline]

Elliott CL, Loudon JA, Brown N, Slater DM, Bennett PR and Sullivan MH (2001) IL-1beta and IL-8 in human fetal membranes: changes with gestational age, labor, and culture conditions. Am J Reprod Immunol 46, 260–267.

Erkinheimo T, Saukkonen K, Narko JJ, Ylikorkala O and Ristimaki A (2000) Expression of cyclo-oxygenase-2 and prostanoid receptors by human myometrium. J Clin Endocrinol Metab 85, 3468–3475.[Abstract/Free Full Text]

Freed KA, Moses EK, Brennecke SP and Rice GE (1997) Differential expression of type II, IV and cytosolic PLA2 messenger RNA in human intrauterine tissues at term. Mol Hum Reprod 3, 493–499.[Abstract/Free Full Text]

Freeman EJ, Ruehr ML and Dorman RV (1998) Angiotensin II-induced translocation of cPLA2 to the nucleus in vascular smooth muscle cells. Am J Physiol 274, C282–C288.

Gelb MH, Valentin E, Ghomaschi F, Lazdunski M and Lambeau G (2000) Cloning and recombinant expression of a structurally novel human secreted phospholipase A2. J Biol Chem 275, 39823–39826.[Abstract/Free Full Text]

Gobeil F, Vazquez-Tello A, Marrache AM, Bhattacharya M, Checchin D, Bkaily G, Lachapelle P, Ribeiro-Da-Silva A and Chemtob S (2003) Nuclear prostaglandin signalling system: biogenesis and actions via heptaheilcal receptors. Can J Physiol Pharmacol 81, 196–204.[CrossRef][Web of Science][Medline]

Hanasaki K and Arita H (2002) Phospholipase A2 receptor: a regulator of biological functions of secretory phospholipase A2. Prost Lipid Mediat 68-69, 71–82.

Helliwell RJA, Berry EBE, O'Carroll SJ and Mitchell MD (2004) Nuclear prostaglandin receptors: role in pregnancy and parturition. Prostagl Leuk Essen Fatty Acids 70, 149–165.

Hirst JJ, Teixeira FJ, Zakar T and Olson DM (1995) Prostaglandin endoperoxide-H synthase-2 expression increases in human gestational tissues with spontaneous labour onset. Reprod Fertil Dev 7, 633–637.[CrossRef][Medline]

Hla T and Neilson K (1992) Human cyclo-oxygenase-2 cDNA. Proc Natl Acad Sci USA 89, 7384–7388.[Abstract/Free Full Text]

Hla T, Farrell M, Kumar A and Bailey JM (1986) Isolation of cDNA for human prostaglandin H synthase. Prostaglandins 32, 829–845.[CrossRef][Web of Science][Medline]

Keelan JA, Marvin KW, Sato TA, Coleman M, McCowan LM and Mitchell MD (1999) Cytokine abundance in placental tissues: evidence of inflammatory activation in gestational membranes with term and preterm parturition. Am J Obstet Gynecol 181, 1530–1536.[CrossRef][Web of Science][Medline]

Koyama M, Ito S, Nakajima A et al (2000) Elevations of group II phospholipase A2 concentrations in serum and amniotic fluid in association with preterm labor. Am J Obstet Gynecol 183, 1537–1543.[CrossRef][Web of Science][Medline]

Kudo I and Murakami M (2002) Phospholipase A2 enzymes. Prostagl Lipid Mediat 68-69, 3–58.

Lappas M and Rice GE (2004) Phospholipase A2 isozymes in pregnancy and parturition. Prostagl Leuk Essent Fatty Acids 70, 87–100.

Lappas M, Munns MJ, King RG and Rice GE (2001) Antisense oligonucleotide inhibition of type II phospholipase A2 expression, release and activity in vitro. Placenta 22, 418–424.[CrossRef][Web of Science][Medline]

Lewis RB and Schulman JD (1972) Influence of acetylsalicylic acid, an inhibitor of prostaglandin synthesis, on the duration of human gestation and labour. Lancet 2, 1159–1161.[Web of Science][Medline]

Lopez Bernal A, Newman GE, Phizackerley PJR, Bryant-Greenwood G and Keeling JW (1992) Human placental phospholipase A2 activity in term and preterm labour. Eur J Obstet Gynecol Reprod Biol 43, 185–192.[Web of Science][Medline]

Munns MJ, Farrugia W, King RG and Rice GE (1999) Secretory type II PLA2 immuno-reactivity and PLA2 enzymatic activity in human gestational tissues before, during and after spontaneous-onset labour at term. Placenta 20, 21–26.[CrossRef][Web of Science][Medline]

Moses EK, Freed K, Brennecke SP and Rice GE (1998) Distribution of the phospholipase A2 receptor messenger RNA in human gestational tissues. Placenta 19, 35–40.[Web of Science][Medline]

Murakami M, Kudo I and Inoue K (1993) Molecular nature of phospholipases A2 involved in prostaglandin I2 synthesis in human umbilical vein endothelial cells: possible participation of cytosolic and extracellular type II phospholipases A2. J Biol Chem 268, 839–844.[Abstract/Free Full Text]

Okazaki T, Sagawa N, Bleasedale JE, Okita JR, McDonald PC and Johnston JM (1981) Initiation of human parturition. XIII. Phospholipase C, phospholipase A2 and diacylglycerol lipase activities in fetal membranes and decidua vera from early and late gestation. Biol Reprod 25, 103–108.[Abstract]

Romero R, Mazor M, Brandt F, Sepulveda W, Avila C, Cotton DB and Dinarello CA (1992) Interleukin-1 beta in preterm and term human parturition. Am J Reprod Immunol 27, 117–123.

Seilhamer JJ, Pruzanski W, Vadas P et al. (1989) Cloning and recombinant expression of phospholipase A2 present in rheumatoid arthritic synovial fluid. J Biol Chem 264, 5335–5338.[Abstract/Free Full Text]

Sharp JD, White DL, Chiou XG et al. (1991) Molecular cloning and expression of human Ca2+ sensitive cytosolic PLA2. J Biol Chem 266, 14850–14853.[Abstract/Free Full Text]

Six DA and Dennis EA (2000) The expanding superfamily of phospholipase A2 enzymes: classification and characterization. Biochim Biophys Acta 1488, 1–19.[Medline]

Skannal DG, Brockman DE, Eis ALW, Xue S, Siddiqi T and Myatt L (1997a) Changes in activity of cytosolic phospholipase A2 in human amnion at parturition. Am J Obstet Gynecol 177, 179–184.[CrossRef][Web of Science][Medline]

Skannal DG, Eis ALW, Brockman DE, Siddiqi T and Myatt L (1997b) Immunohistochemical localization of phospholipase A2 isoforms in human myometrium during pregnancy and parturition. Am J Obstet Gynecol 176, 878–882.[CrossRef][Web of Science][Medline]

Skinner KA and Challis JRG (1985) Changes in the synthesis and metabolism of prostaglandins by human fetal membranes and decidua at labour. Am J Obstet Gynecol 151, 519–523.[Web of Science][Medline]

Slater DM, Berger L, Newton R, Moore GE and Bennett PR (1995) Expression of cyclo-oxygenase types-1 and 2 in human fetal membranes at term. Am J Obstet Gynecol 172, 77–82.[CrossRef][Web of Science][Medline]

Slater DM, Dennes WJB, Campa JS, Poston L and Bennett PR (1999) Expression of cyclo-oxygenase types-1 and -2 in human myometrium throughout pregnancy. Mol Hum Reprod 5, 880–884.[Abstract/Free Full Text]

Smieja Z, Zakar T, Waton JC and Olson DM (1993) Prostaglandin endoperoxide synthase kinetics in human amnion before and after labour at term and following preterm labour. Placenta 14, 163–175.[CrossRef][Web of Science][Medline]

Zervou S, Thornton S and Slater DM (2001) Expression of a secretory phospholipase A2 receptor in human myometrium: relation to gestational age and labour onset. J Soc Gyn Invest 8, 136.

Zhang Q, Wu WX, Brenna JT and Nathanielsz PW (1996) The expression of cytosolic phospholipase A2 and prostaglandin endoperoxide synthase in ovine maternal uterine and fetal tissues during late gestation and labor. Endocrinology 137, 4010–4017.[Abstract]

Submitted on July 19, 2004; accepted on August 16, 2004.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Reproductive SciencesHome page
M. O'Brien, J. J. Morrison, and T. J. Smith
Upregulation of PSCDBP, TLR2, TWIST1, FLJ35382, EDNRB, and RGS12 Gene Expression in Human Myometrium at Labor
Reproductive Sciences, April 1, 2008; 15(4): 382 - 393.
[Abstract] [PDF]


Home page
ReproductionHome page
M. G. Farina, S. Billi, G. Leguizamon, C. Weissmann, T. Guadagnoli, M. L. Ribeiro, and A. M. Franchi
Secretory and cytosolic phospholipase A2 activities and expression are regulated by oxytocin and estradiol during labor
Reproduction, August 1, 2007; 134(2): 355 - 364.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
S. Astle, R. Newton, S. Thornton, M. Vatish, and D.M. Slater
Expression and regulation of prostaglandin E synthase isoforms in human myometrium with labour
Mol. Hum. Reprod., January 1, 2007; 13(1): 69 - 75.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
S.R. Sooranna, P.L. Grigsby, N. Engineer, Z. Liang, K. Sun, L. Myatt, and M.R. Johnson
Myometrial prostaglandin E2 synthetic enzyme mRNA expression: spatial and temporal variations with pregnancy and labour
Mol. Hum. Reprod., October 1, 2006; 12(10): 625 - 631.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
K. Brant, W. Guan, P. Tithof, and R. L. Caruso
Gestation Age-Related Increase in 50-kDa Rat Uterine Calcium-Independent Phospholipase A2 Expression Influences Uterine Sensitivity to Polychlorinated Biphenyl Stimulation
Biol Reprod, May 1, 2006; 74(5): 874 - 880.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
D. M. Slater, S. Astle, N. Woodcock, J. E. Chivers, N. C.J. de Wit, S. Thornton, M. Vatish, and R. Newton
Anti-inflammatory and relaxatory effects of prostaglandin E2 in myometrial smooth muscle
Mol. Hum. Reprod., February 1, 2006; 12(2): 89 - 97.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
10/11/799    most recent
gah103v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Slater, D. M.
Right arrow Articles by Thornton, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Slater, D. M.
Right arrow Articles by Thornton, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?