Mol. Hum. Reprod. Advance Access originally published online on June 18, 2004
Molecular Human Reproduction 2004 10(8):559-565; doi:10.1093/molehr/gah079
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ADAMTS-1/METH-1 and TIMP-3 expression in the primate corpus luteum: divergent patterns and stage-dependent regulation during the natural menstrual cycle
1Division of Reproductive Sciences, Oregon National Primate Research Center, Oregon Health & Science University, 505 NW 185th Ave, Beaverton, Oregon 97006 and 2Department of Physiology and Pharmacology, Oregon Health & Science University, Portland, OR 97201, USA 3Current address: Department of Biological Sciences, California State University Long Beach, Long Beach, CA 90840, USA
4 To whom correspondence should be addressed. E-mail: stouffri@ohsu.edu
| Abstract |
|---|
|
|
|---|
Studies were designed to determine if ADAMTS-1 (a disintegrin and metalloproteinase with thrombospondin repeats-1) is expressed in the rhesus monkey corpus luteum (CL), is regulated by endocrine (LH) or local (progesterone) factors, and is correlated with tissue inhibitor of matrix metalloproteinase-3 (TIMP-3), an inhibitor of ADAMTS-1. PCR analyses indicated that ADAMTS-1 mRNA is expressed in luteinized granulosa cells during controlled ovarian stimulation cycles, and peaks in CL during the early luteal phase of the menstrual cycle, before decreasing (P<0.05) by the midlate stage. Immunostaining for ADAMTS-1 was detected in luteal cells, peaking in early CL. LH and/or steroid depletion at midlate luteal stage decreased (P<0.05) ADAMTS-1 mRNA levels compared to controls; LH but not progestin (R5020) replacement prevented this decrease. In contrast, LH and/or steroid ablationreplacement in the early CL did not affect ADAMTS-1 levels. TIMP-3 mRNA levels were lowest during the early CL and rose progressively (P<0.05), peaking in late CL. The divergent expression patterns during the CL lifespan suggest that an imbalance between ADAMTS-1 and TIMP-3 is important during luteal formation (ADAMTS-1 predominates) and regression (TIMP-3 predominates). Also, LH, perhaps via steroids other than progesterone, promotes ADAMTS-1 expression as a function of the stage of the CL.
Key words: ADAMTS-1/corpus luteum/ovary/primate/TIMP-3
| Introduction |
|---|
|
|
|---|
After follicular rupture, both the development (luteinization) and regression (luteolysis) of the corpus luteum (CL) require extensive tissue remodelling. A number of proteases are implicated in luteal remodelling in various species, including serine proteases (tPA, uPA) (Liu et al., 1997
ADAMTS-1 mRNA is expressed in ovaries of rats and cows during ovulation with its maximum transcription coinciding with follicle rupture (Espey et al., 2000
; Robker et al., 2000
; Madan et al., 2003
), and is involved with ovulatory events (Russell et al., 2003
). However, in bovine CL appreciable levels of ADAMTS-1 levels remain during the early luteal phase before levels decline by the mid luteal stage (Madan et al., 2003
). In immature rats, ADAMTS-1 mRNA expression declined 24 h post hCG administration, reaching baseline after 72 h post hCG exposure (Espey et al., 2003
). These data suggest that this protease contributes to the luteinization of the follicle and early luteal development, at least in species with long luteal phases. Further, transcription of ADAMTS-1 mRNA is regulated by LH either directly or indirectly via progesterone in the follicular granulosa cells of rats at the time of ovulation (Espey et al., 2000
; Robker et al., 2000
). In addition to endocrine regulation at the mRNA level, activity for this protease can also be regulated by tissue inhibitor of matrix metalloproteinase-3 (TIMP-3). TIMP-3 effectively suppresses ADAMTS-1 aggrecanase activity in rat chondrosarcoma-derived tissues (Rodriguez-Manzaneque et al., 2002
).
It is unknown whether ADAMTS-1 is expressed in the ovary and associated with CL development in other species, especially primates. Therefore we designed experiments to determine if ADAMTS-1 mRNA and protein is present in the primate CL throughout the menstrual cycle. In addition, to determine if ADAMTS-1 is regulated by gonadotrophins or ovarian steroids, notably progesterone, we examined ADAMTS-1 mRNA expression in CL collected from females following hormone ablation/replacement protocols. Finally, we tested the hypothesis that the ADAMTS-1 inhibitor TIMP-3 is present in the primate ovary and demonstrates an opposite expression pattern to that of ADAMTS-1.
| Materials and methods |
|---|
|
|
|---|
Animals
Care and housing of rhesus monkeys (Macaca mulatta) at the Oregon National Primate Research Center (ONPRC) was described previously (Wolf et al., 1990
Hormone assays
To evaluate the age and function of the CL of the natural cycle, and to verify the effectiveness of hormone ablation/replacement protocols, serum concentrations of estradiol and progesterone were determined by specific electrochemiluminescence assay using a Roche (USA) Elecsys 2010 analyzer by the Endocrine Services Laboratory, ONPRC, as previously described (Young and Stouffer, 2003
). Hormone concentrations during the hormone ablation/replacement protocols were reported previously (Young and Stouffer, 2003
).
CL collection during the natural menstrual cycle
The CL (n=34/ stage) was isolated from anaesthetized monkeys during aseptic ventral midline laparotomy surgery (as described previously by Duffy et al., 2000
). CL were collected during the early (luteal day 3), mid (days 7), midlate (days (10), late (days 14) and very late (day 18; mense) luteal phase (Figure 2). A portion of the CL was frozen in liquid nitrogen and stored at 80°C for isolation of total RNA using Trizol (BRL, USA) according to BRL's standard protocol (Chaffin and Stouffer, 1999
). A second portion of each CL was immersion-fixed for immunohistochemical analysis of ADAMTS-1 (METH-1) protein expression (Hazzard et al., 2000
).
|
Collection of luteinized granulosa cells
Luteinized granulosa cells were collected from additional adult female rhesus monkeys during controlled ovarian stimulation (COS) cycles for assisted reproductive technology procedures as previously described (Chaffin et al., 1999
CL collection following hormone ablation/replacement protocols
Hormone ablation/replacement protocols were performed in another cohort of adult rhesus monkeys during CL formation in the early luteal phase (day 24), or during the midlate luteal phase (day 911) of natural menstrual cycles (Young et al., 2002
). In each of these treatment periods, females were randomly assigned to one of five groups (n=4 per group): control (no treatment); Antide (a GnRH antagonist, 3 mg/kg, Serono; previously demonstrated to suppress circulating bio-LH levels and luteal function; Duffy et al., 1999b
); Antide + recombinant hLH (40 IU three times daily; SRBI; previously shown to maintain corpus luteum structure and function; Duffy et al., 1999b
); Antide + LH + Trilostane [TRL 600 mg, a 3ß-hydroxysteroid dehydrogenase inhibitor (Sanofi Research Division, USA) previously shown to inhibit steroid synthesis, Duffy et al., 1996
]; Antide + LH + TRL + R5020 (2.5 mg, a non-metabolizable progestin; Hibbert et al., 1996
). Serum estrogen and progesterone levels were analysed daily. On day 5 (developing CL group) or day 12 (developed CL group), the CL was removed via surgery as described above, and a portion was frozen in liquid nitrogen and stored at 80°C for isolation of total RNA.
RT reaction for PCR analysis
After RNA isolation from luteinizing granulosa cells and CL, RT was performed on 1 µg DNAse (Gibco BRL, USA)-treated RNA using Molony Murine Leukemia Virus reverse transcriptase (Gibco BRL) for 2 h at 37°C as described previously (Chaffin and Stouffer, 1999
). The cDNA products of this reaction were utilized to conduct RT and real-time PCR analysis for ADAMTS-1 and TIMP-3 mRNA expression.
RTPCR for ADAMTS-1 and TIMP-3
PCR was performed in a 25 µl volume using Clontech (USA) reagents. The PCR reaction was performed in a thermal cycler (MJ Research, USA) for an empirically determined number of cycles for denaturing at 94°C for 30 s, annealing at 56.4°C (ADAMTS-1; 32 cycles) and 54.4°C (TIMP-3; 28 cycles) for 1 min, and primer extension at 72°C for 1 min. Primers utilized were designed against the human ADAMTS-1 (METH-1) sequence: forward 5'3': GGAGACCGAAGACGAGGAC; reverse 5'3': TCACCACCACCAGGCTAAC. TIMP-3 primers were also designed against the human TIMP-3 sequence: forward 5'3' AGGCAGCAAGCAGATAGACT; reverse 5'3': GCAGGGAGAGGAAAGACATT. Cyclophilin primers were used to amplify controls in separate tubes, run in parallel with each sample. Aliquots of each PCR reaction (7 µl) were electrophoresed through a 1.4% agarose gel stained with 0.1 µg/ml ethidium bromide. Gels were visualized using Quantity One software (BioRad, USA) and analysed using densitometry. For the TIMP-3 semi-quantitative analysis, expression values were normalized to cyclophilin mRNA expression for each sample. For both ADAMTS-1 and TIMP-3, sequence analysis (Applied Biosystems, USA) was performed on the resulting PCR products by the Molecular and Cell Biology Laboratory, ONPRO to obtain the rhesus macaque sequence, and to compare to the human sequence.
Real-time PCR analysis of ADAMTS-1 mRNA
The rhesus sequence obtained for ADAMTS-1 was used to design TaqMan primer and probe sets for the more sensitive real-time assay (Primer Express software; PerkinElmer Applied Biosystems, USA), as described previously (Young et al., 2002
). ADAMTS-1 was selected for real-time methodology due to the fainter bands obtained for later stages of ADAMTS-1 mRNA levels using RTPCR. Real-time was not conducted in these initial studies on TIMP-3 expression, due to robust signal in the RTPCR reaction. Oligonucleotide primer sequences were synthesized by Gibco, and TaqMan probes were synthesized by PerkinElmer. The rhesus monkey-based primer sequences used for ADAMTS-1 analysis were: forward 5'-3': AGAAGCGATTTGTGTCCAGTCA; reverse 5'3': CACTGCCGTGGAATTTCTGC. The ADAMTS-1 TaqMan Probe used was 5'3': 6-FAM- GCCACAAGCATGGTTTCCACATAGCG. A matrix of varying primer concentrations was employed to determine optimal primer concentrations of assay components.
ADAMTS-1 expression was analysed using TaqMan PCR Core Reagent Kit with the ABI PRISM 7700 Sequence Detection System (PE Applied Biosystems, USA), as reported previously (Young et al., 2002
). To control for the amount of total RNA added to each RT reaction and to normalize the target signal, 18S ribosomal RNA was used as an active endogenous control in each well. Amplifications were conducted in a 10 µl final volume containing: 250 nmol/l TaqMan ADAMTS-1 probe (labelled with the 5' reporter dye FAM), 500 nmol/l ADAMTS-1 forward and reverse primers, 250 nmol/l TaqMan 18S probe (labeled with the 5' reporter dye VIC), 80 nmol/l forward and reverse 18S primers. The PCR reactions were conducted and analysed as described previously (Young et al., 2002
).
Immunohistochemistry
Portions of the CL were fixed in 10% neutral buffered formalin (Richard-Allen Scientific, USA) for 1 week. Tissue was then dehydrated in a series of ethanol solutions (50, 70 and 100%) and paraffin-embedded. For ADAMTS-1 immunohistochemistry, 6 µm sections were deparaffinized and hydrated through xylene and a graded series of ethanol, as reported previously (Hazzard et al., 2000
). Sections were incubated in phosphate-buffered saline (PBS) prior to pressure-cooker antigen retrieval in citrate buffer (Citra; BioGenex Laboratories, Inc., USA). Endogenous peroxidases were then quenched with a 10 min incubation in 3% H2O2. Sections were placed in a blocking buffer [1.5% normal horse serum (NHS) in PBS], then incubated with primary antibody in NHSPBS buffer for 1 h at room temperature and overnight at 4°C. Anti-human ADAMTS-1 (METH1 Ab-2; Oncogene, USA) antibody was diluted to 1:750. Primary antibody was detected using a biotinylated anti-rabbit IgG secondary antibody (1:1000; Vector Laboratories, USA) and the Vector ABC Elite Kit, visualized with Nickel-enhanced Sigma Fast diaminobenzidine substrate (Sigma, USA). A negative control lacking primary antibody was processed for each sample on adjacent tissue sections.
Statistical analysis
Statistical evaluation of mean differences among experimental groups was performed by analysis of variance with significance level set at P<0.05 using the Sigma Stat software package (SAS Institute Inc., USA). To isolate significant differences between groups, the StudentNewmanKeuls method was used for the pairwise multiple comparisons.
| Results |
|---|
|
|
|---|
RTPCR: ADAMTS-1 mRNA detection in the macaque ovary
An RTPCR product of expected size (Figure 1) for the ADAMTS-1 primers was obtained from both luteinized granulosa cells (LGC; aspirated during the peri-ovulatory interval) and luteal tissue. Sequence analysis (BLAST) confirmed a 98.8% similarity to human cDNA. Although the signal was most robust in LGC, ADAMTS-1 was detectable in luteal samples (Figure 1), and appeared to decline by the late stages (data not shown).
|
Real-time PCR: ADAMTS-1 mRNA levels in the CL throughout the natural luteal phase
When normalized to 18S ribosomal RNA, which does not change significantly in the CL during the luteal lifespan (Young et al., 2002
Immunohistochemistry forADAMTS-1 in the CL throughout the natural luteal phase
Immunohistochemical staining for ADAMTS-1 was evident in the cytoplasm of the presumptive granulosa-lutein cells; no staining was observed in stroma or endothelial cells in any of the samples (see Figure 3 insets for details). Although positively stained luteal cells were evident throughout the CL lifespan in the menstrual cycle, the staining appeared most prevalent (though not systematically quantified) in CL from the early luteal phase (Figure 3A). Staining appeared to become more heterogeneous between cells by mid and midlate luteal phase (Figure 3B, C), and fewer cells appeared to express detectable ADAMTS-1 protein by the late (Figure 3D) and very late (Figure 3E) luteal phase. No staining was evident in control sections processed without primary antibody (Figure 3F; ECL representative section shown).
|
Real-time PCR: ADAMTS-1 mRNA levels in CL following hormone ablation/replacement
Luteal ADAMTS-1 mRNA levels were detected in the developing (day 24 of the luteal phase) CL of hormone ablation/replacement-treated females; however, neither GnRH ablation (antide treatment) nor LH replacement resulted in significant differences in mRNA expression (Figure 4A; P>0.05). Similarly, TRL treatment and R5020 replacement did not alter ADAMTS-1 mRNA levels (Figure 4A; P>0.05).
|
In contrast, hormone ablation and replacement affected ADAMTS-1 levels in the developed (day 12) CL. Antide treatment decreased mRNA levels 2.5-fold as compared to day 12 control tissue (Figure 4B; P<0.01). However, LH replacement maintained ADAMTS-1 at control levels (Figure 4B). TRL treatment also reduced ADAMTS-1 expression as compared to control and LH replacement groups, but progestin replacement with R5020 did not maintain high ADAMTS-1 mRNA levels (Figure 4B, P>0.05).
RTPCR: TIMP-3 mRNA detection in the CL during the natural luteal phase
Initial evaluation of TIMP-3 mRNA in CL throughout the luteal phase via semi-quantitative RTPCR identified a cDNA product of expected size based on our primers with a homology (BLAST) of 96.0% to human TIMP-3 cDNA. TIMP-3 mRNA levels increased 3.5-fold from the early to the midlate stage (Figure 5; P<0.05). Levels of TIMP-3 mRNA in the late and very late stages remained elevated compared to the early luteal stage (P<0.05).
|
| Discussion |
|---|
|
|
|---|
The current study is the first to demonstrate ADAMTS-1 mRNA expression and protein detection in the primate ovary during natural and COS cycles. ADAMTS-1 mRNA is expressed in luteinizing granulosa cells (LGC) of pre-ovulatory follicles following the hCG bolus in COS cycles, and, notably, in luteal tissue throughout the lifespan of the corpus luteum in spontaneous cycles of adult rhesus monkeys. Data also suggest that ADAMTS-1 expression is positively regulated by LH in the developed CL via progesterone-independent pathways. Finally, the pattern of ADAMTS-1 mRNA expression was inversely related to expression of its endogenous inhibitor TIMP-3; the former peaking in the CL of the early luteal phase, with the latter peaking in the late luteal phase.
In the present study, ADAMTS-1 mRNA was detected in both LGC and CL tissue samples. Although in situ hybridization studies are needed to confirm the cellular sites of synthesis, our immunohistochemical results suggest that ADAMTS-1 protein is inside or on the membranes of granulosa-luteal cells. Unlike the original ADAM family members that contain transmembrane domains to anchor them to the cell membrane, ADAMTS-1 is secreted from cells where it diffuses into the extracellular matrix (ECM), and may bind to sulphated glycosaminoglycans such as heparin sulphate (Kuno and Matsushima, 1998
). Therefore, the non-nuclear staining for ADAMTS-1 in luteal cells may be intracellular stores to be secreted upon cell activation. Alternatively, the staining may be extracellular, primarily associated with ECM in close proximity to the luteal cells, but not with ECM of the microvasculature or adjacent stroma.
The highest levels of ADAMTS-1 mRNA were detected in both the developing CL as well as in the luteinizing granulosa cells of the ovulatory follicle. Protein levels for ADAMTS-1 also appeared to peak in CL during luteal formation. Our results are consistent with data from both rats and cattle, where ADAMTS-1 is expressed during the peri-ovulatory period and early luteal phase (Espey et al., 2000
; Madan et al., 2003
). It is possible that ADAMTS-1 is primarily involved with tissue remodelling associated with ovulatory events (e.g. Russell, 2003
) and is simply declining following the peri-ovulatory period. However, it is currently difficult to discern between ADAMTS-1 actions in the peri-ovulatory period that pertain to ovulation versus luteinization. Nevertheless, because ADAMTS-1 mRNA and protein levels remain appreciable in the CL during the early luteal phase, it is likely that this protease is also involved in the post-ovulatory remodelling associated with luteal development. Due to the complex nature of the ADAMTS-1 protein, it may have several functions associated with different regions of the active protein. It is possible that the disintegrin portion of ADAMTS-1 is critical for controlling cell adhesion during luteal development, whereas the metalloproteinase aspect of the protein is involved with breakdown of ECM components during ovulation and luteinization, or its associated angiogenesis (Nagase, 1997
). ADAMTS-1 may also play a critical role in the release of ECM-bound factors (e.g. growth factors) that would promote luteal development (Stamenkovic, 2003
). Finally, the thrombospondin motifs (either in the native protein or as metabolized, released thrombospondins) may act to control angiogenesis locally, perhaps by promoting the selective binding and sequestration of VEGF 165, but not VEGF 121 (Luque et al., 2003
).
The levels of ADAMTS-1 mRNA, as well as number of cells expressing immunodetectable ADAMTS-1 protein, appeared to decline during the luteal lifespan in the natural menstrual cycle. Interestingly, the pattern of ADAMTS-1 expression during the CL lifespan is similar to that of interstitial collagenase (MMP-1), with MMP-1 mRNA levels elevated in luteinized granulosa cells and in the CL of the early luteal phase, and then declining by mid and late luteal phase (Chaffin and Stouffer, 1999
; Young et al., 2002
). This pattern contrasts to that of the gelatinases, MMP-2 and MMP-9, which display low expression in the early luteal phase, and peak levels near the time of CL regression in rhesus monkeys (Young et al., 2002
). Although these patterns of mRNA levels have not been directly compared to protease activity, the data suggest that ADAMTS-1/MMP-1 protease action is important during the tissue remodelling of the early luteal phase (CL development), whereas the gelatinases predominate during the tissue remodelling in the late luteal phase (CL regression). Nevertheless, despite an apparent reduction in cells displaying immunohistochemical staining for ADAMTS-1 in the very-late CL, some cells remained immunopositive at this time. This residual level of ADAMTS-1 may permit its amplification in response to gonadotrophin (see below) for further tissue remodelling associated with enhanced luteal function by CG in early pregnancy (Duffy et al., 1996
).
An inverse relationship was observed between the declining levels of ADAMTS-1 mRNA and protein and the increase in TIMP-3 mRNA in the CL. These data suggest that the endogenous inhibitor TIMP-3 exerts greater control over ADAMTS-1 protease activity in the CL as the luteal lifespan advances. Lower levels of TIMP-3 may permit a significant amount of ADAMTS-1 activity during luteal formation. Despite the decline in ADAMTS-1 levels near the end of the luteal phase, both mRNA and protein were still evident, and remaining ADAMTS-1 activity may be inhibited via increasing amounts of TIMP-3. The inverse relationship of ADAMTS-1 and the TIMP-3 inhibitor is similar to the relationship between MMP-2/MMP-9 and the TIMP-1 inhibitor. Interestingly, however, the TIMP-1 inhibitor decreases near the end of the luteal phase, whereas the gelatinases increase (Young et al., 2002
). TIMP-2, a third endogenous inhibitor of metalloproteinases, shows no change in mRNA levels throughout the luteal phase (Young et al., 2002
), suggesting that the TIMP-1 have complementary but divergent roles in the regulation of CL remodelling in primates. There are likely species differences in protease expression including MMP/TIMP and ADAMTS in the CL, for example Espey et al. (2003)
report that in CL of immature rats primed with hCG, TIMP-1 expression mirrors the pattern of ADAMTS-1. In humans, TIMP-3 was not detected in CL tissue, and may not serve to regulate the CL during its lifespan (Duncan et al., 1998
). These apparent species differences may also extend to the function of these proteases/protease inhibitors in the CL, and deserve further study.
In addition to the potential regulation of ADAMTS-1 protease activity, alternative roles for TIMP-3 in the late luteal stages should be considered. Because TIMP-3 inhibits both other MMP's, as well as members of the ADAM family, such as TNF-
converting enzyme (TACE) (Amour et al., 1998
), this inhibitor may serve to inhibit a number of proteins in the CL in addition to ADAMTS-1. Importantly, the current study did not examine affinity of the TIMP-3 inhibitor for ADAMTS-1 in luteal tissue, an important consideration for future studies. TIMP-3 can promote apoptosis by preventing cells or ECM components from shedding death receptors and their ligands (Ahonen et al., 2003
). It is possible that increased TIMP-3 in the regressing CL influences programmed cell death of luteal tissue. Luteal TIMP-3 may also be important in controlling the angiogenesis or vessel integrity in the CL, as TIMP-3 can inhibit VEGF action via prevention of VEGF-binding to VEGF-R2 (Qi et al., 2003
).
The present study also provides initial evidence that the ADAMTS-1 system is positively regulated by LH, and perhaps ovarian steroids other than progesterone, in a stage-specific manner in the primate CL. To examine these questions, we used a reliable model of hormone ablation and replacement that effectively depletes and restores both gonadotrophins and ovarian steroids (e.g. Duffy et al., 2000
; Young and Stouffer, 2003
). In the early luteal phase no effect of hormonal ablation and replacement on ADAMTS-1 mRNA levels was observed; however, changes were observed later in the luteal phase. Stage-specific responses were previously reported in primate CL tissue, e.g. prostaglandin F2
exposure promotes progesterone production by primate luteal tissue from early to mid luteal phase but inhibits gonadotrophin-stimulated progesterone production in later stages of the luteal phase (Stouffer et al., 1979
; Khan-Dawood et al., 1989
). It is possible that ADAMTS-1 mRNA production is not sensitive to additional LH during the early luteal phase, but that sensitivity to gonadotrophin ablation/replacement develops over the lifespan of the CL for ADAMTS-1 production. Thus by midlate luteal phase, LH ablation using a GnRH antagonist reduced ADAMTS-1 mRNA expression and LH replacement restored mRNA levels to that of controls.
However, it remains unclear whether the action of LH to promote ADAMTS-1 expression is direct or indirect via LH-stimulated steroidogenesis. Notably, depletion of both gonadotrophins and steroids (with GnRH antagonist treatment), or steroids alone (with trilostane treatment) induced similar decreases in ADAMTS-1 mRNA, suggesting that steroid(s) are local modulators of the ADAMTS-1 system. However, progestin (R5020) replacement did not reverse the effect of trilostane on ADAMTS-1 expression. This suggests that steroids other than progesterone mediate LH-stimulated ADAMTS-1 expression. Both estrogen (ER) and androgen (AR) receptors have been identified in the primate CL, and ERß levels increase in midlate luteal phase (Duffy et al., 1999a
, 2000
). Changing steroid and/or steroid hormone receptor profiles could potentially change the sensitivity of ADAMTS-1 to LH regulation. Further studies are required to determine if estrogens and/or androgens play a role in regulating the ADAMTS-1 system in the primate CL.
Previous studies established that gonadotrophins (LH/CG) and steroids can regulate multiple proteases in the CL of the natural cycle and early pregnancy. For example, administration of an ovulatory bolus of hCG increases expression of MMP1,2, 7, 9 mRNA in primate peri-ovulatory follicles (Chaffin and Stouffer, 1999
). In the primate CL, both mRNA and protein levels of interstitial collagenase (MMP-1) are significantly decreased with LH treatment (Young and Stoufer, 2002
). In humans, luteal rescue with exogenous hCG treatment reduces both the expression and the activity of MMP-2 (Duncan et al., 1998
). LH stimulates MMP-1 and ADAMTS-1 expression in monkey (Chaffin and Stouffer, 1999
) and rat (Robker et al., 2000
) peri-ovulatory follicles respectively, through progesterone receptor-mediated actions. In contrast, LH acts to decrease MMP-1 expression in primate CL (Young and Stouffer, 2002
). In the current study, LH acts potentially via steroids other than progesterone to regulate ADAMTS-1 expression in the developed CL of primates.
In conclusion, as recently demonstrated for various MMP's (Young and Stouffer, 2003
), ADAMTS-1 mRNA levels are also regulated by both endocrine and local (steroid) factors in the primate CL in a stage-dependent manner. The ratio or imbalance between ADAMTS-1 and TIMP-3 may be important for regulation of CL formation. Further studies are warranted to examine the ADAMTS-1/TIMP-3 system during luteal formation and regression in primates as well as its relationship to the actions of other proteases.
| Acknowledgements |
|---|
We are grateful to both Serono Reproductive Biology Institute and Sanofi Research Division for providing research materials, along with the advice and expertise from members of the Stouffer, Hennebold, and Zelinski Laboratories (Marina Peluffo, Fuhua Xu, Ted Molskness, Yibing Jia, Carol Gibbins and Jessica Vance), and the staff of the Department of Animal Resources. This research was supported by NIH NICHD HD20869 (R.L.S.), through a cooperative agreement (U54-HD18185) as part of the Specialized Cooperative Centers Program in Reproduction Research, NCRR RR00163 (R.L.S.), The M.J.Murdock Charitable Trust (#2001279, B.T.), and NICHD NRSA HD042869 (K.A.Y.).
| References |
|---|
|
|
|---|
Ahonen M, Poukkula M, Baker Kashiwagi M, Nagase H, Eriksson JE and Kahari VM (2003) Tissue inhibitor of metalloproteinases-3 induces apoptosis in melanoma cells by stabilization of death receptors. Oncogene 22, 21212134.[CrossRef][Web of Science][Medline]
Amour A, Slocombe PM, Webster A, Butler M, Knight CG, Smith BJ, Stephens PE, Shelley C, Hutton M, Knauper V, Docherty AJ and Murphy G (1998) TNF-alpha converting enzyme (TACE) is inhibited by TIMP-3. FEBS Lett 435, 3944.[CrossRef][Web of Science][Medline]
Chaffin CL and Stouffer RL (1999) Expression of matrix metalloproteinases and their tissue inhibitor messenger ribonucleic acids in macaque periovulatory granulosa cells: time course and steroid regulation. Biol Reprod 61, 1421.
Chaffin CL, Hess DL and Stouffer RL (1999) Dynamics of periovulatory steroidogenesis in the rhesus monkey follicle after ovarian stimulation. Hum Reprod 14, 642649.
Duffy DM, Molskness TA and Stouffer RL (1996) Progesterone receptor messenger ribonucleic acid and protein in luteinized granulosa cells of rhesus monkeys are regulated in vitro by gonadotropins and steroids. Biol Reprod 54, 888895.[Abstract]
Duffy DM, Abdelgadir SE, Stott KR, Resko JA, Stouffer RL and Zelinski-Wooten MB (1999a) Androgen receptor mRNA expression in the rhesus monkey ovary. Endocrine 11, 2330.[CrossRef][Web of Science][Medline]
Duffy DM, Stewart DR and Stouffer RL (1999b) Titrating luteinizing hormone replacement to sustain the structure and function of the corpus luteum after gonadotropin-releasing hormone antagonist treatment in rhesus monkeys. J Clin Endocrinol Metab 84, 342349.
Duffy DM, Chaffin CL and Stouffer RL (2000) Expression of estrogen receptor alpha and beta in the rhesus monkey corpus luteum during the menstrual cycle: regulation by luteinizing hormone and progesterone. Endocrinology 141, 17111717.
Duncan WC, McNeilly AS and Illingworth PJ (1998) The effect of luteal "rescue" on the expression and localization of matrix metalloproteinases and their tissue inhibitors in the human corpus luteum. J Clin Endocrinol Metab 83, 24702478.
Espey LL, Yoshioka S, Russell DL, Robker RL, Fujii S and Richards JS (2000) Ovarian expression of a disintegrin and metalloproteinase with thombospondin motifs during ovulation in the gonadotropin-primed immature rat. Biol Reprod 62, 10901095.
Espey LL, Ujioka T, Okamura H and Richards JS (2003) Metallothionein-1 messenger RNA transcription in steroid-secreting cells of the rat ovary during the periovulatory period. Biol Reprod 68, 1895902. E-pub: Dec 2, 2002.
Hazzard TM, Christenson LK and Stouffer RL (2000) Changes in expression of vascular endothelial growth factor and angiopoietin-1 and -2 in the macaque corpus luteum during the menstrual cycle. Mol Hum Reprod 6, 993998.
Hibbert ML, Stouffer RL, Wolf DP and Zelinski-Wooten MB (1996) Midcycle administration of a progesterone synthesis inhibitor prevents ovulation in primates. Proc Natl Acad Sci USA 93, 1897901.
Khan-Dawood FS, Huang JC and Dawood MY (1989) Effect of human chorionic gonadotropin and prostaglandin F2a on progesterone production by human luteal cells. J Steroid Biochem 33, 941947.[CrossRef][Web of Science][Medline]
Kuno K and Matsushima K (1998) ADAMTS-1 protein anchors at the extracellular matrix through the thrombospondin type I motifs and its spacing region. J Biol Chem 273, 1391213917.
Kuno K, Kanada N, Nakashima E, Fujiki F, Ichimura F and Matsushima K (1997) Molecular cloning of a gene encoding a new type of metalloproteinase-disintegrin family protein with thrombospondin motifs as an inflammation associated gene. J Biol Chem 272, 556562.
Kuno K, Okada Y, Kawashima H, Nakamura H, Miyasaka M, Ohno H and Matsushima K (2000) Nakamura H, Miyasaka M, Ohno H Matsushima K ADAMTS-1 cleaves a cartilage proteoglycan, aggrecan. FEBS Lett 478, 241245.[CrossRef][Web of Science][Medline]
Liu K, Liu YX, Hu ZY, Zou RY, Chen YJ, Mu XM and Ny T (1997) Temporal expression of urokinase type plasminogen activator, tissue type plasminogen activator, plasminogen activator inhibitor type 1 in rhesus monkey corpus luteum during the luteal maintenance and regression. Mol Cell Endocrinol 133, 109116.[CrossRef][Web of Science][Medline]
Luque A, Carpizo DR and Iruela-Arispe ML (2003) ADAMTS1/METH1 inhibits endothelial cell proliferation by direct binding and sequestration of VEGF165. J Biol Chem 278, 2365623665. E-pub: Apr 24, 2003.
Madan P, Bridges PJ, Komar CM, Beristain AG, Rajamahendran R, Fortune JE and MacCalman CD (2003) Expression of messenger RNA for ADAMTS subtypes changes in the periovulatory follicle after the gonadotropin surge and during luteal development and regression in cattle. Biol Reprod 69, 150614. E-pub: July 9, 2003.
Martinez-Chequer JC, Stouffer RL, Hazzard TM, Patton PE and Molskness TA (2003) Insulin-like growth factors-1 and -2, but not hypoxia, synergize with gonadotropin hormone to promote vascular endothelial growth factor-A secretion by monkey granulosa cells from preovulatory follicles. Biol Reprod 68, 11121128. E-pub: Oct 30, 2002.
Nagase H (1997) Activation mechanisms of matrix metalloproteinases. Biol Chem 378, 151160.[Web of Science][Medline]
Qi JH, Ebrahem Q, Moore N, Murphy G, Claesson-Welsh L, Bond M, Baker A and Anand-Apte B (2003) A novel function for tissue inhibitor of metalloproteinases-3 (TIMP-3): inhibition of angiogenesis by blockage of VEGF binding to VEGF receptor-2. Nat Med 9, 407415. E-pub: Mar 24, 2003.[CrossRef][Web of Science][Medline]
Robker RL, Russell DL, Espey LL, Lydon JP, O'Malley BW and Richards JS (2000) Progesterone-regulated genes in the ovulation process: ADAMTS-1 and cathepsin L proteases. Proc Natl Acad Sci USA 97, 46894694.
Rodriguez-Manzaneque JC, Westling J, Thai SN et al (2002) ADAMTS-1 cleaves aggrecan at multiple sites and is differentially inhibited by metalloproteinase inhibitors. Biochem Biophys Res Commun 293, 501508.[CrossRef][Web of Science][Medline]
Russell DL, Doyle KM, Ochsner SA, Sandy JD and Richards JS (2003) Processing and localization of ADAMTS-1 and proteolytic cleavage of versican during cumulus matrix expansion and ovulation. J Biol Chem 278, 423309 E-pub: Aug 7 2003.
Shindo T, Kurihara H, Kuno K, Yokoyama H, Wada T, Kurihara Y, Imai T, Wang Y, Ogata M, Nishimatsu H et al (2000) ADAMTS-1: a metalloproteinase-disintegrin essential for normal growth, fertility, and organ morphology and function. J Clin Invest 105, 13451352.[Web of Science][Medline]
Stamenkovic I (2003) Extracellular matrix remodelling: the role of matrix metalloproteinases. J Pathol 200, 448464.[CrossRef][Web of Science][Medline]
Stouffer RL, Nixon WE and Hodgen GD (1979) Disparate effects of prostaglandins on basal and gonadotropin-stimulated progesterone production by luteal cells isolated from rhesus monkeys during the menstrual cycle and pregnancy. Biol Reprod 20, 897903.[Abstract]
Sun GW, Kobayashi H and Suzuki M (2002) Production of cartilage link protein by human granulosa-lutein cells. J Endocrinol 175, 505515.[Abstract]
Wolf DP, Thomson JA, Zelinski-Wooten MB and Stouffer RL (1990) In vitro fertilization-embro transfer in nonhuman primates: the technique and its applications. Mol Reprod Dev 27, 261280.[CrossRef][Web of Science][Medline]
Young KA, and Stouffer RL (2004) Gonadotropin and steroid regulation of matrix metalloproteinases and their endogenous tissue inhibitors in the developed corpus luteum of the rhesus monkey during the menstrual cycle. Biol Reprod 70: 244-252. E-pub: Sept 17, 2003.
Young KA, Hennebold JD and Stouffer RL (2002) Dynamic expression of mRNAs and proteins for matrix metalloproteinases and their tissue inhibitors in the primate corpus luteum during the menstrual cycle. Mol Hum Reprod 8, 833840.
Submitted on November 4, 2003; accepted on January 6, 2004.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
C. V. Bishop, J. D. Hennebold, and R. L. Stouffer The effects of luteinizing hormone ablation/replacement versus steroid ablation/replacement on gene expression in the primate corpus luteum Mol. Hum. Reprod., March 1, 2009; 15(3): 181 - 193. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Bogan, M. J. Murphy, R. L. Stouffer, and J. D. Hennebold Prostaglandin Synthesis, Metabolism, and Signaling Potential in the Rhesus Macaque Corpus Luteum throughout the Luteal Phase of the Menstrual Cycle Endocrinology, November 1, 2008; 149(11): 5861 - 5871. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Bogan, M. J. Murphy, R. L. Stouffer, and J. D. Hennebold Systematic Determination of Differential Gene Expression in the Primate Corpus Luteum during the Luteal Phase of the Menstrual Cycle Mol. Endocrinol., May 1, 2008; 22(5): 1260 - 1273. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Irusta, M.J. Murphy, W.D. Perez, and J.D. Hennebold Dynamic expression of epoxyeicosatrienoic acid synthesizing and metabolizing enzymes in the primate corpus luteum Mol. Hum. Reprod., August 1, 2007; 13(8): 541 - 548. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Russell and R. L. Robker Molecular mechanisms of ovulation: co-ordination through the cumulus complex Hum. Reprod. Update, May 1, 2007; 13(3): 289 - 312. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Peluffo, K. A. Young, and R. L. Stouffer Dynamic Expression of Caspase-2, -3, -8, and -9 Proteins and Enzyme Activity, But Not Messenger Ribonucleic Acid, in the Monkey Corpus Luteum during the Menstrual Cycle J. Clin. Endocrinol. Metab., April 1, 2005; 90(4): 2327 - 2335. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||









