Molecular Human Reproduction, Vol. 10, No. 6, pp. 423-431, 2004
© European Society of Human Reproduction and Embryology 2004
Identification of genes differentially expressed in testes containing carcinoma in situ
University Department of Growth and Reproduction, Rigshospitalet, Section GR-5064, Rigshospitalet, Blegdamsvej 9, DK-2100 Copenhagen, Denmark
1 To whom correspondence should be addressed. e-mail: cehh{at}biobase.dk
 |
ABSTRACT |
|---|
 Top ABSTRACT IntroductionMaterials and methodsResultsDiscussionREFERENCES |
|---|
Virtually all testicular germ cell tumours originate from a common precursor, the carcinoma in situ (CIS) cell. The precise nature of the molecular mechanisms leading to CIS remains largely unknown. We performed the first systematic analysis of gene expression in testis with CIS compared to normal testis by the differential display (DDRT–PCR) method, with subsequent analysis by RT–PCR and in situ hybridization (ISH). In tissue containing CIS we identified overexpression of 28 mRNA, some previously reported in CIS and a number of genes not previously described in germ cell neoplasia, including the novel expressed sequence tag (EST) OIC1 (Overexpressed In CIS). The genes could be grouped functionally into genes involved in cell growth, proliferation, differentiation, immunological response, and genes with unknown biological function. Examples of overexpressed genes are SFRP1 that is involved in Wnt signalling and IGFBP6, which is of importance for fetal growth and inhibits cell growth through insulin-like growth factor-II. ISH analysis showed that both mRNA were localized to CIS cells. The results of our search for differentially expressed genes in CIS demonstrated a number of genes linked to testicular development (e.g. DCN, IGFBP6, SFRP1, SALL1), supporting our hypothesis that the origin of CIS is probably associated with disturbances of the fetal development of the testis.
Key words: carcinoma in situ/differential display/IGFBP-6/SFRP1/testicular cancer
|
Introduction |
|---|
|
TopABSTRACTIntroductionMaterials and methodsResultsDiscussionREFERENCES |
|---|
Testicular germ cell tumours (TGCT) are the most common malignancies among men aged 17–45 years, and the incidence has been steadily increasing (Adami et al., 1994). TGCT of young adults are classified into two main histological subtypes, classical seminoma and non-seminoma. These tumours originate from a common precursor, the carcinoma in situ (CIS) cell (Skakkebaek, 1972), which is believed to arise by transformation of a gonocyte (Skakkebaek et al., 1987). Epidemiological evidence and comparative studies of cell surface proteins indicate that CIS is an inborn lesion, probably arising in early fetal life, which progresses to an overt TGCT after puberty. The precise nature of the molecular mechanisms leading to CIS remains largely unknown. Morphologically, CIS cells are gonocyte-like, intratubular germ cells that share several features with seminoma and to a lesser extent with embryonal carcinoma.
Several genes have been shown to be highly expressed in CIS, e.g. KIT (c-kit), CCND2, POU5F1, ALPP, mainly by studies using the candidate gene approach and immunohistochemistry (reviewed recently in Rajpert-De Meyts et al., 2003). No systematic studies of gene expression in CIS have been performed so far, partly due to technical difficulties in working with CIS, as these cells occur in low numbers scattered within normal testicular tissue. A few previous studies analysed gene expression profiles in overt testicular tumours, with focus on genes on chromosomes 17 and 12, because of frequent rearrangements of these chromosomes in human cancers (Rothe et al., 2000; Skotheim et al., 2002, 2003; Rodriguez et al., 2003).
To shed more light on CIS cell biology and tumour progression, we decided to analyse gene expression in CIS cells and the most common overt TGCT. Our additional objective in this study was to identify possible new markers for early detection of CIS, therefore the focus was on genes overexpressed in CIS in comparison to normal testicular parenchyma. We used the differential display (DDRT–PCR) method, in order to be able to detect not only known genes but also new expressed sequence tag (EST) in a truly unselected approach, followed by further analysis by reverse transcriptase PCR (RT–PCR) and determination of the cell type-specific expression of selected genes by in situ hybridization (ISH).
|
Materials and methods |
|---|
|
TopABSTRACTIntroductionMaterials and methodsResultsDiscussionREFERENCES |
|---|
Tissue samples
The testicular tissue samples (Table I) were obtained directly after orchidectomy and macroscopic pathological evaluation. Each testicular sample was divided into several tissue fragments: two or three fragments were snap-frozen at –80°C for nucleic acid extraction, and several adjacent fragments were fixed overnight at 4°C in Stieve’s fluid, and subsequently embedded in paraffin and stained with haematoxylin and eosin (HE) or with antibodies against placental alkaline phosphatase (PLAP or ALPP) for histological evaluation (Giwercman et al., 1991). The use of the testicular tissue samples was approved by the Regional Committee for Medical Research Ethics in Denmark.
|
DDRT–PCR screening
Total RNA was prepared using the RNeasy kit from Qiagen as described by the manufacturer (Qiagen, Germany). RNA samples were double DNAse-digested, first ‘on-column’ and, after the RNA had been purified, in solution. cDNA was prepared using one-base-anchored AAGCT11V (V = A, C or G) downstream primers. DDRT–PCR (Liang and Pardee, 1992) was subsequently performed using either one- or two-base-anchored (AAGCT11VN; N = A, C, G or T) primers in combination with different upstream primers. Bands of interest were cut from the DDRT–PCR gels and reamplified using the up- and downstream primers that displayed the bands, but the downstream primer was extended at the 5'-end with a T7-promotor sequence (taatacgactcactatagggAAGCT11V; T7 promotor sequence in lower case letters), allowing direct sequencing on ALFexpress sequenators (Amersham–Pharmacia Biotech, Sweden), using a Cy5-labelled T7-promotor complementary primer. The DDRT–PCR method has been described in detail previously (Jorgensen et al., 1999, 2000).
RT–PCR
RNA was purified as described above, cDNA was synthesized using a dT24 primer. Specific primers (
20 bp) targeting each mRNA were designed. PCR was performed in 30 µl of (final concentrations): 12 mmol/l Tris–HCl, pH 8.3; 50 mmol/l KCl; 1.9 mmol/l MgCl2; 0.1% Triton X-100; 0.005% gelatine; 250 µmol/l dNTP; 30 pmol of each primer. ß-Actin was used as an internal control in all PCR reactions by including 10 pmol of each actin primer (ACCCACACTGTGCCCATCTA and TCACCTTCACCGTTCCAGTTT) in the reaction, resulting in an 800 bp actin fragment. Cycle conditions: one cycle of 2 min at 95°C; 30–40 cycles (depending on the intensity of bands) of: 30 s at 95°C, 1 min at 62°C, 1 min at 72°C and finally one cycle of 5 min at 72°C. PCR products were run on 1.5% agarose gels and visualized by ethidium bromide staining. Digital images of the agarose gels were quantified by the STORM phosphor imager software (ImageQuant, Amersham Biosciences). Representative bands from each primer combination were excised, cloned (with TOPO® Cloning Invitrogen, Cat. No. 45-0641) and sequenced for verification. In a few of the RT–PCR analyses, no bands were detectable after PCR and nested primers were designed. One microlitre from the first PCR reaction was transferred to a new reaction containing the nested primers and analysed as above.
Preparation of biotin-labelled probes and ISH
Probes for ISH were prepared by reamplification of the DDRT–PCR fragments using nested primers specific to the individual fragments with an added T3-promotor sequence (AATTAACCCTCACTAAAGGG) in combination with the T7-extended downstream primer. PCR conditions were: 5 min 95°C; five cycles of: 30 s 95°C, 1 min 45°C, 1 min 72°C; 20 cycles of 30 s 95°C, 1 min 65°C, 1 min 72°C and finally 5 min 72°C. The resulting PCR product was purified on a 2% low melting point agarose gel and sequenced from both ends, using Cy5-labelled primers complementary to the added T3 and T7 tags. Aliquots of 200 ng were used for in vitro transcription labelling, using the MEGAscript-T3 (sense) or MEGAscript-T7 (anti-sense) kits, as described by the manufacturer (Ambion, USA). The composition of the 10xnucleotide mix was: 7.5 mmol/l ATP, GTP and CTP, 3.75 mmol/l UTP, 1.5 mmol/l biotin-labelled UTP. To estimate quantity and labelling efficiencies, aliquots of the labelled RNA product were analysed by agarose gel electrophoresis, and dotted onto nitrocellulose filters and developed as described below.
ISH was performed essentially as described previously (Nielsen et al., 2003). The only deviation from the standard protocol was the removal of mercury from sections fixed in Stieve fixative (Giwercman et al., 1991) by 15 min treatment with potassium iodide (KI) (10 g/l)/I (5 g/l), followed by three washes in diethyl pyrocarbonate (DEPC) water. The iodine was subsequently removed by incubation in sodium thiosulphate pentahydrate (5% w/v, 10 min) followed by washing (4xDEPC water). The ISH procedure in brief: sections were re-fixed in 4% parformadehyde (PFA), treated with proteinase K (P-2308; Sigma, USA) (1.0–5.0 µg/ml), post-fixed in PFA, pre-hybridized 1 h at 50°C, and hybridized overnight at 50°C with biotinylated antisense and sense control probes. Excess probe was removed with 0.1xstandard saline citrate (60°C) 3x30 min. Visualization was performed using streptavidin conjugated with alkaline phosphatase (1:1000) (Cat. No. 1093266; Roche Diagnostics GmbH, Germany) followed by development with BCIP = 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/Nitroblue Tetrazolium (NBT).
|
Results |
|---|
|
TopABSTRACTIntroductionMaterials and methodsResultsDiscussionREFERENCES |
|---|
DDRT–PCR screening
To obtain knowledge on gene expression changes between the different stages in the development from non-malignant testicular tissue through CIS to the malignant stage of a germ cell cancer, we performed a systematic comparison by the DDRT–PCR method (Liang and Pardee, 1992; Jorgensen et al., 1999). For the initial screening, we analysed six testicular biopsy samples: two with homogeneous classical seminoma, two containing almost exclusively CIS tubules, of which one was from an intra-abdominal CIS and two with normal spermatogenesis (Table I). We included the specimen of undescended testis with CIS because according to the hypothesis of testicular dysgenesis syndrome (Skakkebaek et al., 2001), both testicular cancer and undescended testes are symptoms of maldeveloped gonads and may have common pathogenesis.
We performed 402 primer combinations, and assuming that each competitive PCR reaction gives rise to 100 bands on a DDRT gel and that each band corresponds to one mRNA, this investigation allowed comparison of 40 000 mRNA. We excised and sequenced 56 bands, which showed overexpression (ranging from 1.5- to 10-fold) in at least one of the CIS samples. Several mRNA were detected with more than one primer combination; for instance, overexpression of CCND2 was detected with three different primer combinations. Examples of screening gels are shown in Figure 1.
|
Verification of differential expression
Screening results suggested notable sample-to-sample variation in the expression of many of the bands, even among the normal samples, a phenomenon possibly caused by biological variation and differences in cellularity. To analyse the pattern of expression in detail, all genes showing >2-fold overexpression in CIS were analysed by RT–PCR on a panel of 15 different testicular biopsy samples, including several with seminoma, embryonal carcinoma, mature teratoma, CIS and normal spermatogenesis (Table I). Specific primers targeting each of the putative differentially expressed mRNA were designed, and PCR was performed with ß-actin as an internal PCR control and for normalization of PCR and gel loading. As a control, representative DNA fragments from all amplifications were excised, cloned and sequenced.
The RT–PCR analysis verified overexpression of 23 known genes, four transcripts corresponding to EST and one sequence not annotated as a gene (Table II). The overexpression was categorized as either up-regulated in CIS (if the up-regulation was detected in three or four of the analysed CIS samples) or up-regulated in only some CIS samples (if the up-regulation was detected in one or two of the CIS samples). We identified overexpression of a number of genes that have not previously been identified in germ cell neoplasia, which will be discussed below, and genes that have previously been described in CIS or seminoma, such as CCND2, lactate dehydrogenase B (LDHB) and XIST (Houldsworth et al., 1997; Looijenga et al., 1997; Von Eyben et al., 2000; Kawakami et al., 2003). In addition, we identified genes with high up-regulation in the lanes with normal tissue, e.g. protamine 1 and the testis-specific lactate dehydrogenase C. We also detected a weak up-regulation in CIS and tumour specimens of ribosomal proteins L27 and S16, which most likely was related to increased proliferation (Bévort and Leffers, 2000). As an indirect control of the tissue composition, we analysed the expression of a marker of ongoing spermatogenesis, protamine 1, and the mRNA expression of the immunohistochemical marker of CIS, ALPP (Manivel et al., 1987). Our microscopy examination of the biopsies was in good agreement with the expression levels of these markers (Figure 2).
|
|
Identification of cell specific expression
To determine whether the detected overexpression was actually caused by expression in CIS cells or was due to expression in other cell types present in the testicular sample, we performed non-radioactive ISH on Stieve-fixed, paraffin-embedded testicular biopsies containing either CIS, seminoma or normal spermatogenesis. Not all ISH probes gave signals possible to interpret, e.g. due to a very low abundance of transcripts or too strong background staining (Table II). To validate the ISH procedure, we first performed a control study with a marker for CIS (ALPP) and for normal spermatogenesis (protamine) (Figure 3), and both were localized to the expected cell types. CIS cells contain large, glycogen-rich vacuoles that disappear during fixation (Rorth et al., 2000), thus the remnants of cytoplasm are usually visible around the nucleus and as a thin ring attached to the cell membrane (Figure 3G). Staining in CIS was for some transcripts both cytoplasmic and nuclear, and for others predominantly nuclear.
|
We detected SFRP1 mRNA in CIS cells, and moderate expression of the COL1A2 mRNA in CIS cells and in Sertoli cells, but COL1A2 was in addition to Sertoli cells also strongly expressed in elongated spermatids in normal testis (results not shown). We confirmed previously published expression patterns of the CCND2 mRNA (Bartkova et al., 1999), which was expressed in most of the CIS cells, but not detectable in normal testicular tissue. Expression pattern was also confirmed for insulin-like growth factor binding protein 6 (IGFBP6) (Drescher et al., 1997), where ISH analysis showed strong expression in CIS cells and moderate expression in spermatogonia and spermatocytes. ISH analysis of several of the novel genes, which were detected as weakly or moderately overexpressed in biopsies with CIS by DDRT–PCR and RT–PCR, revealed that the signal in some cases was from other cell types, especially Sertoli and Leydig cells. Most likely this was due to changes in the cellular composition of the tissue samples (Ivell and Spiess, 2002; Almstrup et al., 2004), where mRNA from the Sertoli or Leydig cells were relatively over-represented due to the absence of mRNA from differentiated germ cells. Expression of TXNIP was moderate in Sertoli cells in tubules with and without CIS, and weak in most cell types in the seminoma tissue. CD47 expression was weak to moderate in Leydig cells in both tissue with CIS and normal testicular tissue.
|
Discussion |
|---|
|
TopABSTRACTIntroductionMaterials and methodsResultsDiscussionREFERENCES |
|---|
This is the first systematic study of differential gene expression in testes with CIS, the preinvasive stage of germ cell tumours, compared to normal testis. We have detected genes that were previously reported in CIS and a number of genes never before described in germ cell neoplasia. The newly identified overexpressed transcripts can be grouped by their ontology into mRNA involved in cell growth/proliferation, cell differentiation, immunological response, and genes with unknown biological function. We discuss a possible significance of the high expression in CIS-containing tissue of selected genes that are interesting from the biological and clinical point of view.
Genes related to cell growth/differentiation
Several of the overexpressed genes were reported as oncogenes or tumour suppressors in other types of human neoplasms, and may be involved in the neoplastic transformation of germ cells. Among the genes in this category is Frizzled related protein 1 (SFRP1) which was overexpressed in all CIS samples and in the teratoma sample. The transcript was localized by ISH to CIS cells. SFRP1 is a soluble Wnt antagonist, and has been suggested as a tumour suppressor (Bafico et al., 1999). Wnt activation promotes development of many organs, including neural differentiation (Cadigan and Nusse, 1997). Inhibition of Wnt and activation of Notch are features of undifferentiated human embryonal carcinoma (EC) and embryonic stem (ES) cells (Walsh and Andrews, 2003), and may be mediated by SFRP1, which is repressed in differentiating NT2/D1 cells (derived from human EC cells) after treatment with retinoic acid (Freemantle et al., 2002). Increased SFRP1 expression has been reported in leiomyomas, particularly under estrogenic stimulation (Fukuhara et al., 2002). In this context it is noteworthy that a relative excess of estrogens during early fetal life was proposed as a possible factor involved in the malignant transformation of germ cells into CIS cells (Sharpe and Skakkebaek, 1993). In addition, changes of methylation status of SFRP1 were observed in human cancers (Suzuki et al., 2002). Thus, a high expression of SFRP1 in CIS cells may be also explained by their phenotypic similarity to primordial germ cells, which undergo global demethylation (Van Gurp et al., 1994).
IGFBP6 was overexpessed in some CIS and the teratoma sample, and the transcript was localized to CIS cells. This protein has preferential affinity for IGFII, which is considered of primary importance for fetal growth. IGFBP6 inhibits cell growth through IGF-dependent and -independent mechanisms, and is a potent inducer of programmed cell death in lung cancer cells (Sueoka et al., 2000). IGFBP6 expression was previously detected in four of 13 samples of CIS by immunohistochemistry (Drescher et al., 1997). The same study also reported the presence of insulin-like growth factor-II (IGF-II) in Sertoli cells, therefore it is possible that the IGF-II/IGFBP6 system is involved in signalling of growth inhibitory signals from Sertoli cells to germ cells.
Histone deacetylase 3 (HDAC3) was overexpressed in one CIS, one seminoma and one teratoma sample. It is a transcriptional co-repressor that plays a role in transcriptional regulation, cell cycle progression and development (Yang et al., 1997). HDAC3 siRNA caused histone hyperacetylation and increased apoptosis, demonstrating that HDAC3 is important for survival of cancer cells (Glaser et al., 2003). Molecular partners (co-repressors) and target genes for HDAC3 in the testis are unknown, although it is possible that two other overexpressed genes, TXNIP and SALL1, may be involved. Thioredoxin interacting protein (TXNIP, also known as VDUP1) was weakly overexpressed in all CIS and the teratoma sample, and by ISH the transcript was localized to Sertoli cells in tubules with CIS. TXNIP has tumour suppressor activity, interacts with histone deacetylase 1 and is a negative regulator of thioredoxin, which is a redox protein reported to function as an inhibitor of the cell cycle and a stimulator of apoptosis (Nishiyama et al., 1999; Han et al., 2003). Down-regulation of TXNIP has been reported in lymphoma and gastric cancer (Ikarashi et al., 2002; De Vos et al., 2003). The Zinc finger protein SALL1 was overexpressed in one sample with CIS and in all tumour samples. It is expressed in fetal and adult Leydig and Sertoli cells (Ma et al., 2002). Murine Sall1 represses transcription by recruiting a histone deacetylase complex (Kiefer et al., 2002).
Decorin (DCN), overexpressed in some CIS samples and down-regulated in the tumour samples, is a proteoglycan that in adult testis was detected in fibroblasts, peritubular cells and arteries but not within seminiferous tubules (Ungefroren et al., 1995). DCN inhibits TGF-ß and PDGF activity, thus part of a feedback system regulating cell growth (Yamaguchi et al., 1990; Nili et al., 2003). Interestingly, DCN was identified in certain stages of the migratory pathway of primordial germ cell in the mouse embryo (Soto-Suazo et al., 2002), and was also required to reverse the migratory phenotype of myoblasts in the developing chick limb buds (Olguin et al., 2003). Therefore, we speculate that the enhanced expression of DCN in tissue containing CIS cells may reflect their primordial germ cell-like phenotype.
Genes related to the immune system
Several of the genes overexpressed in specimens with CIS are related to an activated immune system, which corresponds well to the frequent presence of mononuclear cell infiltration in tissues with CIS and seminoma (Jahnukainen et al., 1995). The detected up-regulation of these genes is therefore presumably not derived from CIS cells, but is more likely caused by infiltrating lymphocytes or other cells involved in the immune response. Tumour rejection antigen 1 (TRA1) was up-regulated in one CIS and all tumour samples investigated; it is ubiquitously expressed and is a peptide binding protein in the endoplasmic reticulum implicated in integrin function and host defence action (Li et al., 2002). Other up-regulated genes found in this study that are related to the immune system are CD47, CD74, complement component-7, SRP-SOX chemokine, interferon-induced transmembrane protein-1 and HLA DR alpha chain.
Other differentially expressed genes
Up-regulation of collagen alpha 2 type 1 (COL1A2) and bullous pemphigoid antigen 1 (BPAG1) is most likely related to remodelling in CIS-containing tissue due to an enhancement of the attachment capacity of the neoplastic cells. In prostate cancer, the expression of BPAG1 was inversely correlated with tumour progression (Vanaja et al., 2003). Two additional up-regulated genes, optic atrophy 1 (OPA1) and cytochrome b reductase 1 (CYBRD1), are probably related to mitochondrial processes, reflecting a changed activity in the mitochondria or changes in number of mitochondria.
Several of the detected genes were only overexpressed in a subset of the CIS samples, which may partly be due to specific aspects of the biology of the testis and CIS cells. First, in frozen tissue specimens it is not possible to determine the exact composition of the analysed testicular tissue by histology of adjacent tissue fragments. On the transcript level, a strong overexpression in one cell type may mask a weak overexpression in the cell of interest. We have partially obviated this problem by ISH analysis of some of the newly identified transcripts. Secondly, morphologically similar-appearing CIS cells in the vicinity of different types of TGCT may have different gene expression profiles. In fact, heterogeneity of CIS cells at the protein level was noticed earlier (Rajpert-De Meyts et al., 1996). Thirdly, the expression profile in the testis seems to be affected by the location of the testis. Perhaps these gene expression differences are linked to the causative factors involved in the pathogenesis of cryptorchidism, or perhaps the gene expression differences occur as a result of the different location, maybe due to changes in temperature. This may be the reason for the differences in gene expression profile between the sample from an undescended, intra-abdominal testis (CIS2, Table I) and other CIS samples. For example, TRA1 was relatively weakly expressed in CIS2, whereas HDAC3 was strongly overexpressed. One sequenced band (novel EST: OIC1 (Overexpressed In CIS), Table II), which was strongly overexpressed in CIS2, did not match any mRNA or EST sequence in the genbank or EBI databases. However, OIC1 had a perfect match to a genomic sequence located on chromosome 15q21.3, within the large second intron in the gene for TCF12 (also called HTF-4 and E-Box binding protein). The match was downstream of an EST that is also located in the second intron of TCF12 and is transcribed independently of TCF12 (accession no. BX112789, AI075936, Unigene cluster Hs.134007). To investigate whether the sequenced band was derived from alternative splicing of either TCF12 or the EST, we designed primers matching exon 1 and 2 of TCF12 and exon 1 and 2 of the EST and performed PCR with a reverse primer located at the 5'-end of the sequenced fragment. None of the primer combinations produced a band after PCR, suggesting that the detected transcript may correspond to a novel mRNA. The sequence has been submitted to the EBI database with accession no. AJ617288.
The results of our search for differentially expressed genes in CIS demonstrated a number of genes linked to testicular development, i.e. DCN, IGFBP6, SFRP1, SALL1, supporting our hypothesis of the origin of CIS from primordial germ cells or gonocytes (Skakkebaek et al., 1987). In regard to the future, the results of this study indicate that differences between the gene expression profiles in CIS compared to normal tissue are informative with regard to the biology and origin of this neoplasia. More work is needed to describe the transcriptome of CIS cells in detail. A comparison between CIS and the cell type from which CIS derives (fetal germ cells) would be very informative for the elucidation of mechanisms of neoplastic transformation, but this remains practically very difficult due to problems in obtaining human fetal gonocytes. The other important perspective is to apply the new knowledge for early clinical diagnosis of germ cell neoplasms at the stage of CIS, possibly by a non-invasive method. Further studies to define the biological importance of overexpression in CIS of the newly identified genes and their possible use for early detection of incipient testicular cancer in the clinical setting are planned.
|
Acknowledgements |
|---|
We wish to thank Marlene Dalgaard and Brian Vendelbo Hansen for excellent technical assistance. The study was supported by grants from The Danish Cancer Society, The Svend Andersen Foundation and The Danish Medical Research Council.
|
REFERENCES |
|---|
|
TopABSTRACTIntroductionMaterials and methodsResultsDiscussionREFERENCES |
|---|
Adami HO, Bergstrom R, Mohner M, Zatonski W, Storm H, Ekbom A, Tretli S, Teppo L, Ziegler H, Rahu M et al (1994) Testicular cancer in nine northern European countries. Int J Cancer 59,33–38.[Web of Science][Medline]
Almstrup K, Nielsen JE, Hansen MA, Tanaka M, Skakkebaek NE and Leffers H (2004) Analysis of cell-type-specific gene expression during mouse spermatogenesis. Biol Reprod 70, Issue 6.
Badve S, Deshpande C, Hua Z and Logdberg L (2002) Expression of invariant chain (CD 74) and major histocompatibility complex (MHC) class II antigens in the human fetus. J Histochem Cytochem 50,473–482.
Bafico A, Gazit A, Pramilla T, Finch PW, Yaniv A and Aaronson SA (1999) Interaction of frizzled related protein (FRP) with Wnt ligands and the frizzled receptor suggests alternative mechanisms for FRP inhibition of Wnt signaling. J Biol Chem 274,16180–16187.
Bartkova J, Rajpert-De Meyts E, Skakkebaek NE and Bartek J (1999) D-type cyclins in adult human testis and testicular cancer: relation to cell type, proliferation, differentiation, and malignancy. J Pathol 187,573–581.[CrossRef][Web of Science][Medline]
Bartkova J, Rajpert-De Meyts E, Skakkebaek NE, Lukas J and Bartek J (2003) Deregulation of the G1/S-phase control in human testicular germ cell tumours. APMIS 111,2252–265.
Bévort M and Leffers H (2000) Down regulation of ribosomal protein mRNAs during neuronal differentiation of human NTERA2 cells. Differentiation 66,81–92.[CrossRef][Web of Science][Medline]
Cadigan KM and Nusse R (1997) Wnt signaling: a common theme in animal development. Genes Dev 24,3286–3305.
Deblandre GA, Marinx OP, Evans SS, Majjaj S, Leo O, Caput D, Huez GA and Wathelet MG (1995) Expression cloning of an interferon-inducible 17-kDa membrane protein implicated in the control of cell growth. J Biol Chem 270,23860–23866.
Delettre C, Lenaers G, Pelloquin L, Belenguer P and Hamel CP (2002) OPA1 (Kjer type) dominant optic atrophy: a novel mitochondrial disease. Mol Genet Metab 75,97–107.[CrossRef][Web of Science][Medline]
DeVos S, Hofmann W-K, Grogan TM, Krug U, Schrage M, Miller TP, Braun JG, Wachsman W, Koeffler HP and Said JW (2003) Gene expression profile of serial samples of transformed B-cell lymphomas. Lab Invest 83,271–285.[Web of Science][Medline]
Drescher B, Lauke H, Hartmann M, Davidoff MS and Zumkeller W (1997) Immunohistochemical pattern of insulin-like growth factor (IGF) I, IGF II and IGF binding proteins 1 to 6 in carcinoma in situ of the testis. Mol Pathol 50,298–303.
Freemantle S, Kerley JS, Olsen SL, Gross RH and Spinella MJ (2002) Developmentally-related candidate retinoic acid target genes regulated early during neuronal differentiation of human embryonal carcinoma. Oncogene 21,2880–2889.[CrossRef][Web of Science][Medline]
Fukuhara J, Kariya M, Kita M, Shime H, Kanamori T, Kosaka C, Orii A, Fujita J and Fujii S (2002) Secreted frizzled related protein 1 is overexpressed in uterine leiomyomas, associated with a high estrogenic environment and unrelated to proliferative activity. J Clin Endocrinol Metab 87,1729–1736.
Giwercman A, Cantell L and Marks A (1991) Placental-like alkaline phosphatase as a marker of carcinoma-in-situ of the testis. Comparison with monoclonal antibodies M2A and 43–9F. APMIS 99,586–594.[Web of Science][Medline]
Glaser KB, Li J, Staver MJ, Wei R-Q, Albert DH and Davidsen SK (2003) Role of class I and class II histone deacetylases in carcinoma cells using siRNA. Biochem Biophys Res Commun 310,529–536.[CrossRef][Web of Science][Medline]
Han SH, Jeon JH, Ju HR, Jung U, Kim KY, Yoo HS, Lee YH, Song KS, Hwang HM, Na YS, Yang Y, Lee KN and Choi I (2003) VDUP1 upregulated by TGF-beta1 and 1,25-dihydorxyvitamin D3 inhibits tumor cell growth by blocking cell-cycle progression. Oncogene 22,4035–4046.[CrossRef][Web of Science][Medline]
Houldsworth J, Reuter V, Bosl GJ and Chaganti RSK (1997) Aberrant expression of cyclin D2 is an early event in human male germ cell tumorigenesis. Cell Growth Differ 8,293–299.[Abstract]
Ikarashi, M., Takahashi Y, Ishii Y, Nagata T, Asai S and Ishikawa K (2002) Vitamin D3 up-regulated protein 1 (VDUP1) expression in gastrointestinal cancer and its relation to stage of disease. Anticancer Res 22,4045–4048.[Web of Science][Medline]
Ivell R and Spiess AN (2002) ‘‘Analysing differential gene expression in the testis’’ in Testicular tangrams. In Rommerts FFG and Teerds KJ (eds) 12th European Workshop on Molecular and Cellular Endocrinology of the Testis. Springer-Verlag, pp 99–120.
Jahnukainen K, Jorgensen N, Pollanen P, Giwercman A and Skakkebaek NE (1995) Incidence of testicular mononuclear cell infiltrates in normal human males and in patients with germ cell neoplasia. Int J Androl 18,313–320.[Web of Science][Medline]
Jorgensen M, Bevort M, Kledal TS, Hansen BV, Dalgaard M and Leffers H (1999) Differential display competitive polymerase chain reaction: an optimal tool for assaying gene expression. Electrophoresis 20,230–240.[Web of Science][Medline]
Jorgensen M, Vendelbo B, Skakkebaek NE and Leffers H (2000) Assaying estrogenicity by quantitating the expression levels of endogenous estrogen-regulated genes. Environ Health Perspect 108,403–412.[Web of Science][Medline]
Kawakami T, Okamoto K, Sugihara H, Hattori T, Reeve AE, Ogawa O and Okada Y (2003) The roles of supernumerical X chromosomes and XIST expression in testicular germ cell tumors. J Urol 169,1546–1552.[CrossRef][Web of Science][Medline]
Kiefer SM, McDill BW, Yang J and Rauchmann M (2002) Murine Sall1 represses transcription by recruiting a histone deacetylase complex. J Biol Chem 277,14869–14876.
Li Z, Dai J, Zheng H, Liu B and Caudill M (2002) An integrated view of the roles and mechanisms of heat shock protein gp96-peptide complex in eliciting immune response. Front Biosci 7,731–751.
Liang P and Pardee AB (1992) Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257,967–971.
Looijenga LHJ, Gillis AJM, van Gurp RJHLM, Verkerk AJMH and Oosterhuis JW (1997) X inactivation in human testicular tumors. XIST expression and androgen receptor methylation status. Am J Pathol 151,581–590.[Abstract]
Ma Y, Chai L, Cortez SC, Stopa EG, Steinhoff MM, Ford D, Morgan J and Maizel AL (2002) SALL1 expression in the human pituitary–adrenal/gonadal axis. J Endocrinol 173,437–448.[Abstract]
Manivel JC, Jessurun J, Wick MR and Dehner LP (1987) Placental alkaline phosphatase immunoreactivity in testicular germ-cell neoplasms. Am J Surg Pathol 11,21–29.[CrossRef][Web of Science][Medline]
McKie AT, Barrow D, Latunde-Dada GO, Rolfs A, Sager G, Mudaly E, Mudaly M, Richardson C, Barlow D, Bomford A et al (2001) An iron-regulated ferric reductase associated with the absorption of dietary iron. Science 291,1755–1759.
Nielsen JE, Hansen MA, Jorgensen M, Tanaka M, Almstrup K, Skakkebaek NE and Leffers H (2003) Germ cell differentiation-dependent and stage-specific expression of LANCL1 in rodent testis. Eur J Histochem 47,215–222.[Web of Science][Medline]
Nili N, Cheema AN, Giordano FJ, Barolet AW, Babaei S, Hickey R, Eskandarian MR, Smeets M, Butany J, Pasterkamp G et al (2003) Decorin inhibition of PDGF-stimulated vascular smooth muscle cell function: potential mechanism for inhibition of intimal hyperplasia after balloon angioplasty. Am J Pathol 163,869–878.
Nishiyama A, Matsui M, Iwata S, Hirota K, Masutani H, Nakamura H, Takagi Y, Sono H, Gon Y and Yodoi J (1999) Identification of thioredoxin-binding protein-2/vitamin D(3) up-regulated protein 1 as a negative regulator of thioredoxin function and expression. J Biol Chem 274,21645–21650.
Olguin HC, Santander C and Brandan E (2003) Inhibition of myoblast migration via decorin expression is critical for normal skeletal muscle differentiation. Dev Biol 259,209–224.[CrossRef][Web of Science][Medline]
Podack, E.R. and Tschopp J (1984) Membrane attack by complement. Mol Immunol 21,589–603.[CrossRef][Web of Science][Medline]
Prockop DJ and Kivirikko KI (1995) Collagens: molecular biology, diseases, and potentials for therapy. Annu Rev Biochem 64,403–434.[CrossRef][Web of Science][Medline]
Rajpert-DeMeyts E, Kvist M, Skakkebaek NE (1996) Heterogeneity of expression of immunohistochemical tumour markers in testicular carcinoma in situ: pathogenetic relevance. Virchows Arch 428,133–139.[Web of Science][Medline]
Rajpert-DeMeyts E, Bartkova J, Samson M, Hoei-Hansen CE, Frydelund-Larsen L, Bartek J, Skakkebaek NE (2003) The emerging phenotype of the testicular carcinoma in situ germ cell. APMIS 111,267–279.[CrossRef][Web of Science][Medline]
Rasmussen CD and Means AR (1989) Calmodulin, cell growth and gene expression. Trends Neurosci 12,433–438.[CrossRef][Web of Science][Medline]
Rodriguez S, Jafer O, Goker H, Summersgill BM, Zafarana G, Gillis AJ, van Gurp RJ, Oosterhuis JW, Lu YJ, Huddart R et al (2003) Expression profile of genes from 12p in testicular germ cell tumors of adolescents and adults associated with i(12p) and amplification at 12p11.2-p12.1. Oncogene 22,1880–1891.[CrossRef][Web of Science][Medline]
Rorth M, Rajpert-De Meyts E, Andersson L, Dieckmann KP, Fossa SD, Grigor KM, Hendry WF, Herr HW, Looijenga LH, Oosterhuis JW et al (2000) Carcinoma in situ in the testis. Scand J Urol Nephrol Suppl 205,166–186.[Medline]
Rothe M, Ko Y, Albers P and Wernert N (2000) Eukaryotic initiation factor 3 p110 mRNA is overexpressed in testicular seminomas. Am J Pathol 157,1597–1604.
Seiffert M, Cant C, Chen Z, Rappold I, Brugger W, Kanz L, Brown EJ, Ullrich A and Bühring H-J (1999) Human signal-regulatory protein is expressed on normal, but not on subsets of leukemic myeloid cells and mediates cellular adhesion involving its counterreceptor CD47. Blood 94,3633–3643.[Medline]
Sharpe RM and Skakkebaek NE (1993) Are oestrogens involved in falling sperm counts and disorders of the male reproductive tract? Lancet 341,1392–1395.[CrossRef][Web of Science][Medline]
Shimaoka T, Kume N, Minami M, Hayashida K, Kataoka H, Kita T and Yonehara S (2000) Molecular cloning of a novel scavenger receptor for oxidized low density lipoprotein, SR-PSOX, on macrophages. J Biol Chem 275,40663–40666.
Skakkebaek NE (1972) Possible carcinoma-in-situ of the testis. Lancet 2,516–517.[Web of Science][Medline]
Skakkebaek NE, Berthelsen JG, Giwercman A and Müller J (1987) Carcinoma-in-situ of the testis: possible origin from gonocytes and precursor of all types of germ cell tumours except spermatocytoma. Int J Androl 10,19–28.[Web of Science][Medline]
Skakkebaek NE, Rajpert-De Meyts E and Main KM (2001) Testicular dysgenesis syndrome: an increasingly common developmental disorder with environmental aspects. Hum Reprod 16,972–978.
Skotheim RI, Monni O, Mousses S, Fossa SD, Kallioniemi OP, Lothe RA and Kallioniemi A (2002) New insights into testicular germ cell tumorigenesis from gene expression profiling. Cancer Res 62,2359–2364.
Skotheim RI, Abeler VM, Nesland JM, Fossa SD, Holm R, Wagner U, Florens VA, Aass N, Kallioniemi OP and Lothe RA (2003) Candidate genes for testicular cancer evaluated by in situ protein expression analyses on tissue microarrays. Neoplasia 5,397–404.[Web of Science][Medline]
Soto-Suazo M, San Martin S, Ferro ES and Zorn TM (2002) Differential expression of glycosaminoglycans and proteoglycans in the migratory pathway of the primordial germ cells of the mouse. Histochem Cell Biol 118,69–78.[CrossRef][Web of Science][Medline]
Sueoka N, Lee H-Y, Wiehle S, Cristiano RJ, Fang BL, Ji L, Roth JA, Hong WK, Cohen P and Kurie JM (2000) Insulin-like growth factor binding protein-6 activates programmed cell death in non-small cell lung cancer cells. Oncogene 19,4432–4436.[CrossRef][Web of Science][Medline]
Suzuki H, Gabrielson E, Chen W, Anbazhagan R, van Engeland M, Weijenberg MP, Herman JG and Baylin SB (2002) A genomic screen for genes upregulated by demethylation and histone deacetylase inhibition in human colorectal cancer. Nat Genet 31,141–149.[CrossRef][Web of Science][Medline]
Trejo R and Delhumeau G (1997) Calmodulin content, Ca2+-dependent calmodulin binding proteins, and testis growth: identification of Ca2+-dependent calmodulin binding proteins in primary spermatocytes. Mol Reprod Dev 48,127–136.[CrossRef][Web of Science][Medline]
Ungefroren H, Ergün S, Krull N and Holstein AF (1995) Expression of the small proteoglycans biglycan and decorin in the adult human testis. Biol Reprod 52,1095–1105.[Abstract]
VanGurp RJ, Oosterhuis JW, Kalscheuer V, Mariman EC and Looijenga LH (1994) Biallelic expression of the H19 and IGF2 genes in human testicular germ cell tumors. J Natl Cancer Inst 86,1070–1075.
VonEyben, F.E., Liu FJ, Amato RJ and Fritsche HA (2000) Lactate dehydrogenase isoenzyme 1 is the most important LD isoenzyme in patients with testicular germ cell tumor. Acta Oncol 39,509–517.[CrossRef][Web of Science][Medline]
Vanaja DK, Cheville JC, Iturria SJ and Young CY (2003) Transcriptional silencing of zinc finger protein 185 identified by expression profiling is associated with prostate cancer progression. Cancer Res 63,3877–3882.
Walsh J and Andrews PW (2003) Expression of Wnt and Notch pathway genes in a pluripotent human embryonal carcinoma cell line and embryonic stem cell. APMIS 111,197–210.[CrossRef][Web of Science][Medline]
Yamaguchi Y, Mann DM and Ruoslahti E (1990) Negative regulation of transforming growth factor-beta by the proteoglycan decorin. Nature 346,281–284.[CrossRef][Medline]
Yang W-M, Yao Y-L, Sun J-M, Davie JR and Seto E (1997) Isolation and characterization of cDNAs corresponding to an additional member of the human histone deacetylase gene family. J Biol Chem 272,28001–28007.
Submitted on February 21, 2004; resubmitted on March 15, 2004; accepted on March 21, 2004.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  C. M. Spiller, D. Wilhelm, and P. Koopman Retinoblastoma 1 Protein Modulates XY Germ Cell Entry into G1/G0 Arrest During Fetal Development in Mice Biol Reprod, February 1, 2010; 82(2): 433 - 443. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Szczepny, C. A. Hogarth, J. Young, and K. L. Loveland Identification of Hedgehog Signaling Outcomes in Mouse Testis Development Using a Hanging Drop-Culture System Biol Reprod, February 1, 2009; 80(2): 258 - 263. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. R Hutchison, H. M Scott, M. Walker, C. McKinnell, D. Ferrara, I. K. Mahood, and R. M Sharpe Sertoli Cell Development and Function in an Animal Model of Testicular Dysgenesis Syndrome Biol Reprod, February 1, 2008; 78(2): 352 - 360. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Rajpert-De Meyts Developmental model for the pathogenesis of testicular carcinoma in situ: genetic and environmental aspects Hum. Reprod. Update, May 1, 2006; 12(3): 303 - 323. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Pauls, H. Schorle, W. Jeske, R. Brehm, K. Steger, N. Wernert, R. Buttner, and H. Zhou Spatial expression of germ cell markers during maturation of human fetal male gonads: an immunohistochemical study Hum. Reprod., February 1, 2006; 21(2): 397 - 404. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. H.J. Looijenga, R. Hersmus, A. J.M. Gillis, R. Pfundt, H. J. Stoop, R. J.H.L.M. van Gurp, J. Veltman, H. B. Beverloo, E. van Drunen, A. Geurts van Kessel, et al. Genomic and Expression Profiling of Human Spermatocytic Seminomas: Primary Spermatocyte as Tumorigenic Precursor and DMRT1 as Candidate Chromosome 9 Gene Cancer Res., January 1, 2006; 66(1): 290 - 302. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. E. Hoei-Hansen, E. Rajpert-De Meyts, G. Daugaard, and N. E. Skakkebaek Carcinoma in situ testis, the progenitor of testicular germ cell tumours: a clinical review Ann. Onc., June 1, 2005; 16(6): 863 - 868. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. L. S. Lindegaard, J. E. Nielsen, J. Hannibal, and L. B. Nielsen Expression of the endothelial lipase gene in murine embryos and reproductive organs J. Lipid Res., March 1, 2005; 46(3): 439 - 444. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. E. Hoei-Hansen, J. E. Nielsen, K. Almstrup, S. B. Sonne, N. Graem, N. E. Skakkebaek, H. Leffers, and E. R.-D. Meyts Transcription Factor AP-2{gamma} Is a Developmentally Regulated Marker of Testicular Carcinoma In situ and Germ Cell Tumors Clin. Cancer Res., December 15, 2004; 10(24): 8521 - 8530. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||