Skip Navigation


Mol. Hum. Reprod. Advance Access originally published online on September 17, 2004
Molecular Human Reproduction 2004 10(11):807-813; doi:10.1093/molehr/gah109
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
10/11/807    most recent
gah109v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Gianotten, J.
Right arrow Articles by Meijers, J. C.M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gianotten, J.
Right arrow Articles by Meijers, J. C.M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Human Reproduction vol. 10 no. 11 © European Society of Human Reproduction and Embryology 2004; all rights reserved

Absence of mutations in the PCI gene in subfertile men

Judith Gianotten1,4, Alinda W.M. Schimmel2, Fulco van der Veen1, M.Paola Lombardi1,3 and Joost C.M. Meijers2

1Center for Reproductive Medicine, 2Department of Vascular Medicine and 3Department of Clinical Genetics, Academic Medical Center, University of Amsterdam, The Netherlands

4 To whom correspondence should be addressed at: Center for Reproductive Medicine, Department of Obstetrics and Gynaecology, Academic Medical Center, Meibergdreef 9, H4-205, 1105 AZ Amsterdam, The Netherlands. Email: j.gianotten{at}amc.uva.nl


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The molecular aetiology of male subfertility is still unknown in the majority of cases and it is thought that multiple genes are involved. One of the genes that might play a role in male reproductive function is the protein C inhibitor (PCI) gene. In mice the presence of PCI is an absolute requirement for reproduction. In this study we performed a mutation screen of the PCI gene in subfertile men with severe teratozoospermia or idiopathic azoospermia. Male partners of subfertile couples with idiopathic azoospermia (n=27) or teratozoospermia (n=34) and men with normozoospermia (n=34) were screened for mutations in the PCI gene by direct sequencing. Nine nucleotide variants found in the patients were not present in the initial control group and were therefore screened in an additional control group of 80 men with normozoospermia by restriction fragment length polymorphism analysis. In addition, PCI antigen levels were measured in the seminal plasma of the patients in which a potential mutation was found. In total, three new variants were exclusively present in men with idiopathic azoospermia, but are not likely to have caused the patients' phenotypes. In addition, the PCI antigen levels in seminal plasma of these three patients were not decreased. The fact that we were not able to detect causal mutations in the PCI gene does not necessarily lead to the conclusion that the PCI protein is not involved in human male fertility, but the results of our study indicate that mutations in the human PCI gene are not a common cause of reduced semen parameters in men.

Key words: male subfertility/protein C inhibitor


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The molecular aetiology of male subfertility due to reduced semen parameters is still unknown in the majority of cases. So far, numerical and structural chromosomal abnormalities, including partial deletions of the Y chromosome, have been described in patients with reduced sperm counts (Reijo et al., 1995Go; Tuerlings et al., 1998Go; Hargreave, 2000Go; Kuroda-Kawaguchi et al., 2001Go; Repping et al., 2002Go). Recently, a heterozygous mutation in the Synaptonemal Complex protein 3 (SYCP3) gene, which encodes for a DNA-binding protein on chromosome 12, was found in two patients with azoospermia due to maturation arrest. This report indicates that autosomal genes are involved in human male subfertility too (Miyamoto et al., 2003Go).

These findings however, account only for a small proportion of subfertile patients with semen aberrations. This is not surprising, as male factor subfertility is thought to be a complex disorder in which multiple genes are involved as suggested by gene-targeting studies in Drosophila and mice (Grootegoed et al., 1998Go; Venables and Cooke, 2000Go; Hackstein et al., 2000Go).

Nowadays, ICSI with ejaculated or surgically retrieved sperm offers a great opportunity for subfertile patients with reduced semen parameters. However, genetic abnormalities causing subfertility can be transmitted to the next generation by ICSI, with a possible negative impact on fertility. Therefore, searching for genes involved in subfertility due to reduced semen parameters is of great importance.

One of the genes that might play a role in male reproduction is the protein C inhibitor (PCI) gene. Protein C inhibitor is a plasma glycoprotein belonging to the serpin superfamily of serine protease inhibitors (Suzuki et al., 1987Go). PCI acts as an inhibitor of activated protein C (Suzuki et al., 1983Go), but also inhibits various other proteases such as factor Xa, thrombin (Suzuki et al., 1983), plasma kallikrein, factor XIa (Meijers et al., 1988Go), urokinase (España et al., 1989Go; Geiger et al., 1989Go), acrosin (Hermans et al., 1994Go; Zheng et al., 1994Go), prostate-specific antigen (PSA) (Christensson and Lilja, 1994Go) and tissue kallikrein (tKK) (España et al., 1995Go). The physiological role of PCI in humans, however, has not yet been established and no known human disease has been related to deficiencies in PCI.

PCI is expressed in many organs and tissues (Suzuki, 2000Go) and is present in various human body fluids (Laurell et al., 1992Go). The highest PCI concentration has been described in seminal plasma (España et al., 1991Go, 1995Go; Laurell et al., 1992Go). The major secretory origin is in the seminal vesicles, although PCI is also present in cells of the testis and the prostate (Laurell et al., 1992Go). PCI has been detected on the head of washed sperm and it has been found on morphologically abnormal sperm heads of ejaculated sperm in the immediate vicinity of disrupted acrosomal membranes (Zheng et al., 1994Go). PCI has also been shown to be present on the acrosomal cap of intact human sperm in ejaculated sperm, as well as on epididymal sperm (Elisen et al., 1998Go).

PCI acts as a rapid inhibitor of acrosin, a serine protease stored in the acrosome of sperm (Hermans et al., 1994Go; Elisen et al., 1998Go). Induction of the acrosome reaction in ejaculated human sperm results in the disappearance of PCI from the plasma membrane overlying the acrosomal head and the appearance of a strict distribution at the equatorial segment of human sperm (Elisen et al., 1998Go). Moreover, PCI inhibits the amidolytic activity of activated human sperm extracts (Zheng et al., 1994Go). Based on these observations it has been suggested that PCI might function as an inhibitor of acrosin during storage of sperm in the epididymis. Inhibition of acrosin might prevent the proteolytic activity of acrosin, released from the acrosomes of degenerating sperm, upon other cells. Moreover, two subfertile patients have been described in which the PCI protein appeared to be functionally inactive (He et al., 1999Go).

In mice it has already been reported that the presence of PCI is an absolute requirement for reproduction. After targeted disruption of the PCI gene, male homozygous knockout mice appeared to be healthy but infertile. This was apparently caused by abnormal spermatogenesis due to destruction of the Sertoli cell barrier, probably due to unopposed proteolytic activity. The resulting epididymal sperm in these mice were malformed (Uhrin et al., 2000Go). The sequence of the mouse PCI gene is highly homologous with the human PCI gene (Zechmeister-Machhart et al., 1997Go) and the amino acid sequence deduced from the mouse PCI gene (mPCI) is also highly homologous to that of human PCI (Uhrin et al., 2000Go).

All together, the PCI gene is an excellent candidate gene for human male subfertility. The human PCI (hPCI) gene is located in a cluster with other serine protease inhibitors on chromosome 14q32.1 (Billingsley et al., 1993Go). The gene is 11.5 kb long and comprises five exons separated by four introns (Meijers and Chung, 1991Go). We hypothesized that mutations of the PCI gene in humans can result in increased proteolytic activity in testis which causes destruction of sperm cells and early necrosis of the Sertoli cells. Therefore, we performed a mutation screen of the PCI gene in subfertile men with severe teratozoospermia or idiopathic azoospermia. PCI protein levels were measured in seminal plasma of patients in whom a unique genetic aberration was found in the PCI gene. The number of PCI alleles was quantified by Southern blot analysis in men who had a large part of the gene present in homozygous form and were thus suspected of having a partial deletion of one allele.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Patients
Male partners of subfertile couples attending the Center for Reproductive Medicine of the Academic Medical Center were included in this study between October 2000 and October 2002. In total, 34 men with severe teratozoospermia and 27 men with idiopathic azoospermia were included as patients; 114 men with normozoospermia were included as controls.

Severe teratozoospermia was defined as ≤10% normal spermatozoa, in patients with ≥1 x 106 spermatozoa per semen sample. Normozoospermia was defined as a total sperm count >40 x 106 with a progressive motility and normal morphology of ≥40%, in two consecutive semen samples. Semen analyses were performed according to World Health Organization (1992)Go criteria.

Patients with a history of orchitis, alcohol abuse, surgery of the vasa deferentia, bilateral orchidectomy, bilateral cryptorchidism, chemo- or radiotherapy, obstructive azoospermia (confirmed by testicular biopsy), and with numerical chromosomal abnormalities or microdeletions of the Y chromosome were excluded from this study.

Blood was drawn from all patients and controls for DNA isolation (Miller et al., 1988Go). Of patients in whom a unique mutation was found, we collected a semen sample to analyse PCI protein levels in seminal plasma. We also tried to collect DNA from their parents to study the inheritance pattern of the identified mutation. Written informed consent was obtained from all participants, and the Institutional Review Board of the Academic Medical Center approved the study.

Screening for point mutations
All patients and an initial control group of 34 controls were screened for mutations by direct sequencing. All five exons identified in the human PCI (hPCI) gene and flanking intronic sequences, a 2 kb fragment 5' to the transcriptional initiation site comprising the promoter region and 1 kb of the 3' untranslated region, were scanned for mutations. All primers used for PCR amplification and sequence analysis are listed in Table I. PCR reactions consisted of 3 µl primer forward and reverse (10 mmol/l), 4 µl dNTP (1.25 mmol/l; Amersham Pharmacia), 1 µl BSA (10 mg/ml), 5 µl 10 x PCR buffer (Qiagen), 0.3 µl Taq (Qiagen), 30.7 µl mQ-water and 3 µl DNA. PCR conditions were 5 min denaturation at 94°C, followed by 30 cycles at 94°C for 1 min, 1 min at the annealing temperatures given in Table I and 1 min at 72°C.


View this table:
[in this window]
[in a new window]
 
Table I. Primer sequences and annealing temperatures for PCR amplification

 
Analysis of both the sense and antisense strands of the PCR-amplified fragments was performed on an automated ABI Prism 3100 Genetic Analyser (Applied Biosystems), using the same PCR primers. Two additional internal primers were used for the sequencing of exon 5 (PCI-ex5-seq2F: CAAAGAGAGGTCCAGAGTCC; PCI-ex5-seq2R: GGACTCTGGACCTCTCTTTG). Output sequences were compared to the human reference PCI sequence (NT_026437; M_68516).

Variants identified in the patient groups, which were not present in the initial control group of 34 normozoospermic men, were additionally screened, either by restriction fragment length polymorphism (RFLP) analysis or, when no restriction site was available, by sequencing in an additional group of 80 men with normozoospermia. The following restriction enzymes were used: HaeIII for –1014 G->T, MspI for –938 C->T, MvaI for –806 G->A, HphI for 1364 G->A and AluI for 1937 G->A.

Screening for deletions
For Southern blot analysis, 10 µg of genomic DNA was digested with BamHI (Roche), according to the manufacturer's recommendations. DNA was separated on a 0.8% agarose gel, for 16–18 h at x5 V cm and transferred to Hybond+ (Amersham). A HindIII fragment (Hind 4, Figure 1) of the phage clone {lambda}FIX-PCI-12 (Meijers and Chung, 1991Go) covering the promoter region, exon 1 and the 5' end of intron A of the PCI gene (M_68516) was radioactively labelled with [32P]dCTP by random prime labelling and used as probe (Figure 1). A 2.5 kb TaqI fragment of cosmid q25 (GeneBank accession no. Z68344) on chromosome 11 was used as control probe (Alders et al., 2000Go).



View larger version (62K):
[in this window]
[in a new window]
 
Figure 1. Southern blot analysis of the PCI gene. (A) Schematic drawing of the experimental approach, showing the organization of the gene coding for human protein C inhibitor, the size and location of the PCI probe and PCI fragmentation following BamHI digestion. (B) Auto-radiographic image after hybridization with Hind4 (PCI probe) and Q25 (control probe). The position of the DNA mol. wt markers (in bp) is indicated. All controls, except the one in the last lane, were men with normozoospermia. Samples 22.1 and 22.2 correspond respectively to the mother and father of patient Terato 22.3.

 
Filters were prehybridized for ≥1 h and hybridized overnight in ExpressHyb hybridizing solution (Clontech) at 65°C. Filters were then washed to a stringency of 0.1 x standard saline citrate/0.1% sodium dodecyl sulphate, followed by autoradiography for 1–3 days at –70°C using Kodak XAR-5 films with an intensifying screen.

Protein levels
Liquefied semen was centrifuged at 2000 g for 10 min at 18°C. The plasma was stored at –80°C. Antigen levels of protein C inhibitor were determined by enzyme-linked immunosorbent assay using a monoclonal antibody against PCI (API-93) as capturing antibody and rabbit polyclonal anti-PCI serum as secondary antibody (Meijers et al., 1988Go). Reference values were measured in seminal plasma of 20 men with normozoospermia according the same procedure. The mean antigen level in the normozoospermic men was 17.5 IU/ml. The mean±2 SD was 6.1–28.9 IU/ml and was considered as the normal range.

Statistics
Allele frequencies were compared between both patient groups and the control group using Fisher's exact test. P<0.05 was considered as statistically significant.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Mutation analysis: screening for point mutations
The entire coding sequence and promoter region of the PCI gene were analysed for sequence variants in 34 patients with teratozoospermia, 27 patients with azoospermia and 34 controls with normozoospermia by direct sequencing. Semen parameters of the patients with teratozoospermia are listed in Table II. In total, 46 single nucleotide variants were identified which are listed in Table III. The vast majority of these sequence variations represents single nucleotide polymorphisms previously reported in the SNP database (www.ncbi.nih.gov)Go. Fifteen nucleotide variants were detected which were not yet reported in this database. Nine nucleotide variants (Table III, nos. 5, 7, 9, 27, 28, 29, 30, 34 and 44) found in the patients were not present in the initial control group of 34 men with normozoospermia, and therefore an additional control group of 80 men with normozoospermia was screened for these variants by RFLP analysis. Three of these variants (Table III, nos. 9, 27 and 30) were absent in the additional control population. These three new variants were all found in men with azoospermia.


View this table:
[in this window]
[in a new window]
 
Table II. Semen parameters of patients with teratozoospermia

 

View this table:
[in this window]
[in a new window]
 
Table III. Nucleotide variants detected in the human PCI gene

 
The first variant was a G->A transition detected at position –806 in the promoter region in heterozygous form. A search for potential transcription factor binding sites (MatInspectorV2.2) of a 2.2 kB region upstream of the transcription initiation site resulted in the identification of many potential binding sites. In particular, one site stretches from nucleotide position –811 to –800 (GCCTGGGAGTCA) and potentially serves as binding site for an Ikaros 2 (Ik-2) zinc finger protein. The G nucleotide at position –806 of the PCI promoter region is invariant in the consensus sequence of Ik-2.

The second variant was a heterozygous C->T transition found in intron 2 at position 735-6. This transition does not result in an amino acid change and although this is part of the 3' consensus splice-site sequence, C and T nucleotides are found with the same frequency at this position.

The third variant was a G->T transition in exon 3 at position 985. This transition was also present in heterozygous form and results in cysteine replacing a tryptophan residue at amino acid position 271 (W271C). Both parents and a brother of the patient in whom this variant was found were available for DNA analysis. The mutation could also be detected in the patient's mother and in his brother who had normal semen parameters.

Mutation analysis: screening for gene deletions
In the course of analysis of allelic frequencies and distribution of the SNP in the various groups, it became apparent that in four patients and one control individual the polymorphic sites of a large part of the gene (up to exon 3) were present in the homozygous form. As this finding was suggestive for partial deletions of one allele, we performed Southern blot analysis of the genomic DNA of these patients and of an equal number of controls (Figure 1). After BamHI digestion, a 10 kb fragment including the entire 5' flanking region, exon 1, the intervening intron A, exon 2 and a large part of intron B was detected with a probe spanning the first 4 kb of the 5' flanking region of the PCI gene. The same blot was hybridized with a control probe, which detects a ~5 kb BamHI fragment of the BWS chromosome region 2 on chromosome 11. No aberrant banding patterns or differences in the ratios of intensity of the bands obtained with the two probes were detected.

Protein levels
PCI was measured in seminal plasma from the three patients carrying a mutation not found in the controls. Antigen levels were 36.8 IU/ml in the patient with the –806 G->A variant, 21.7 IU/ml in the patient with the 735–6 C->T variant and 16.8 IU/ml in the patient with the 985 G->T variant.

Statistical analysis
By comparing the different allele frequencies between patients and controls, no statistical significant differences were found.


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
In this study we performed a mutation screen of the PCI gene in 61 patients with severe teratozoospermia or azoospermia. We demonstrated the presence of several nucleotide changes in the human PCI gene by direct sequencing.

In mice, PCI is an absolute requirement for reproduction. As the epididymal sperm in PCI-disrupted mice are malformed (Uhrin et al., 2000Go), the patient group we studied consisted of patients with teratozoospermia. However, the histological analysis of the reproductive organs of the PCI-disrupted mice, in which the lumina of the seminiferous tubules were filled with cells in different stages of spermatogenesis, revealed that some of the cells were apoptotic (Uhrin et al., 2000Go). Spermatogenesis in these mice was disturbed, likely due to the destruction of Sertoli cells. In addition, significantly higher amidolytic activity was found in testis extracts of PCI knockout mice. Based on these observations, we hypothesized that defects of PCI in humans might also result in early necrosis of the Sertoli cells with total destruction of spermatogenesis. Therefore patients with azoospermia were also included in this study.

Most of the variants found in our patients were present in both patient groups as well as in a control population of men with normozoospermia. This indicates that these variants are most likely polymorphic alleles unrelated to the phenotype we studied. However, three nucleotide changes were found among patients with azoospermia and were not detected in the control population.

The first mutation, –806 G->A, occurs in the distant promoter. For the PCI gene, putative binding sites for transcription factors have been identified in the proximal promoter region, in the vicinity of the putative transcription initiation site (Meijers and Chung, 1991Go). Until now, no binding sites have been reported in the distant promoter region of the PCI gene, but in a number of other genes, enhancers, repressors, determinants of tissue-specific gene expression and other responsive elements have been identified in the distant promoter (Watanabe et al., 1987Go; Murakami et al., 1990Go). Moreover, mutations in the distant promoter elements have been shown to be associated with reduced protein synthesis.

The –806 G->A variant replaces an invariant G nucleotide within the motif which is potentially a binding site for an Ikaros 2 (Ik-2) zinc finger protein (Molnar and Georgopulos, 1994Go). This mutation therefore potentially disrupts the putative IK-2 binding site. Ik-2 can strongly stimulate transcription. However, the PCI antigen level in the seminal plasma of this patient was above the normal range and therefore we can conclude that this variant does not lead to reduced PCI protein expression. Based on the elevated PCI antigen level, one can even speculate that the PCI gene expression is up-regulated in this patient.

The second mutation, 735–6 C->T, occurs at position –6 of the 3' acceptor splice site of intron 2. Analysis of the consensus nucleotide frequency pattern at the 3' splice sites shows that at this position C or T occurs with almost the same frequency (C 39%, T 47%) (Cooper and Krawczak, 1990Go). This indicates that this variant most likely does not interfere with the correct splicing of the downstream exon and therefore is not responsible for the observed phenotype. In addition, the PCI antigen level in the seminal plasma of this patient was within the normal range, which is another argument that this variant is not causing azoospermia.

The third mutation, the replacement of a G by a T at position 985 in exon 3, results in the amino acid change W271C. This mutation occurred in the coding sequence of the gene and was not detected in the control group. Therefore, we thought that this mutation might represent a potentially causative mutation. However, the same mutation was also detected in the patient's brother who had normal semen parameters and the PCI level in the patient's seminal plasma was normal. Therefore it seems highly unlikely that this mutation is causing the subfertile phenotype.

Two variants found in this study (Table III, nos. 37 and 38) were only present in the controls and not in the patient group. These variants were already described in the NCBI database and occur apparently with a low frequency. Obviously these variants are not associated with the phenotype under study.

In addition to the nucleotide variants found in this study, four patients were suspected of having a partial deletion of one allele of the gene. By Southern blot analysis, no differences could be detected between those four patients and controls. This rules out the possibility that deletions account for the lack of allele variability in these patients.

The results of this study show that mutations in the human PCI gene are not a common cause of azoo- or teratozoospermia in man. However, the fact that we were not able to detect causal mutations in the PCI gene does not necessarily lead to the conclusion that the PCI protein is not involved in human male fertility.

The mouse model that has been established to analyse the consequences of a PCI deficiency provides a strong argument that PCI is involved in reproduction. After targeted disruption of the PCI gene, male homozygous knockout mice appeared to be healthy but infertile (Uhrin et al., 2000Go). Analysis of sperm obtained from the epididymides of these mice revealed that 95% of all sperm were morphologically abnormal. In vitro experiments indicated almost complete inability of these sperm to fertilize oocytes of wild-type females.

Nevertheless, we have to realize that there is a striking difference in the expression of PCI between mice and humans. In humans, PCI is expressed in several body fluids including blood plasma where it might have a function in blood coagulation. In mice, however, PCI is only detected in high concentrations in the reproductive tract. Therefore, a mutation of the PCI gene in humans might have phenotypical consequences that are much more severe than in mice. It cannot be ruled out that defects of the PCI gene in humans are lethal, which in turn might explain the fact that we were not able to detect mutations in our patient population, which consisted of subfertile but otherwise healthy men.


    Acknowledgements
 
We thank Jan W.A.de Vries, Saskia K.M.van Dalen, Cindy M.Korver, Jorge Peter, Arnoud Marquart, and Sebastiaan de Leng for their technical support.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Alders M, Ryan A, Hodges M, Bliek J, Feinberg AP, Privitera O, Westerveld A, Little PFR and Mannens M (2000) Disruption of a novel imprinted Zinc-Finger gene, ZNF215, in Beckwith–Wiedemann Syndrome. Am J Hum Genet 66, 1473–1484.[CrossRef][Web of Science][Medline]

Billingsley GD, Walter MA, Hammond GL and Cox DW (1993) Physical mapping of four serpin genes: alpha 1-antitrypsin, alpha 1-antichymotrypsin, corticosteroid-binding globulin, and protein C inhibitor, within a 280-kb region on chromosome I4q321. Am J Hum Genet 52, 343–353.[Web of Science][Medline]

Cooper DN and Krawczak M (1990) The mutational spectrum of single base-pair substitutions causing human genetic disease: patterns and predictions. Hum Genet 85, 55–74.[Web of Science][Medline]

Christensson A and Lilja H (1994) Complex formation between protein C inhibitor and prostate-specific antigen in vitro and in human semen. Eur J Biochem 220, 45–53.[Web of Science][Medline]

Elisen MG, van Kooij RJ, Nolte MA, Marquart JA, Lock TM, Bouma BN and Meijers JC (1998) Protein C inhibitor may modulate human sperm-oocyte interactions. Biol Reprod 58, 670–677.[Abstract/Free Full Text]

España F, Berrettini M and Griffin JH (1989) Purification and characterization of plasma protein C inhibitor. Thromb Res 55, 369–384.[CrossRef][Web of Science][Medline]

España F, Gilabert J, Estelles A, Romeu A, Aznar J and Cabo A (1991) Functionally active protein C inhibitor/plasminogen activator inhibitor-3 (PCI/PAI-3) is secreted in seminal vesicles, occurs at high concentrations in human seminal plasma and complexes with prostate-specific antigen. Thromb Res 64, 309–320.[CrossRef][Web of Science][Medline]

España F, Fink E, Sanchez-Cuenca J, Gilabert J, Estelles A and Witzgall K (1995) Complexes of tissue kallikrein with protein C inhibitor in human semen and urine. Eur J Biochem 234, 641–649.[Web of Science][Medline]

Geiger M, Huber K, Wojta J, Stingl L, España F, Griffin JH and Binder BR (1989) Complex formation between urokinase and plasma protein C inhibitor in vitro and in vivo. Blood 74, 722–728.[Abstract/Free Full Text]

Grootegoed JA, Baarends WM, Roest HP and Hoeijmakers JHJ (1998) Knockout mouse model and gametogenic failure. Mol Cell Endocrinol 145, 161–166.[CrossRef][Web of Science][Medline]

Hackstein JHP, Hochstenbach R and Pearson PL (2000) Towards an understanding of the genetics of human male infertility: lessons from flies. Trends Genet 16, 565–572.[CrossRef][Web of Science][Medline]

Hargreave TB (2000) Genetic basis of male fertility. Br Med Bull 56, 650–671.[Abstract/Free Full Text]

He S, Lin YL and Liu YX (1999) Functionally inactive protein C inhibitor in seminal plasma may be associated with infertility. Mol Hum Reprod 5, 513–519.[Abstract/Free Full Text]

Hermans JM, Jones R and Stone SR (1994) Rapid inhibition of the sperm protease acrosin by protein C inhibitor. Biochemistry 33, 5440–5444.[CrossRef][Medline]

Kuroda-Kawaguchi T, Skaletsky H, Brown LG, Minx PJ, Cordum HS, Waterston RH, Wilson RK, Silber S, Oates R, Rozen S and Page DC (2001) The AZFc region of the Y chromosome features massive palindromes and uniform recurrent deletions in infertile men. Nat Genet 29, 279–286.[CrossRef][Web of Science][Medline]

Laurell M, Christensson A, Abrahamsson PA, Stenflo J and Lilja H (1992) Protein C inhibitor in human body fluids. Seminal plasma is rich in inhibitor antigen deriving from cells throughout the male reproductive system. J Clin Invest 89, 1094–1101.

Meijers JCM, Kanters DHAJ, Vlooswijk RAA, van Erp HE, Hessing M and Bouma BN (1988) Inactivation of human plasma kallikrein and factor XIa by protein C inhibitor. Biochemistry 27, 4231–4237.[CrossRef][Medline]

Meijers JC and Chung DW (1991) Organization of the gene coding for human protein C inhibitor (plasminogen activator inhibitor-3). Assignment of the gene to chromosome 14. J Biol Chem 266, 15028–15034.[Abstract/Free Full Text]

Miller SA, Dykes DD and Polesky HF (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 16, 1215.[Free Full Text]

Miyamoto T, Hasuike S, Yogev L, Maduro MR, Ishikawa M, Westphal H and Lamb DJ (2003) Azoospermia in patients heterozygous for a mutation in SYCP3. Lancet 362, 1714–1719.[CrossRef][Web of Science][Medline]

Molnar R and Georgopulos K (1994) The Ikaros gene encodes a family of functionally diverse zinc finger DNA-binding proteins. Mol Cell Biol 14, 8292–8303.[Abstract/Free Full Text]

Murakami T, Nishiyori A, Takiguchi M and Mori M (1990) Promoter and 11 kb upstream enhancer elements responsible for hepatoma cell-specific expression of the rat ornithine transcarbamylase gene. Mol Cell Biol 10, 1180–1191.[Abstract/Free Full Text]

Reijo R, Lee TY, Salo P, Alagappan R, Brown LG, Rosenberg M, Rozen S, Jaffe T, Strauss D, Hovatta O et al. (1995) Diverse spermatogenic defects in humans caused by Y chromosome deletions encompassing a novel RNA-binding protein gene. Nat Genet 10, 383–393.[CrossRef][Web of Science][Medline]

Repping S, Skaletsky H, Lange J, Silber S, van der Veen F, Oates RD, Page DC and Rozen S (2002) Recombination between palindromes P5 and P1 on the human Y chromosome causes massive deletions and spermatogenic failure. Am J Hum Genet 71, 906–922.[CrossRef][Web of Science][Medline]

SNP database http://www.ncbinih.gov.

Suzuki K (2000) Protein C inhibitor (PAI-3): structure and multi-function. Fibrinol Proteol 14, 133–145.[CrossRef]

Suzuki K, Nishioka J and Hashimoto S (1983) Protein C Inhibitor; purification from human plasma and characterization. J Biol Chem 258, 163–168.[Abstract/Free Full Text]

Suzuki K, Deyashiki Y, Nishioka J, Kurachi K, Akira M, Yamamoto S and Hashimoto S (1987) Characterization of a cDNA for human protein C inhibitor. A new member of the plasma serine protease inhibitor superfamily. J Biol Chem 262, 611–616.[Abstract/Free Full Text]

Tuerlings JH, France de HF, Hamers A, Hordijk R, Van hemel JO, Hansson K, Hoovers JM, Madan K, Van der Blij-Philipsen M, Gerssen-Schoorl KB et al. (1998) Chromosome studies in 1792 males prior to intra-cytoplasmic sperm injection: the Dutch experience. Eur J Hum Genet 6, 194–200.[CrossRef][Web of Science][Medline]

Uhrin P, Dewerchin M, Hilpert M, Chrenek P, Schofer C, Zechmeister-Machhart M, Kronke G, Vales A, Carmeliet P, Binder BR and Geiger M (2000) Disruption of the protein C inhibitor gene results in impaired spermatogenesis and male infertility. J Clin Invest 106, 1531–1539.[Web of Science][Medline]

Venables JP and Cooke HJ (2000) Lessons from knockout and transgenic mice for infertility in men. J Endocrinol Invest 23, 584–591.[Web of Science][Medline]

Watanabe K, Saito A and Tamaoki T (1987) Cell-specific enhancer activity in a far upstream region of the human alpha-fetoprotein. J Biol Chem 262, 4812–4818.[Abstract/Free Full Text]

World Health Organization (1992) WHO Laboratory Manual for the Examination of Human Semen and Sperm–Cervical Mucus Interaction. 3rd edn. Cambridge University Press, New York, pp. 1–107.

Zechmeister-Machhart M, Hufnagl P, Uhrin P, Korschineck Binder BR and Geiger M (1997) Molecular cloning and sequence analysis of the mouse protein C inhibitor gene. Gene 186, 61–66.[CrossRef][Web of Science][Medline]

Zheng X, Geiger M, Ecke S, Bielek E, Donner P, Eberspacher U, Schleuning WD and Binder BR (1994) Inhibition of acrosin by protein C inhibitor and localization of protein C inhibitor to spermatozoa. Am J Physiol 267, 466–472.

Submitted on June 18, 2004; resubmitted on August 17, 2004; accepted on August 19, 2004.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
10/11/807    most recent
gah109v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Gianotten, J.
Right arrow Articles by Meijers, J. C.M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gianotten, J.
Right arrow Articles by Meijers, J. C.M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?