Mol. Hum. Reprod. Advance Access originally published online on March 25, 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Molecular Human Reproduction, Vol. 10, No. 6, pp. 433-444, 2004
© European Society of Human Reproduction and Embryology 2004
Expression analysis of the human testis-specific serine/threonine kinase (TSSK) homologues. A TSSK member is present in the equatorial segment of human sperm
1Center for Research in Contraception and Reproductive Health (CRCRH), Department of Cell Biology, University of Virginia, Charlottesville, VA 22908 and 2Department of Veterinary and Animal Sciences, University of Massachusetts, 208 Paige Laboratories, Amherst, MA 01003, USA
3 To whom correspondence should be addressed at: Department of Veterinary and Animal Sciences, University of Massachusetts, 208 Paige Laboratories, Amherst, MA 01003, USA. e-mail: pvisconti{at}vasci.umass.edu
| ABSTRACT |
|---|
|
|
|---|
Two members of the human testis-specific serine/threonine (Ser/Thr) kinase family, TSSK 1 and TSSK 2, were cloned and sequenced from a human testis adaptor-ligated cDNA library using a PCR strategy. Within the cDNA, open reading frames (ORF) were defined encoding proteins of 367 and 358 amino acids respectively, as well as conserved kinase domains typical of the superfamily of Ser/Thr kinases. Both genes were intronless and mapped to chromosomes 5 and 22 respectively. The human and mouse homologues of TSSK 1 and TSSK 2, together with TSSK 3 and SSTK/FKSG82, constitute a kinase subfamily closely related to the calmodulin kinases and SNF/nim 1 kinase subfamilies. Similar to the mouse, tissue expression by northern and dot blot analysis revealed that human TSSK 1 and 2 messages are expressed exclusively in the testis. However, mRNA for these kinases can be detected in other tissues using real-time PCR. In addition, TSKS, the human homologue of a putative substrate of TSSK 1 and 2, was cloned. TSKS had an ORF of 592 amino acids and was also expressed exclusively in the testis as demonstrated by northern and dot blot analyses; however, lower levels of expression in other tissues were detected using real-time PCR. Human TSSK 2 and TSKS interacted in a yeast two-hybrid system and also co-immunoprecipitated after in vitro translation. TSSK 2 expressed in yeast and bacteria was able to autophosphorylate and also phosphorylated recombinant TSKS in vitro. Antibodies against recombinant TSSK 2 demonstrated that a member of the TSSK family was present in human testis and localized to the equatorial segment of ejaculated human sperm. In contrast, TSKS was only found in the testis. The finding of a TSSK family member in mature sperm suggests that this family of kinases might play a role in sperm function.
Key words: serine/threonine kinase/testis-specific/spermatogenesis/TSKS/TSSK
| Introduction |
|---|
|
|
|---|
Spermatogenesis, the process in which functional sperm are produced in the testis, involves specific interactions between the developing germ cells and their supporting Sertoli cells as well as hormonal regulation by the androgen-producing Leydig cells. The general organization of spermatogenesis is essentially the same in all mammals and can be divided into three distinct phases: (i) the initial phase is the proliferative or spermatogonial phase during which spermatogonia undergo mitotic division and generate a pool of spermatocytes; (ii) the meiotic phase, which yields the haploid spermatids; and (iii) spermiogenesis whereby each round spermatid differentiates into a spermatozoon (Sharpe, 1994). Although the molecular mechanisms regulating the first two phases have been relatively well characterized (Sassone-Corsi, 1997), many of the molecules involved in spermiogenesis remain uncharacterized. Mammalian spermiogenesis, the post-meiotic phase of spermatogenesis, is characterized by considerable morphological changes that occur in the haploid spermatid. Some of these changes include the formation of the acrosome and its contents, the condensation and reorganization of the chromatin, the elongation and species-specific reshaping of the cell, and the assembly of the flagellum (Sharpe, 1994). These events result from changes in both gene transcription (Hecht, 1988) and protein translation (Hake et al., 1990) that occur during this developmental period. Many proteins translated in the haploid spermatid will remain incorporated in the cytoarchitecture of the mature sperm after it leaves the testis, while others may be shed with the cytoplasmic droplet. Given these considerations, proteins that are synthesized during spermiogenesis might play necessary roles in spermatid differentiation and/or sperm functions during epididymal maturation, capacitation, sperm transport and fertilization.
Our group is interested in the study of signalling events that are involved in spermatogenesis and in sperm function. One particular area of interest focuses on signal transduction processes that modulate the acquisition of sperm fertilizing capacity. After ejaculation, sperm are able to move actively but lack fertilizing competence. They acquire the ability to fertilize in the female genital tract in a time-dependent process called capacitation (for review see Visconti and Kopf, 1998). We have recently demonstrated that capacitation is accompanied by the increase in protein phosphorylation of a subset of proteins on tyrosine residues. This increase in protein tyrosine phosphorylation is regulated by a cAMP/protein kinase A (PKA) pathway (Visconti et al., 1995a,b, 1997). With the exception of PKA, other kinase(s) involved in the regulation of capacitation remain undefined.
Post-translational modifications of proteins through phosphorylation play a role in many cellular processes such as the transduction of extracellular signals, intracellular transport, and cell cycle progression. Protein kinases make up a large family of related enzymes (Hanks et al., 1988) characterized by a homologous region of
300 amino acids. Considering the importance of phosphorylation events in the regulation of cellular mechanisms, it is not surprising that several protein kinases have been shown to be involved in spermatogenesis (Sassone-Corsi, 1997). However, only a few of them are exclusively expressed in germ cells or in the testis (Jinno et al., 1993; Walden and Cowan, 1993; Nayak et al., 1998; Toshima et al., 1998, 1999; Tseng et al., 1998; Shalom and Don, 1999). Examples of testis-specific kinases include the recently described testis-specific serine/threonine kinases (TSSK) 1, 2 and 3 (Bielke et al., 1994; Kueng et al., 1997; Zuercher et al., 2000). These kinases are expressed postmeiotically during spermiogenesis. Although the mechanism of action of the TSSK is unknown, the importance of phosphorylation events in signalling processes suggests that this kinase family might have a role in sperm differentiation and/or subsequent sperm functions during maturation, capacitation and fertilization.
To continue our studies on the TSSK family, initiated with the cloning of the mouse and human homologues of TSSK 3 (Visconti et al., 2001), we have now cloned the human homologues of TSSK 1 and TSSK 2. In addition, we have cloned the human homologue of a putative substrate of the TSSK (TSKS) (Kueng et al., 1997) and shown that this protein is abundantly expressed in testis. Interestingly, recombinant TSSK 2 is able to interact and to phosphorylate TSKS in vitro. In addition, these two proteins interact in a yeast two-hybrid assay. Antibodies made against recombinant TSSK 2 and TSKS showed that TSSK 2 is present in human testis and in ejaculated sperm, while the TSKS protein was only found in the testis. These results are the first to demonstrate that a member of the TSSK family is present in mature sperm.
| Materials and methods |
|---|
|
|
|---|
Cloning of the human homologues of TSSK1, TSSK2 and their putative substrate TSKS
Mouse TSSK 1 (also known as stk22a and FSKG81, Table I) nucleotide sequence was initially used to perform a basic local alignment search (BLAST) against the human genome database on the National Center for Biotechnology Information (NCBI) BLAST server. Mouse TSSK 1 matched an intronless sequence on chromosome 5 (Ref | NT_006899.7). This sequence was used to design PCR primers Hao73 (TCTATCCAGGATGTAAATGAGCACACT, sense), Hao74 (GAGAAGAAGCTGATGAAAATAGAGGCT, antisense), Hao75 (CTGTAGAGGGCAGCCTCAGAGGCACTG, sense), and Hao76 (GAACCATGTGGGTTACCA AGTTCAAGG, antisense). These primers were used to amplify human TSSK1 from an adaptor-ligated human testicular Marathon ready cDNA (library) (Clontech, USA). Amplimers from Hao73/Hao76 were purified using a 1% agarose gel, subcloned into a pTOPO cloning vector (Invitrogen, USA) and both strands were sequenced.
|
To clone human TSSK 2 (also known as stk22b; Table I), mouse TSSK 2 nucleotide sequence was used to retrieve the human genomic sequence using BLAST search. Mouse TSSK 2 matched an intronless sequence on chromosome 16 (AC004471). This sequence was used to design the PCR primers Hao57 (antisense, CATGGAGCTGCAGACCATGATGTA) and Hao58 (sense, GACGTCAGCCAGCGGCTGCACATC). These primers were used in combination with adaptor primers from the adaptor-ligated Marathon ready testicular cDNA library (Clontech) to obtain the full length human TSSK 2 sequence using 5' and 3' rapid amplification of cDNA end (RACE) as described by the manufacturer. The amplimers were cloned into the pTOPO plasmid after gel purification and sequenced. Finally, two primers Hao68 (antisense, TGTGCCTTCTTCAGATCCTACCTGCCT) and Hao67 (sense, TTGAGGACAATGCCTGCTGGCCCACAT), designed according to the two RACE fragments, were used to amplify the longest cDNA. The cloned cDNA was sequenced in both strands.
Human TSKS was cloned from Marathon ready human testis cDNA library (Clontech) in a two step PCR reaction. First, the 5' and 3' regions were amplified separately by PCR, using primers Hao89 (5'-ATGGCGAGCG TGGTGGTGAAGACGATC-3') and Hao90 (5'GAACAGCTTCTGCAA TTCCTGCTC-3'), or Hao65-1 (GAGGCCATTTATTGTTCAGGGGCT GAG) and Hao93 (5'-CAGCAGCAGCTGCAGGATGAGACG) pairs respectively. The 5' and 3' regions overlapped each other in the middle section by 100 bp. The amplimers were then purified by gel electrophoresis and full length TSKS was amplified using oligo primers Hao89 and Hao65-1 and a mixture of the 5' and 3' PCR products as template. The full length TSKS was purified by gel electrophoresis, subcloned into pTOPO cloning vector and sequenced.
Plasmid construction
To construct pGBKTSSK2, oligonucleotide primers Hao100 (5'-GATGAATTCGACGATGCCACAGTCCTAAGGAAG-3') and Hao101 (5'-CGAGGATCCCTAGGTGCTTGCTTTCCCCACCTC-3') were used to amplify the TSSK2 open reading frame (ORF) by PCR. The PCR fragment was then subcloned into the pGBK vector after cleavage of both the PCR amplimer and the pGBK vector with EcoRI and BamHI restriction enzymes. Similarly, the TSKS ORF was first amplified using Hao99 (5'-TCTCTCGAGTGA GGCCATTTATTGTTCAGG-3') and Hao107 (5'-GTCAAGATCTTGG CGAGCGTGGTGGTGAAGACG-3'). The amplimer cleaved by BglII and XhoI was subcloned into the pGAD between BamHI and XhoI sites.
TSSK 2 and TSKS expression plasmids pESCtrpTSSK2 and pESCleuTSKS were constructed as follows. PCR amplification of TSSK 2 with an N-terminal Myc tag was performed using pGBKTSSK2 as a template and oligo primers Hao136 (5'-ATAGCGGCCGCGAATTTGTAATACGACTCACTATA-3') and Hao101 (5'-CGAGGATCCCTAGGTGCTTGCTTTCCCCACCTC-3'). The PCR fragment was then cleaved by NotI and BamHI and inserted into the pESCtrp vector following cleavage by NotI and BglII. The pGADTSKS insert was cleaved by BglII and XhoI and inserted into the BamHI, XhoI cleaved pESCleu vector to construct pESCleuTSKS. All plasmid constructs were sequenced before transformation to confirm the correct reading frame and to ensure that no mutations had been accidentally introduced.
Multi-sequence alignment and phylogenetic analysis
Multiple sequence alignment of human TSSK 1, TSSK 2, TSSK 3 and TSSK 4 was performed using Clustal W (Thompson et al., 1994) on the EMBL/EBI server and a consensus was determined. To construct a phylogenetic tree, an amino acid BLAST search of TSSK 1 was conducted first to retrieve those kinases that showed homology to human TSSK 1. A group of 28 kinases was then chosen for multiple sequence alignment using the pile-up program in the GCG package. The pile-up file was subsequently used to construct a phylogenetic tree using the PHYLIP program in the GCG software package. The kinases used for phylogenetic tree analysis included Abl (P00519), Src1 (P12931), PKC (P17252), PKG (P00516), PKA (P17612), tpk2 (P06245), tpk1 (P06244), ark2 (P35626), ark1 (P21146), nim1 (P07334), snf1 (P06782), kin1 (P13185), kin2 (P13186), CaMKII1A (P11275), CaMKIIB (P11276), FKSG82 (AF348077), TSSK 3 (AF296450), TSSK 2 (AF362953), TSSK 1 (AY028964), tesk1 (NM_006285) (Toshima et al., 1999), tesk2 (NM_007170) (Rosok et al., 1999), nek1 (S25284), ERK2 (M64300), ERK1 (AF155236), cdc28 (P00546), Cdc2 (P06493), MCK1 (P21965)1, GSK3 (NM_017344).
Northern blots and RNA dot blot analyses
Northern and dot blot analyses were performed as previously described (Hao et al., 2002). Briefly, human multiple tissue northern membranes (MTN) containing eight human tissues with 1 µg of poly A+ RNA loaded in each lane and multi-tissue array RNA dots containing 76 tissues were purchased from Clontech. Double strand DNA of 1.35 kb (TSSK1), 1.25 kb (TSSK2) and 1.8 kb (TSKS) containing the entire ORF of the three genes were excised from pTOPO clones and used as hybridization probes for northern and dot blot hybridization analyses. The hybridization probes were prepared by the random prime labelling method using [
32P]dCTP and Klenow DNA polymerase. Hybridizations were carried out in ExpressHyb (Clontech) at 68°C for 1 h followed by two washes in 2xstandard salt citrate (SSC), 0.1% sodium dodecyl sulphate (SDS) for 20 min each at 22°C and three washes in 0.1% SSC, 0.1% SDS for 20 min, each at 65°C. Films were exposed 2496 h at 80°C with two intensifying screens. After the probes were stripped, the same membranes were probed with ß-actin as the loading control.
For hybridization with multi-tissue RNA dot blots, the same probes were used. Hybridizations were performed at 68°C overnight in ExpressHyb solution containing single-stranded salmon sperm DNA and Cot-1 DNA following the manufacturers instructions. The array contained 76 human tissues including whole brain, cerebral cortex, frontal lobe, parietal lobe, occipital lobe, temporal lobe, paracentral gyrus of cerebral cortex, pons, left cerebellum, right cerebellum, corpus callosum, amygdala, caudate nucleus, hippocampus, medulla oblongata, putamen, substantia nigra, accumbens nucleus, thalamus, pituitary gland, spinal cord, heart, aorta, left atrium, right atrium, left ventricle, right ventricle, interventricular septum, apex of the heart, oesophagus, stomach, duodenum, jejunum, ileum, ilocaecum, appendix, ascending colon, transverse colon, descending colon, rectum, kidney, skeletal muscle, spleen, thymus, peripheral blood lymphocytes, lymph node, bone marrow, trachea, lung, placenta, bladder, uterus, prostate, testis, ovary, liver, pancreas, adrenal gland, thyroid gland, salivary gland, mammary gland, leukaemia HL-60, Hela S3, leukaemia K-562, leukaemia MOLT-4, Burkkitts lymphoma Raji, Burkkitts lymphoma Daudi, colorectal adenocarcinoma SW480, lung carcinoma A549, fetal brain, fetal heart, fetal kidney, fetal liver, fetal spleen, fetal thymus, and fetal lung. The membranes were washed twice in 2xSSC, 0.1% SDS each at 22°C for 10 min and twice in 0.1% SSC, 0.1% SDS each at 68°C for 20 min and exposed for 96 h at 80°C.
Real-time RTPCR analysis
First strand cDNA was prepared from 5 µg of total RNA from human testis (Ambion, USA) using 1 µmol/l oligo d(T) primer (Ambion) and Omniscript reverse transcriptase (Qiagen, USA) in a 100 µl reaction using the reaction buffer supplied by the manufacturer. Real-time RTPCR was performed using a Bio-Rad (USA) i-cycler IQ system. Primer pairs were validated in 20 µl PCR reactions containing 2 µl of testis cDNA, 10 µl of IQ SYBR Green supermix (BioRad), and 0.6 µl of a 10 µmol/l stock of each primer (0.3 µmol/l final concentration). Cycle conditions were 95°C for 3 min followed by 45 cycles of 95°C for 10 s and 60°C for 30 s. The amplification was followed by melting curve analysis in which the PCR products were denatured at 95°C for 1 min and annealed at 72°C for 10 s. The temperature was then increased in 0.1°C increments while monitoring the loss of SYBR green fluorescence. Each primer pair amplified a single product with a sharp melting peak at a temperature consistent with the calculated Tm of the predicted PCR product. Agarose gel electrophoresis confirmed that the amplified products had the expected sizes. No products were obtained when reverse transcriptase was omitted from the cDNA synthesis reactions.
The oligonucleotide primers were all purchased from Qiagen Operon (Alameda, USA). Where possible, the primers were selected to span a splice junction. Obviously, this could not be done in cases of intronless genes such as TSSK 1 and TSSK 2. Primer pairs for each gene were: TSSK 1, 5'-GCC CCTAGGTGGATGAGG-3' (forward) and 5'-TCACGCTCTGGGGGAGTA-3' (reverse); for TSSK 2, 5'-GGGTTCCTACGCAAAAGTCA-3' (forward) and 5'-GTTTTCTTGCGGTCGATGAT3' (reverse); for TSSK 3, 5'-GGG GAAGGGACCTACTCAAA-3' (forward) and 5'-GTCCAGGGTACG GACGATTT-3' (reverse); for TSSK 4, 5'-TACGCGTCACCCGAGTGCT-3' (forward) and 5'-ACGCCCATGCTCCACACA (reverse); for TSKS, 5'-GCTGAGCGAGAATCTGGAG-3' and 5'-TTCAGCATCTTCCACAGACC-3'; for TSKS-1 5'-GGATTCAAATGAGGCTCCAAC-3' (forward) and 5'-TGGAGGTAGCGCAGCTTCT-3' (reverse); for glyceraldehyde-3-phosphate dehydrogenase (GADPH), 5'-ATCATCAGCAATGCCTCCTG-3' (forward) and 5'-ATGGCATGGACTGTGGTCAT-3' (reverse).
Relative levels of mRNA expression in human tissues were determined using multiple tissue cDNA (MTC) panels from BD Biosciences (USA) in real-time PCR reactions as described above. The point at which the PCR product is first detected above a fixed threshold, termed cycle threshold (Ct), was determined for each sample. Melting curve analysis confirmed the amplification of only the expected product. To determine the quantity of gene-specific transcripts present in each tissue cDNA relative to testis, their respective Ct values were first normalized by subtracting the Ct value obtained from the GADPH control (e.g.
Ct = Ct TSSK 3 Ct GADPH). The concentration of gene-specific mRNA in a given tissue relative to testis was then calculated by subtracting the normalized Ct values obtained with each tissue from that obtained with testis (e.g. 
Ct =
Ct of brain
Ct of testis), and the relative concentration was determined (relative concentration = 2ÄÄCt).
Expression of TSSK 2 and TSKS and antibody production
TSSK 2 and TSKS were subcloned into a pET28b expression vector (Hao et al., 2002) and the respective recombinant proteins expressed in Escherichia coli. The recombinant TSSK 2 contained the entire ORF of human TSSK 2 plus a histidine (his) tag in its amino terminus, whereas the recombinant TSKS contained a differentially spliced version of TSKS and a his tag in its amino terminus. This version of differentially spliced TSKS is otherwise 100% identical to the testis transcript (from amino acids 20 to 386) except the unique leader sequence (amino acid 119). The recombinant proteins were purified using a Ni-NTA affinity column and subsequently resolved by preparative SDSPAGE using a Prep-Cell apparatus (Model 491; Bio-Rad, USA). The purified proteins, which appeared as single bands on SDSPAGE after silver staining, were used for injection into rats following the schedule previously described (Hao et al., 2002).
Preparation of sperm
Semen specimens were obtained from volunteers by masturbation. The use of semen samples was approved by the UVA Human Investigation Committee. Individual semen samples were allowed to liquefy at room temperature (0.53 h) and mature sperm were purified by Percoll (Pharmacia Biotech, Sweden) density gradient centrifugation as previously described (Naaby-Hansen et al., 1997). The basic medium used for all experiments was modified human tubal fluid (mHTF; Irvine Scientific, USA). Sperm presenting >90% motility were prepared immediately for either western blots or immunofluorescence experiments.
Immunofluorescence microscopy
Sperm were air-dried onto slides, washed three times with PBS, permeabilized with methanol, washed with PBS and then blocked with 10% normal goat serum (NGS) in PBS. Incubations were then carried out with
TSSK 2 antibodies (1:250) diluted in PBS with 1% NGS (PBS-NS), washed and incubated with FITC-conjugated F(Ab)2 fragments of donkey
rat IgG (1:200) (Jackson ImmunoResearch) in PBS-NS. Slides were washed with PBS and mounted with Slow-Fade Light (Molecular Probes, USA). Sperm were observed by differential interference contrast (DIC) and epifluorescence microscopy using a Zeiss axiophot microscope (Carl Zeiss, Inc., USA).
SDSPAGE and immunoblotting
After incubation under different experimental conditions, the sperm were concentrated by centrifugation 10,000 xg 2 min at room temperature, washed in 1 ml of phosphate-buffered saline (PBS) containing 1 mmol/l sodium orthovanadate, resuspended in sample buffer (Laemmli, 1970) without 2-mercaptoethanol and boiled for 5 min. After centrifuging, the supernatants were saved and 2-mercaptoethanol was added to a final concentration of 5%, the sample was boiled for 5 min, and then subjected to 10% SDSpolyacrylamide gel electrophoresis (PAGE) (Laemmli, 1970). Testis extracts were obtained from Clontech. Electrophoretic transfer of proteins to Immobilon P (Bio-Rad) and immunodetection were carried out using
TSSK 2 rat polyclonal antibodies as previously described (Kalab et al., 1994). Immunoblots were developed with the appropriate secondary antibody conjugated to horseradish peroxidase (Sigma Chemical Co., USA) and an ECL kit (Amersham Corp., USA) according to the manufacturers instructions.
In vitro transcription/translation and immunoprecipitation
In vitro transcription/translation was performed using the TNT Quick Coupled Transcription/Translation System (Promega, USA) following the manufacturers instruction. Plasmids with TSSK 2 (tagged with myc in the N terminus) and TSKS (tagged with HA in the N-terminus) inserts immediately downstream of a T7 promoter in pGBK and pGAD respectively were used as templates. In vitro transcription and translation were started with the addition of the TNT quick master mix, methionine and the plasmid templates. The mixture was incubated at 30°C for 6090 min and stopped by addition of 2xSDS loading buffer for western blot analysis using monoclonal anti-myc antibody (mouse; Clontech) or monoclonal anti-HA high affinity antibody (3F10; Roche, USA). For co-immunoprecipitation assay, TSSK 2 and TSKS were transcribed and translated in the same reaction as above. The reactions were stopped by addition of 2xkinase buffer (see below for composition). To immunoprecipitate the tagged proteins, the in vitro-translated proteins were incubated with either myc antibody coupled to agarose beads (Clontech) or HA antibody coupled to agarose beads (Roche) for 1 h at 4°C. Following three washes with 1xkinase buffer, the beads were boiled in SDS loading buffer, and analysed by western blot. The reaction mixture without plasmid template and treated identically served as the negative control.
Two-hybrid analysis
The Match-Maker two-hybrid System 3 (Clontech) was used to assess proteinprotein interactions. To detect interaction between human TSSK 2 and TSKS, TSSK 2 was fused with Gal4 DBD in pGBKT7 whereas TSKS was fused with Gal4 AD in pGADT7 (see above). The two plasmids were co-transformed into the AH109 host strain (Genotype: Mat a, trp1-901, leu2-3, 112, ura3-52, his3-200, gal4
, gal80
, LYS2::GAL1UAS-GAL1TATA-HIS3, MEL1 GAL2UAS-GAL2TATA-ADE2, URA3::MEL1UAS-MEL1TATA-lacZ) and analysed for expression of both hybrid proteins (DBD-TSSK 2, AD-TSKS) by western blot of myc-tagged and HA-tagged protein respectively. The AH109 transformants harboring both pGBKT7-TSSK 2 and pGADT7-TSKS were streaked out in complete drop-out medium (SCM) lacking tryptophan, leucine and histidine to test for histidine prototrophy. Two plasmids containing simian virus (SV) 40 large T antigen (LgT) fused with GALAD in pGADT7 and p53 fused with GALDBD in pGBKT7 were co-transformed into AH109 and used as positive controls.
-Galactosidase reporter gene activity was measured following instructions provided in the kit (Match-Maker two-hybrid System 3; Clontech) with minor modification. Briefly, AH109 clones harbouring both pGBK TSSK 2 and pGAD TSKS were cultured in SCM-leu-trp medium to optical density (OD)600 nm
1.0. One millilitre of culture from each inoculation (in triplicate) was centrifuged in a 1.5 ml centrifuge tube at 10,000 xg for 2 min, at 22°C. The supernatants were carefully transferred to fresh tubes on ice. Aliquots of 120 µl of culture supernatant were mixed with 360 µl of assay buffer [prepared by mixing two volumes of 0.5 mol/l sodium acetate pH 4.5 and 1 vol of 100 mmol/l of p-nitrophenyl
-D-galactopyranoside (PNP-
-Gal)]. The reaction mixes were incubated at 30°C for 5 h before stopping the reaction with the addition of 520 µl of stop buffer (1 mol/l sodium carbonate). The OD410 of each reaction was recorded by a spectrophotometer using a reaction mix containing SCM-leu-trp medium in the place of culture supernatant as the blank. The activity was expressed either as arbitrary units or percentage of wild type gene (as a way to record interaction strength between TSSK 2 and TSKS deletion mutants). Each assay was repeated three times and the average was reported.
Expression of TSSK 2 and TSKS in yeast, preparation of protein extracts and in vitro kinase assay
To express human TSSK 2 and TSKS in yeast for in vitro kinase assay, the pESC-trp-TSSK 2 with an N-terminal myc tag and pESC-leu-TSKS with an N-terminal HA tag were constructed as above. Yeast host strain YPH500 (Genotype: Mat-
ura3-52, lys2-801amber, ade2-201ochre, trp1-
63, his3-
200, leu2-
1) was transformed either with pESC-trp-TSSK 2 alone or together with pESC-leu-TSKS. To make yeast protein extracts, yeast transformants carrying appropriate plasmid(s) were cultured in selective media to mid-log phase (OD600 <1.0). Cells were harvested by centrifugation at 4000 g for 15 min, washed twice in ice-cold water and suspended in appropriate volume of ice-cold HB buffer with protease inhibitors (see above) to make non-denaturing protein extracts using the beads-beating method. Alternatively, denaturing protein extracts were made by mixing a 1:1 ratio of 20% trichloroacetic acid (TCA), yeast cell suspension in TCA buffer (Tris 20 mmol/l, EDTA 2 mmol/l, ammonium acetate 50 mmol/l pH 8.0 plus protease inhibitor cocktail (Roche) and 425600 µm diameter glass beads (Sigma, USA). The cells were dissociated in a screw-capped tube for 2x30 s using a bead-beater (Biospec, USA) at the highest setting. The supernatant was collected and the remaining beads were washed again by suspending in appropriate volumes of a 1:1 mix of 20% TCA and TCA buffer and dissociated for another 30 s. The proteins were then collected by centrifugation at 10,000 xg. In all cases we used a microcentrifuge at maximum setting for 10 min at 4°C. The tagged proteins were immunoprecipitated individually with myc (9E10) or HA high affinity monoclonal antibody (3F10) coupled to agarose beads and washed thoroughly. In vitro kinase assay was performed as described previously (Visconti et al., 1997). Briefly, recombinant TSSK 2 bacterial soluble fraction before and after induction with isopropyl-ß-D-thiogalactopyranoside (IPTG) were used as the source of enzyme and incubated at 30°C for 10 min in a buffer containing 10 mmol/l TrisHCl pH 7.4, 10 mmol/l MgCl2, 10 mmol/l MnCl2, 10 µmol/l aprotinin, 10 µmol/l leupeptin, 100 µmol/l Na3VO4, 40 mmol/l p-nitrophenyl phosphate, 40 mmol/l ß-glycerol phosphate and 5 µCi [32P]
ATP. In some cases, to evaluate the ability of TSSK 2 to phosphorylate TSKS, the purified C-terminal domain of recombinant TSKS was added to the reaction. The phosphorylation assay was then stopped by boiling in sample buffer and the 32P incorporation was analyzed using 10 % PAGE and autoradiography. The same buffer was used to evaluate whether immunoprecipitates contained yeast recombinant TSSK 2 kinase activity. In this case, immunoprecipitation was performed after immunoprecipitation with
-Myc antibodies. After the phosphorylation reaction, the beads were boiled in sample buffer and the 32P incorporation evaluated by PAGE and autoradiography.
| Results |
|---|
|
|
|---|
Nomenclature, chromosomal localization and homology of the TSSK family
Since the first member of the TSSK family was identified and cloned in 1993 (Bielke et al., 1994), several groups have cloned other members of this family, and as a consequence, several names have been assigned to these kinases, lending a measure of confusion to the field. In this section, a nomenclature for the TSSK family is introduced. The original name TSSK given by Bielke et al. (1994) shall be adhered to for reasons of historical accuracy and the fact that TSSK stands for testis-specific serine kinase, a term that reflects both the function of these enzymes and the abundant (although not exclusive) expression in the testis (see results below). Other names given to this kinase family are presented in Table I, including the genome-annotated designations of the four TSSK members.
In the mouse, two homologous Tssk family members, Tssk1 and Tssk2, are closely linked on chromosome 16 A3. This region of the mouse chromosome is syntenic to human chromosome 22q11.21 where two human homologues of mouse Tssk are closely mapped. One of these human sequences on 22q11, which we designate TSSK1b, appears to represent a truncated, non-transcribed pseudogene related to mouse Tssk 1. The longest possible open reading frame for TSSK1b encodes a potential protein fragment corresponding to the C terminus of TSSK1. This fragment spans amino acids 196358 of TSSK1 and lacks a complete kinase domain. Hence, TSSK 1b is predicted to be inactive as a kinase. This human pseudogene appears as TSSK 1 or SPOGA 1 in databases. The term TSSK 1b (Table I) is proposed particularly to differentiate this pseudogene from the authentic human homologue of TSSK 1 located on chromosome 5. The second TSSK gene located on human chromosome 22 is 87% identical to mouse Tssk 2 and has been designated TSSK 2 in our nomenclature while its gene symbol is STK22B. Human TSSK 2 and TSSK1b are localized in a region deleted in DiGeorges syndrome.
Human TSSK 1 is 85% identical to mouse Tssk1 and maps to human chromosome 5q22.2 in a region without synteny to mouse chromosome 16, the locus where mouse TSSK1 is found. The evolutionary significance of this lack of synteny is not apparent at present. As described before, the human TSSK 3 gene maps to chromosome 1p34.3 and is syntenic with the mouse Tssk 3 gene on chromosome 4 D2.2 (Visconti et al., 2001). Another predicted gene with high homology to TSSK is SSTK or FKSG82. The SSTK gene maps to chromosome 19p13.11 and has a mouse homologue, Sstk, in the syntenic region of mouse chromosome 8 B3.3. Expression analysis of SSTK mRNA (see below) and expressed sequence tags (EST) sequences suggest that this gene is also abundantly expressed in the testis. Due to the high homology between SSTK and the other members of the TSSK family, we propose the name TSSK 4 for the protein encoded by the gene SSTK. The gene symbols for the TSSK family are currently STK22A-D for TSSK 13 and SSTK for TSSK 4. Since it is now clear that these genes are distributed on chromosomes 5, 22, 1 and 19 (humans) and 16, 4 and 8 (mice), a renaming of these genes is warranted, since the 22 chromosomal designation no longer applies to all members. Table I summarizes a proposed nomenclature for the members of the TSSK family including alternative names, chromosomal localizations and current gene symbols. We hope this nomenclature is considered by the Human Genome Nomenclature Committee.
It is noteworthy that the genes encoding human TSSK 1 and TSSK 2 encode proteins of 367 and 358 amino acids respectively, and are intronless, as are their corresponding mouse homologues. The human TSSK 3 and TSSK 4 genes, by comparison, each have two exons that encode proteins of 268 and 273 amino acids respectively.
The human TSSK (Figure 1) show very high homology at the amino acid level. The identity between TSSK 1 and TSSK 2 is 83% in the kinase region. This identity, however, decreases to 72% across the entire ORF, reflecting a divergence of the C-terminal amino acid sequence (Figure 1). In comparison, the TSSK 3 protein has 47.5 and 49% identity with TSSK 1 and TSSK 2 respectively. Unlike TSSK 3, TSSK 1 and TSSK 2 have an
100 amino acid C-terminal extension located outside the kinase domain.
|
A phylogenetic tree was constructed as indicated in Materials and methods using sequences from 28 human kinases with high homology to TSSK 2 (Figure 2). This study showed that the TSSK 1 and TSSK 2 genes constitute a subfamily within the TSSK kinase family, which, in turn, lies within the superfamily of Ser/Thr kinases. Other related kinases, in order of decreased similarity to TSSK 1 and TSSK 2, include TSSK 3 and TSSK 4. In addition, CaMK IIA, CaMK IIB, KIN1, KIN2 and nim1, SNF have significant homology with the TSSK family.
|
Tissue expression of the TSSK family by northern and dot blots
In mouse, the expression of TSSK 1, TSSK 2 and TSSK 3 is reported to be limited to testicular germ cells (Kueng et al., 1997; Visconti et al., 2001). Expression of TSSK 3 is also testis specific in humans using similar methods (Visconti et al., 2001). To evaluate the tissue distribution of TSSK 1 and TSSK 2 in humans, the human homologues of TSSK 1 and TSSK 2 were cloned. The expression pattern of TSSK 1 and TSSK 2 was analysed by northern and dot blots of multiple human tissues as described above (Figure 3B and C). Similar to results reported in the mouse, these techniques showed that mRNA corresponding to TSSK 1 and TSSK 2 were detected exclusively in the testis. Although it is not possible to discount lower levels of expression of these genes in other tissues, these northern analyses suggest that TSSK 1 and TSSK 2 are abundant within and predominantly expressed in the testis. Northern blots corresponding to TSSK 1 showed two bands of 1.5 and 2.7 kb (Figure 3B). Since TSSK 1 and TSSK 1b are highly homologous, and TSSK 1 b predicts a truncated form of TSSK 1, it is possible that the 1.5 kb message represents expression of the truncated TSSK 1b gene whose message is predicted to be 1.4 kb. TSSK 2 gave only a single band of 1.7 kb.
|
The tissue distribution of a putative human testicular substrate of TSSK 1 and TSSK 2, named TSKS (testis-specific kinase substrate), previously discovered by the Ziemiecki group in the mouse (Kueng et al., 1997), was also explored by northern and dot blot analyses of human tissues. In mouse, TSKS interacts with TSSK 2 and with TSSK 1 in a yeast two-hybrid system and can be phosphorylated in vitro by TSSK 2 and TSSK 1. To investigate whether TSKS is highly expressed in the human testis, the human TSKS homologue was cloned as described in Materials and methods. Similar to the mouse, analysis of TSKS tissue distribution by northern and dot blot analysis showed a 2.0 kb message that was exclusively expressed in the testis.
Real-time PCR analysis of TSSK tissue distribution
Although northern and dot blot techniques indicated that TSSK 1, TSSK 2 and TSSK 3 were only expressed in the testis, to evaluate the possibility of lower mRNA expression levels in other tissues, real-time PCR was used with probes specific for each of the TSSK kinases, including TSSK 4. Although TSSK 1 and TSSK 2 were abundantly expressed in the testis (Figure 4), several other tissues showed lower levels of expression. TSSK1 was noted in pancreas, while TSSK2 expression was noted in heart, brain and placenta. By contrast, TSSK 3 and TSSK 4 were only found to be expressed in the testis (Figure 4). It is not clear at present whether the low expression of TSSK 1 and TSSK 2 in other tissues has a physiological significance.
|
Recombinant human TSSK 2 and TSKS interact
Two different approaches were used to investigate whether the human homologues of TSSK 2 and TSKS interact. First, the interaction between TSSK 2 and TSKS was analysed using a yeast two-hybrid system (Clontech) as described in the Materials and methods section. The TSSK 2 ORF was fused with Gal4 DNA binding domain (DBD) (Myc tag) and the TSKS ORF was fused with Gal4 DNA activation domain (AD) (HA tag). As a positive control, p53 was fused with Gal4 DBD, and simian virus SV40 large T (LgT) was fused with Gal4 AD. The S. cerevisiae host strain AH109 was transformed with four pairs of plasmids, which contained GalDBD + GalAD-TSKS, GalDBD-TSSK 2 + GalAD-TSKS, GalDBD + GalAD-LgT and GalDBD-p53 + GalAD-LgT; as expected, they all grew on SCM plates lacking both leucine and tryptophan (Figure 5A). Western blot analysis showed that all proteins were expressed (Figure 5B). On re-streaking the same transformed colonies onto SCM plates lacking leucine, tryptophan and histidine, only the GalDBD-TSSK 2 + GalAD-TSKS and GalDBD-p53 + GalAD-LgT pair supported growth (Figure 5 A). This experiment indicated that TSSK 2 and TSKS are able to interact, bring together GalDBD and GalAD and cause activation of histidine amino acid synthesis in the host strain similar to the positive control pair GalDBD-p53 + GalAD-LgT. To confirm these data and to semi-quantify the strength of the interaction,
-galactosidase activity was measured in culture supernatants of yeast clones harbouring GalDBD + GalAD-TSKS, GalDBD-TSSK 2 + GalAD-TSKS, and GalDBD-p53 + GalAD-LgT (Figure 5C).
-Galactosidase activity was significantly higher when GalDBD-p53 and GalAD-LgT (8-fold higher) and when GalDBD-TSSK 2 and GalAD-TSKS (12-fold higher) were expressed together in comparison with
-galactosidase activity when GalDBD + GalAD-TSKS were co-expressed.
|
As a second approach, an in vitro transcription/translation system coupled with a co-immunoprecipitation approach was used to further investigate whether human TSSK 2 and human TSKS are able to form a complex when co-expressed. Expression plasmids PGBK-TSSK2 (TSSK 2 tagged with Myc) and pGAD-TSKS (TSKS tagged with HA) were transcribed and translated together in a rabbit reticulocyte-based expression system. A mouse monoclonal antibody against the myc tag coupled to agarose beads (Clontech) was used to immunoprecipitate TSSK 2, whereas an anti-HA tag rat monoclonal antibody (3F10) coupled to agarose beads was used to precipitate TSKS (Figure 5D). As predicted, the TSKS-HA was precipitated by anti-HA immunoreagents and TSSK 2-myc was immunoprecipitated by anti-myc antibodies, validating that each tagged protein was appropriately immunoreactive. Importantly, anti-HA precipitated TSSK 2-myc, and conversely, anti-myc also precipitated TSKS-HA. The control anti-HA antibodies did not precipitate TSSK 2-Myc and conversely, anti-Myc antibodies were not able to precipitate TSKS-HA (Figure 5E). These cross-immunoprecipitation results using co-expression in the reticulocyte transcription/translation system reinforce the yeast two-hybrid data and together offer evidence in support of the hypothesis that human TSSK 2 and human TSKS interact.
Recombinant human TSSK2 phosphorylates TSSKS author correct?
To analyse TSSK 2 kinase activity and its ability to phosphorylate TSKS, TSSK 2 was expressed in bacteria. The soluble recombinant TSSK 2 was assayed for kinase activity in the presence or in the absence of recombinant TSKS. As shown in Figure 6A (left panel), recombinant TSSK 2 incorporated 32P in an in vitro phosphorylation assay indicating autophosphorylation. In addition, when TSKS was present in the incubation assay, TSKS was also phosphorylated. To enrich both TSSK and TSKS, immunoprecipitation after phosphorylation was employed. Anti-Myc immunoprecipitates of yeast extracts containing TSSK 2-Myc also incorporated 32P in the phosphorylation assay (Figure 6A, right panel). Parallel samples were probed with anti-Myc antibodies and showed the presence of TSSK 2-Myc in the immunoprecipitates (Figure 6B). The robust phosphorylation signal observed in bacteria extract in the absence of induction is likely to be an endogenous bacterial substrate for an endogenous bacterial kinase or alternatively the autophosphorylation of an endogenous kinase. Although reduced, this signal is also visible in the induced population.
|
Western blot and immunofluorescence analyses of TSSK 2
Purified TSSK 2 was used to produce rat polyclonal antibodies that were used for western blots analysis of human sperm and testis (Figure 7A). Anti-TSSK 2 recognized the recombinant protein and also a protein in sperm and testes with the predicted mol. wt of 40 kDa, suggesting that at least one member of the TSSK family was present in ejaculated sperm. On the other hand, anti-TSKS only recognized a protein in testis but not in ejaculated sperm. Anti-TSSK 2 was then used to study the intracellular localization of this protein in human sperm. Figure 7B shows that TSSK 2 localized to the sperm head, with staining most intense in the equatorial segment. Control experiments were performed using rat preimmune serum and both western blot and immunofluorescence results were negative (Figure 7A, plus data not shown). Although the antibody against TSSK 2 was produced against recombinant TSSK 2, we cannot discard the possibility of cross-reactivity with other members of the TSSK family since their sequences have high homology.
|
| Discussion |
|---|
|
|
|---|
Protein kinases play a pivotal role in intracellular signal transduction systems involved in the regulation of cell proliferation, differentiation, metabolism, and other activities. An increasing number of genes encoding putative protein kinases have been isolated by cDNA cloning (Lindberg and Hunter, 1990; Cance et al., 1993). Some of these newly identified protein kinases contain catalytic and non-catalytic domains unrelated to known members of the protein kinase family. These novel members are assumed to be involved in signalling pathways for which the substrates remain undefined. One classical example where a new kinase was identified before its substrates were defined is in the JAK family of protein kinases. This protein kinase family was identified as a solitary class of protein kinases not related to any other known kinases (Cance et al., 1993) and were later demonstrated to be involved in signalling pathways mediating interferon and other cytokine effects (Silvennoinen et al., 1993; Watling et al., 1993).
The TSSK family of kinases are at present hypothesized to be involved in spermatogenesis and/or sperm function, although the precise pathways are unclear. The first member of this family (TSSK1) was cloned by Bielke et al. (1994) using degenerate oligonucleotides corresponding to two highly conserved motifs within the protein kinase catalytic domain and a PCR-based cloning strategy. Another two members were subsequently cloned by the same group and/or by others using different methodologies (Kueng et al., 1997; Zuercher et al., 2000; Visconti et al., 2001). The sequence of a fourth member of the TSSK family, SSTK/FKGS82 (TSSK 4), has been deduced using bioinformatics. The TSSK family is closely related to a variety of other protein kinases. TSSK 1 displays high homology to a group of yeast Ser/Thr kinases encoded by SNF-1, nim-1, KIN-1 and KIN-2 (Bielke et al., 1994). Tssk 2, on the other hand, is the mouse homologue of the human DiGeorge syndrome gene (DGSG). This human gene has been characterized as one of 11 putative transcription units encoded in the minimal DiGeorge critical region of 250 kb, located in the proximal arm of human chromosome 22 (Gong et al., 1996; Galili et al., 1997; Kueng et al., 1997). Of these genes, the transcription factor tbx1 is the gene responsible for developmental disorders observed in Di Georges syndrome (Epstein, 2001; Lindsay et al., 2001; Merscher et al., 2001). However, the localization of TSSK 2 in the same region of chromosome 22 has been responsible for assignment of the name stk22 b to this gene. Since other members of this kinase family have a different chromosomal localization (Table I), a nomenclature change of these kinases from stk22 to TSSK and stk22 a, b, c and d to TSSK 1, 2, 3 and 4 may both simplify and clarify this family of genes. Reasons for assigning the name TSSK (testis specific serine/threonine kinases) to these kinase are: (i) a short sequence motif in the kinase subdomain VIB (DKCEN) (Figure 1) diagnostic for ser/thr kinases is present in all the members of this family; (ii) northern, dot blot and real-time PCR analyses indicate that these kinases are mainly expressed in the testis; (iii) the first cloned member of this family was originally named TSSK.
The human homologues of TSSK 1 and 2 cloned in the present study have a high percentage identity with mouse TSSK 1 and TSSK 2 (84 and 92% respectively), suggesting that they are the authentic human orthologues of the mouse genes. The four members of the TSSK family have high homologies in their kinase domains with TSSK 1 and 2 presenting the highest homology, followed closely by TSSK 3 and TSSK 4. Similar to results in the mouse, northern and dot blot analyses of human TSSK 1, 2 and 3 indicate that they are exclusively expressed in the testis. However, real-time PCR analysis revealed lower levels of expression in other tissues. Whether the low expression of TSSK kinases in other tissues has physiological relevance is still not known. Although the TSSK 4 cDNA has yet to be cloned, Unigene analysis showed several EST corresponding to this gene that are expressed in the testis, suggesting that TSSK 4 is also a testis-abundant message. This hypothesis is supported by real-time PCR experiments shown in this manuscript.
In the mouse, Tssk 1, 2 and 3 have been found expressed postmeiotically in germ cells. This expression pattern suggests a role in spermiogenesis or in sperm function. A putative substrate of Tssk 1 and 2, Tsks, has an expression pattern similar to these kinases (Kueng et al., 1997) and was shown to interact with these kinases using a yeast two-hybrid approach. After immunoprecipitation of Tssk 1 and Tssk 2 from testicular extracts, Tsks remained associated with these kinases and became phosphorylated in an in vitro assay (Kueng et al., 1997). In the present report, the human homologue of TSKS was cloned and two approaches, a yeast two-hybrid system and co-immunoprecipitation, demonstrated that TSKS is able to interact with TSSK 2. Similar to the TSSK family, human TSKS is also a testis-abundant message as shown by northern and dot blots. The role of TSKS has yet to be established.
Recombinant human TSSK 2 and TSKS were used to obtain rat polyclonal antibodies and these antibodies recognized the recombinant proteins by western blots. Anti-TSSK 2 antibodies demonstrate the presence of a 40 kDa band in sperm and in testicular extracts. In contrast, TSKS protein was only recognized in the testis. Due to the high homology between TSSK 1 and TSSK 2, it is not possible to know which of these kinases are recognized by the anti-TSSK 2 antibody. However, the presence of at least one TSSK kinase in sperm suggests that this kinase family might have a role in sperm function.
Several different protein phosphorylation events regulate sperm motility (Eddy and OBrien, 1994) and capacitation (Visconti et al., 2002); one of the protein kinases playing a role in both processes is PKA. However, other protein kinases involved in these processes are not known. The presence of at least one member of the TSSK family in the equatorial segment of human sperm suggests that this kinase(s) could have a role in some of the properties attributed to this sperm structure. The equatorial segment is the place where the fusion events accompanying the acrosome reaction begin. After the acrosome reaction is completed, the equatorial segment remains attached to the sperm and becomes the first sperm structure to interact with the oocyte oolema. It is believed that most of the proteins needed for the fusion between the sperm and the oocyte reside in this subcellular compartment. Proteins in this region are also the first to go inside the oocyte and could be involved in oocyte activation as sperm factors. In addition, the equatorial segment remains intact after the principal segment is lost during the acrosome reaction and proteins in this domain may play a role in equatorial segment structural integrity. Lastly, the equatorial segment is the region where breakdown of the nuclear envelope is initiated (Wolkowicz et al., 2003).
In sum, although the mechanism of action of the TSSK family is unknown, the importance of phosphorylation events in signalling processes, the conservation of the kinase domains in the three human TSSK, and the TSSK(s) expression patterns suggest that TSSK might have a role in mammalian germ cell differentiation and/or sperm function. The TSSK sequences present several differences compared to other known members of the kinase family, which suggests that specific inhibitors toward this kinase family could be obtained, raising interest in these molecules as contraceptive targets.
| Acknowledgements |
|---|
This study was supported by NIH HD38082 (to P.E.V.), by U54HD29099 and a grant from Schering AG (to J.C.H.) and by the Andrew W.Mellon Foundation. Z.H. and K.J. were supported by D43TW/HD00654 from the Fogarty International Center.
| REFERENCES |
|---|
|
|
|---|
Bielke W, Blaschke RJ, Miescher GC, Zurcher G, Andres AC and Ziemiecki A (1994) Characterization of a novel murine testis-specific serine/threonine kinase. Gene 139,235239.[CrossRef][Web of Science][Medline]
Cance WG, Craven RJ, Weiner TM and Liu ET (1993) Novel protein kinases expressed in human breast cancer. Int J Cancer 54,571577.[Web of Science][Medline]
Eddy EM and OBrien DA (1994) The Spermatozoon. In Knobil E and Neill JD (eds) The Physiology of Reproduction, vol 1 Raven Press, New York, pp 2977.
Epstein JA (2001) Developing models of DiGeorge syndrome. Trends Genet 17,S1317.[CrossRef][Medline]
Galili N, Baldwin HS, Lund J, Reeves R, Gong W, Wang Z, Roe BA, Emanuel BS, Nayak S, Mickanin C et al (1997) A region of mouse chromosome 16 is syntenic to the DiGeorge, velocardiofacial syndrome minimal critical region [published erratum appears in Genome Res (1997) 7(4), 399]. Genome Res 7,1726.
Gong W, Emanuel BS, Collins J, Kim DH, Wang Z, Chen F, Zhang G, Roe B and Budarf ML (1996) A transcription map of the DiGeorge and velo-cardio-facial syndrome minimal critical region on 22q11. Hum Mol Genet 5,789800.
Hake LE, Alcivar, AA and Hecht, NB (1990) Changes in mRNA length accompany translational regulation of the somatic and testis-specific cytochrome c genes during spermatogenesis in the mouse. Development 110,249257.[Abstract]
Hanks SK, Quinn AM and Hunter T (1988) The protein kinase family: conserved features and deduced phylogeny of the catalytic domains. Science 241, 4252.
Hao Z, Wolkowicz MJ, Shetty J, Klotz K, Bolling L, Sen B, Westbrook VA, Coonrod S, Flickinger CJ and Herr JC (2002) SAMP32, a testis-specific, isoantigenic sperm acrosomal membrane-associated protein. Biol Reprod 66,735744.
Hecht NB (1988) Post-meiotic gene expression during spermatogenesis. Prog Clin Biol Res 267,291313.[Medline]
Jinno A, Tanaka K, Matsushime H, Haneji T and Shibuya M (1993) Testis-specific mak protein kinase is expressed specifically in the meiotic phase in spermatogenesis and is associated with a 210-kilodalton cellular phosphoprotein. Mol Cell Biol 13,41464156.
Kalab P, Visconti P, Leclerc P and Kopf GS (1994) p95, the major phosphotyrosine-containing protein in mouse spermatozoa, is a hexokinase with unique properties. J Biol Chem 269,38103817.
Kueng P, Nikolova Z, Djonov V, Hemphill A, Rohrbach V, Boehlen D, Zuercher G, Andres AC and Ziemiecki A (1997) A novel family of serine/threonine kinases participating in spermiogenesis. J Cell Biol 139,18511859.
Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227,680685.[CrossRef][Medline]
Lindberg RA and Hunter T (1990) cDNA cloning and characterization of eck, an epithelial cell receptor protein-tyrosine kinase in the eph/elk family of protein kinases. Mol Cell Biol 10,63166324.
Lindsay EA, Vitelli F, Su H, Morishima M, Huynh T, Pramparo T, Jurecic V, Ogunrinu G, Sutherland HF, Scambler PJ et al (2001) Tbx1 haploinsufficieny in the DiGeorge syndrome region causes aortic arch defects in mice. Nature 410,97101.[CrossRef][Medline]
Merscher S, Funke B, Epstein JA, Heyer J, Puech A, Lu MM, Xavier RJ, Demay MB, Russell RG, Factor S et al (2001) TBX1 is responsible for cardiovascular defects in velo-cardio-facial/DiGeorge syndrome. Cell 104,619629.[CrossRef][Web of Science][Medline]
Naaby-Hansen S, Flickinger CJ and Herr JC (1997) Two-dimensional gel electrophoretic analysis of vectorially labeled surface proteins of human spermatozoa. Biol Reprod 56,771787.[Abstract]
Nayak S, Galili N and Buck CA (1998) Immunohistochemical analysis of the expression of two serine-threonine kinases in the maturing mouse testis. Mech Dev 74,171174.[CrossRef][Web of Science][Medline]
Rosok O, Pedeutour F, Ree AH and Aasheim HC (1999) Identification and characterization of TESK2, a novel member of the LIMK/TESK family of protein kinases, predominantly expressed in testis. Genomics 61,4454.[CrossRef][Web of Science][Medline]
Sassone-Corsi P (1997) Transcriptional checkpoints determining the fate of male germ cells. Cell 88,163166.[CrossRef][Web of Science][Medline]
Shalom S and Don J (1999) Tlk, a novel evolutionarily conserved murine serine threonine kinase, encodes multiple testis transcripts. Mol Reprod Dev 52,392405.[CrossRef][Web of Science][Medline]
Sharpe RM (1994) Regulation of spermatogenesis. In Knobil E and Neill JD (eds) The Physiology of Reproduction, vol 1 Raven Press, New York, pp 13631434.
Silvennoinen O, Ihle JN, Schlessinger J and Levy DE (1993) Interferon-induced nuclear signalling by Jak protein tyrosine kinases. Nature 366,583585.[CrossRef][Medline]
Thompson JD, Higgins DG and Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22,46734680.
Toshima J, Koji T and Mizuno K (1998) Stage-specific expression of testis-specific protein kinase 1 (TESK1) in rat spermatogenic cells. Biochem Biophys Res Commun 249,107112.[CrossRef][Web of Science][Medline]
Toshima J, Tanaka T and Mizuno K (1999) Dual specificity protein kinase activity of testis-specific protein kinase 1 and its regulation by autophosphorylation of serine-215 within the activation loop. J Biol Chem 274,1217112176.
Tseng TC, Chen SH, Hsu YP and Tang TK (1998) Protein kinase profile of sperm and eggs: cloning and characterization of two novel testis-specific protein kinases (AIE1, AIE2) related to yeast and fly chromosome segregation regulators. DNA Cell Biol 17,823833.[Web of Science][Medline]
Visconti PE and Kopf GS (1998) Regulation of protein phosphorylation during sperm capacitation. Biol Reprod 59,16.
Visconti PE, Bailey JL, Moore GD, Pan D, Olds-Clarke P and Kopf GS (1995a) Capacitation of mouse spermatozoa I Correlation between the capacitation state and protein tyrosine phosphorylation. Development 121,11291137.[Abstract]
Visconti PE, Moore GD, Bailey JL, Leclerc P, Connors SA, Pan D, Olds-Clarke P and Kopf GS (1995b) Capacitation of mouse spermatozoa II Protein tyrosine phosphorylation and capacitation are regulated by a cAMP-dependent pathway. Development 121,11391150.[Abstract]
Visconti PE, Johnson LR, Oyaski M, Fornes M, Moss SB, Gerton GL and Kopf GS (1997) Regulation, localization and anchoring of protein kinase A subunits during mouse sperm capacitation. Dev Biol 192,351363.[CrossRef][Web of Science][Medline]
Visconti PE, Hao Z, Purdon MA, Stein P, Balsara BR, Testa JR, Herr JC, Moss SB and Kopf GS (2001) Cloning and chromosomal localization of a gene encoding a novel serine/threonine kinase belonging to the subfamily of testis-specific kinases. Genomics 77,163170.[CrossRef][Web of Science][Medline]
Visconti PE, Westbrook VA, Chertihin O, Demarco I, Sleight S and Diekman AB (2002) Novel signaling pathways involved in sperm acquisition of fertilizing capacity. J Reprod Immunol 53,133150.[CrossRef][Web of Science][Medline]
Walden PD and Cowan NJ (1993) A novel 205-kilodalton testis-specific serine/threonine protein kinase associated with microtubules of the spermatid manchette. Mol Cell Biol 13,76257635.
Watling D, Guschin D, Muller M, Silvennoinen O, Witthuhn BA, Quelle FW, Rogers NC, Schindler C, Stark GR, Ihle JN et al (1993) Complementation by the protein tyrosine kinase JAK2 of a mutant cell line defective in the interferon-gamma signal transduction pathway [see comments]. Nature 366,166170.[CrossRef][Medline]
Wolkowicz MJ, Shetty J, Westbrook A, Klotz K, Jayes F, Mandal A, Flickinger CJ, Herr JC (2003) Equatorial segment protein defines a discrete acrosomal subcompartment persisting throughout acrosomal biogenesis. Biol Reprod 69(3),735745.
Zuercher G, Rohrbach V, Andres AC and Ziemiecki A (2000) A novel member of the testis specific serine kinase family, tssk-3, expressed in the Leydig cells of sexually mature mice. Mech Dev 93,175177.[CrossRef][Web of Science][Medline]
Submitted on December 23, 2003; resubmitted on February 13, 2004; accepted on February 20, 2004.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
J. Sosnik, P. V. Miranda, N. A. Spiridonov, S.-Y. Yoon, R. A. Fissore, G. R. Johnson, and P. E. Visconti Tssk6 is required for Izumo relocalization and gamete fusion in the mouse J. Cell Sci., August 1, 2009; 122(15): 2741 - 2749. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Jones, P. S. James, D. Oxley, J. Coadwell, F. Suzuki-Toyota, and E. A. Howes The Equatorial Subsegment in Mammalian Spermatozoa Is Enriched in Tyrosine Phosphorylated Proteins Biol Reprod, September 1, 2008; 79(3): 421 - 431. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Su, W. Zhang, Y. Yang, Y. Deng, Y. Ma, H. Song, and S. Zhang Mutation Screening and Association Study of the TSSK4 Gene in Chinese Infertile Men With Impaired Spermatogenesis J Androl, July 1, 2008; 29(4): 374 - 378. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang, X. Shen, B. H Jones, B. Xu, J. C Herr, and J. F Strauss III Phosphorylation of Mouse Sperm Axoneme Central Apparatus Protein SPAG16L by a Testis-Specific Kinase, TSSK2 Biol Reprod, July 1, 2008; 79(1): 75 - 83. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.N. Jha, A.M. Salicioni, E. Arcelay, O. Chertihin, S. Kumari, J.C. Herr, and P.E. Visconti Evidence for the involvement of proline-directed serine/threonine phosphorylation in sperm capacitation Mol. Hum. Reprod., December 1, 2006; 12(12): 781 - 789. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Q. Diep, G. Peng, M. Bewley, V. Pilauri, I. Ropson, and J. E. Hopper Intragenic Suppression of Gal3C Interaction With Gal80 in the Saccharomyces cerevisiae GAL Gene Switch Genetics, January 1, 2006; 172(1): 77 - 87. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||












