Mol. Hum. Reprod. Advance Access originally published online on July 2, 2004
Molecular Human Reproduction 2004 10(9):629-639; doi:10.1093/molehr/gah089
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Identification of novel genes regulated by LH in the primate corpus luteum: insight into their regulation during the late luteal phase
1Department of Molecular Reproduction, Development and Genetics and 2Primate Research Laboratory, Indian Institute of Science, Bangalore, India
3 To whom correspondence should be addressed at: Department of Molecular Reproduction, Development and Genetics, Indian Institute of Science, Bangalore 560012, India. Email: rmm{at}mrdg.iisc.ernet.in
| Abstract |
|---|
|
|
|---|
The process of luteinization, during which granulosa cells are transformed into luteal cells, is accompanied by dramatic changes in the response of luteal cells to LH. Although luteal cells require LH-cAMP signalling cascade for survival, whether these cells respond to trophic factors through changes in gene expression remains poorly characterized. In an attempt to characterize gonadotrophin (LH)-regulated gene expression in the bonnet monkey corpus luteum (CL), changes in gene expression after GnRH antagonist treatment to inhibit LH secretion, different stages of CL and during hCG-simulated early pregnancy were examined using differential display RTPCR, Northern blot and semiquantitative RTPCR analyses. We have identified seven non-redundant cDNA's whose expression were regulated by LH. The results show that inhibition of LH secretion not only leads to down-regulation in the expression of genes, e.g. low density lipoprotein (LDL) receptor and Aldose reductase, but expression of some of the genes was up-regulated, e.g. Humanin, RNA helicase, Lyric protein, Acidic ribosomal phosphoprotein and KIAA1750. mRNA levels of the genes identified as up-regulated after LH inhibition were higher during late compared to the early and mid-luteal phase CL, but treatment with hCG down-regulated their expressions. We conclude that we have identified novel genes (known and unknown) that are up or down-regulated by LH, and the results suggest that LH-mediated activation and repression of expression of many genes is central to the regulation of the structure and function of the CL in the monkey.
Key words: corpus luteum/differential display/GnRH antagonist/mRNA expression/bonnet monkey
| Introduction |
|---|
|
|
|---|
The corpus luteum (CL), an endocrine structure formed from the ruptured ovulatory follicle, is necessary, by way of production of progesterone, for establishment and maintenance of pregnancy in mammals (Zeleznik and Benyo, 1994
LH and CG bind and activate the same G protein-coupled receptor on target cells to primarily stimulate the adenylate cyclasecAMPprotein kinase A (PKA) pathway (Vandevoort et al., 1988
; Richards, 2001
). At the nuclear level, the cAMP pathway regulates transcription mainly by PKA-dependent phosphorylation of the cAMP response element binding protein (CREB) family of transcription factors (CREB, ATF1, CREM etc.; Richards, 2001
). In primates, intriguingly CREB has been reported to be extinct after ovulation and thus nuclear actions of LH appear to be compromised in the CL (Somers et al., 1995
). Recent studies, however, seem to suggest that expression of some of the genes is altered by changes in the circulating gonadotrophin concentrations during luteolysis, e.g. Bax, Steroidogenic Acute Regulatory protein (StAR) and during simulated early pregnancy, e.g. StAR and low density lipoprotein receptor (LDLr) (Benyo et al., 1993
; Sugino et al., 2000
; Kohen et al., 2003
). The results of these reports indicate that even though there is apparent disruption in the cAMPPKACREB signalling pathway, the CL seems to respond to LH/CG by way of changes in transcription. Alternatively, LH and CG may mediate their actions by PKA-independent pathways such as through the Mitogen Activated Protein (MAP) kinase pathway (Srisuparp et al., 2003
). Recently, however, we have observed expression of CREB in the monkey CL (Medhamurthy and Gupta, 2004
). In light of the above observations, we hypothesize that at least some nuclear actions of LH may after all be intact in the primate luteal cells and that changes in the expression of genes occurs in response to varying levels of circulating LH/CG.
The objective of this study was to identify genes that are differentially expressed in CL collected from monkeys treated with GnRH antagonist to inhibit pituitary LH secretion. After identifying the differentially expressed genes, their expression under different gonadotrophin milieu was confirmed by Northern blot and semiquantitative RTPCR analyses. The identification and characterization of gene expression patterns occurring at different stages of CL development and function will contribute to a better understanding of the molecular determinants of CL rescue and regression.
| Materials and methods |
|---|
|
|
|---|
Reagents
GnRH antagonist (Cetrorelix®; CET) was a kind gift from Asta Medica (Germany). Human CG (hCG) was from Ares Serono (Switzerland). Avian Myeloblastoma Virus (AMV) RT, Taq DNA Polymerase, random hexamers, RNAsin, Wizard Plasmid Mini-preparation purification kit, pGEMT easy cloning kit, dNTP, RNA markers and 100 bp DNA ladder were from Promega (USA). Oligonucleotide primers were synthesized by SigmaGenosys (UK). Restriction enzymes were obtained from MBI Fermentas (Germany). For random primer labelling, the Random Primer Extension Labelling System, [
32P]dCTP and [
32P]dATP were procured from Perkin Elmer Life Sciences Inc. (USA). Platinum Taq, Agarose and Trizol reagent were obtained from Invitrogen, Life Technologies (USA). All other reagents were purchased from Sigma Chemical Co. (USA), Invitrogen, Life Technologies (USA) or sourced locally.
Animal protocols and CL collections
Experimental protocols involving monkeys in this study were approved by the Institutional Animal Ethics Committee of the Indian Institute of Science. Care and management of monkeys were followed as per the guidelines outlined by the Indian National Science Academy, New Delhi for welfare of laboratory animals. Adult female bonnet monkeys (Macaca radiata) weighing 34.6 kg with a history of regular menstrual cyclicity (2729 days) were utilized for the study. The general care and housing of monkeys at the Primate Research Laboratory, Indian Institute of Science, Bangalore have been described elsewhere (Srinath, 1979
). Monkeys were monitored daily for menses, and blood samples (
1.5 ml) through femoral venipunctures were collected daily from day 8 following the onset of menses until day 12 for determining estradiol (E2) and LH surges. Further blood samples were collected either daily or at more frequent intervals until the day of CL retrieval. In this study, 1 day post LH surge was designated as day 1 of the luteal phase.
Corpus luteum on a designated day of the luteal phase (see below) was retrieved after accessing the ovary by performing laparotomy on ketamine hydrochloride (15 mg/kg body weight) anaesthetized female monkeys under aseptic conditions. The excised CL was transferred to a sterile Petri dish containing filter paper, cut into four quarters, placed in individual sterile cryovials and snap-frozen in liquid nitrogen before storing at 70°C.
Experiment I: Temporal changes in gene expression during GnRH antagonist-induced luteolysis
It is well established that administration of GnRH antagonist into monkeys during mid-luteal phase leads to suppression of LH secretion and abrupt termination of the luteal phase (Ravindranath et al., 1992
; Duffy et al., 1999
; Fraser et al., 1999
). In the present study, Cetrorelix, a synthetic GnRH antagonist, was administered s.c., at a dose of 75 µg/kg body weight twice daily (09:00 and 21:00) on day 7 of the luteal phase of the menstrual cycle. This dose of Cetrorelix was chosen based on a pilot study in the bonnet monkey which indicated that Cetrorelix at a dose of 75 µg/kg body weight administered s.c., twice daily for 3 consecutive days, resulted in decreased circulating serum progesterone concentrations within 12 h after treatment and initiation of menstruation on day 3 or 4 after start of treatment. Twice daily administration of Cetrorelix was chosen since the half-life was reported to be 10 h (Duijkers et al., 1998
). The GnRH antagonist was administered on day 7 of the luteal phase and CL (n=3/time point) collected before, 12, 24 and 48 h after treatment. For differential display RTPCR analysis, CL (n=3/time point) collected from monkeys on day 9 of the luteal phase and from monkeys treated with Cetrorelix for 48 h served as control and treatment respectively.
Experiment II: Gene expression changes during various stages of CL development and function
During different stages of CL development, the pattern of expression of differentially expressed genes was examined by Northern blot and semiquantitative RTPCR analyses. Corpora lutea (n=3/stage) were collected from monkeys experiencing spontaneous menstrual cycles at the early (day 5), mid- (days 89) and late (days 1415) luteal phase of the menstrual cycle.
Experiment III: Gene expression changes during simulated early pregnancy
In order to determine the gene expression changes during rescue of the CL following conception and establishment of pregnancy, we have utilized a model system that involves simulation of early pregnancy in non-mated cycling bonnet monkeys. Studies carried out in rhesus (Ottobre and Stouffer, 1984
) and bonnet (Benyo et al., 1992
) monkeys have demonstrated that administration of hCG in increasing doses beginning day 9 of the luteal phase of the non-mated cycles mimics the circulating pattern of monkey CG, steroid profile and the expression profile of key steroidogenic enzymes in CL observed during early pregnancy. In the present study, in addition to administration of hCG (day 913 of the luteal phase, see below) in incremental doses to mimic early pregnancy, another group of monkeys was treated with hCG beginning in the early luteal phase similar to the protocol reported by Ottobre and Stouffer (1984)
, as that treatment regimen results in persistent rather than transient stimulation of luteal progesterone production, to examine whether the gene expression would be different from that observed during the simulated early pregnancy model system. Monkeys (n=3) were administered increasing doses of hCG during days 513 (15, 30, 45, 90, 180, 360, 720, 1440 and 2880 IU) or days 913 (15, 30, 45, 90 and 180 IU) of the luteal phase i.m. twice daily (09:00 and 17:00), and CL collected on day 14 of the luteal phase from both the groups of monkeys. For comparison, CL collected on day 14 of the luteal phase, but without treatment (n=3), was utilized as the untreated control.
RNA extraction
Total RNA was extracted from CL tissue using Trizol reagent according to the manufacturer's recommendations. The quality and quantity of each RNA sample was assessed spectrophotometrically as well as on a 1% formaldehyde agarose gel.
Differential mRNA display
Differential display RTPCR was performed by a variation of the method of Liang et al. (Liang and Pardee, 1992
; Liang et al., 1993
). Arbitrary (AP1AP6) and anchored primers (MA, MG, MC and MT) designed for this study are listed in Table I. Total RNA of CL collected from individual monkeys from the control or treatment group were pooled within each group and analysed at least twice for differential expression. Pooled total RNA (200 ng) was reverse-transcribed using 2 µmol/l of anchored primer (HT11VM, where H: CGGAATTC; V is a variable nucleotide; and M is A, G, C or T), 250 µmol/l of dNTP, and 10 IU AMV RT in a 20 µl reaction volume with the following parameters: 37°C for 60 min, 75°C for 5 min. PCR with the same anchored primer and an arbitrary primer (e.g. AP2 primer: CGTGAATTCGGACCGCTTGT) was carried out using 2 µl of the RT reaction in 1.5 mmol/l MgCl2, 2 µmol/l HT11VM primer (MA/MG/MC/MT), 2 µmol/l arbitrary primer (AP1/AP2), 25 µmol/l dNTP, and 2 µCi [
32P]dATP and 1 IU Taq polymerase in a 20 µl reaction volume. The following PCR program was run in a Peltier Thermal Cycler PTC-200 MiniCyclerTM (MJ Research, USA): 94°C for 30 s, 40°C for 2 min, 72°C for 30 s for 40 cycles followed by 72°C for 5 min. Aliquots of PCR mixture were run on a 6% sequencing gel and amplicons were visualized by autoradiography. Different combinations of anchored and arbitrary primers were used initially in separate reactions to generate differential display from which fragments could be isolated. The primer combinations that resulted in consistent expression patterns on the differential display autoradiograms were subsequently repeated for reproducibility and those that were reproducible were chosen for further analysis. The details of the primer combinations used for isolation of differentially amplified products are provided in Table II. Differentially amplified products were recovered by aligning the gel with the film, excising the gel containing the amplicons and soaking the excised gel with Whatman No. 3 paper in 100 µl H2O for 10 min followed by boiling for 10 min. The supernatant was collected and precipitated by the addition of 10 µl of 3 mol/l sodium acetate pH 5.2, 1 µl of yeast tRNA and 450 µl of 100% ethanol at 70°C and DNA was dissolved in 10 µl of H2O. Four microlitres of the resuspended cDNA was used to reamplify products with 1.5 mmol/l MgCl2, 250 µmol/l dNTP, 2 µmol/l HT11VM primer, 2 µmol/l arbitrary primer, and 5 IU Taq polymerase in a 40 µl reaction volume using the same PCR program as above.
|
|
cDNA cloning and sequencing
Re-amplified cDNA fragments eluted from the gel were cloned into pGEMT vector using TA cloning system according to the manufacturer's instructions. The clones were confirmed by EcoRI digestion and release of the identical size product from the vector as observed before cloning. Using SP6/T7 primer, all clones were sequenced by Macrogen Inc. (Korea). The nucleotide sequences obtained were compared with GenBank databases using computer searches and sequence alignments at http://www.ncbi.nlm.nih.gov and http://searchlauncher.bcm.tmc.edu
Probe preparation and Northern blot analysis
One nanogram of each cloned PCR product was amplified using the specific anchored and arbitrary primers under the same PCR conditions employed for differential display, but with an additional step of denaturation for 5 min at 95°C in the start. All the PCR products were purified using the PCR prep purification kit. Purified PCR products were labelled with [
32P]dCTP using random primer labelling kit. Northern blot analysis was carried out essentially as described previously (Yadav et al., 2002
).
Semiquantitative RTPCR analysis
Semiquantitative RTPCR was carried out essentially as described previously (Uma et al., 2003
). Oligonucleotide primers were designed for the identified non-redundant cDNA fragments from the published partial cDNA sequences, cloned and sequenced by us in the present study (see Table II for Accession numbers). Primers and PCR conditions (annealing temperature and PCR cycle number) used were as follows: 5'-CAGCCGGTGTAAATGTTG-3' and 5'-CATGTCATCATCAGACTCCTC-3' for 224 bp Ribosomal Protein Large P1 (54°C and 26 cycles); 5'-GTAGTGGGTTATTGTCTCTG-3' and 5'-GAAGCCACTCATACATACA-3' for 120 bp LDLr (44°C and 28 cycles); 5'-GTGATGAGGAGATGGCAAC-3' and 5'-CGAAGTTCACTGTGATCTCAG-3' for 220 bp Aldose reductase (54°C and 26 cycles); 5'-CATCACCTCTAGCATTACCA-3' and 5'-ACGGACAGGTCAATTTCA-3' for 185 bp Humanin (54°C and 25 cycles); 5'-GACAGAGGTTACTCTAGCCT-3' and 5'-CTGCTGCACTGCAGTC-3' for 421 bp RNA helicase (54°C and 30 cycles); 5'-CATTGGGTCTACTGCTGA-3' and 5'-CATCAGGAATTGGTTCC-3' for 221 bp Lyric protein (54°C and 28 cycles); 5'-TCACGGAGGATAAGATCAATGC-3' and 5'-CAGCTGGAGCAGCAGCAG-3' for 201 bp Acidic ribosomal phosphoprotein (58°C and 35 cycles); 5'-GCATTGTTACCAGCTTGTACTGG-3' and 5'-CCACGCATGCAAACTTACAAC-3' for 201 bp KIAA1750 (54°C and 30 cycles). To rule out the possibility of genomic DNA contamination and template contamination (from the reagents), RTPCR was carried out on samples with the exclusion of reverse transcriptase and cDNA template respectively (data not shown). Ethidium bromide-stained agarose gels displaying PCR products were scanned using UVI-Tech gel documentation system and quantified using UVI-Band Map software (1999).
Hormone assays
Estradiol (E2), progesterone and LH concentrations in serum were determined by specific radioimmunoassays as reported previously (Selvaraj et al., 1996
). The E2 (GDN #244) and progesterone (GDN #337) antisera were kindly provided by Professor G.D.Niswender, University of Colorado, Fort Collins, Colorado, USA. Blood samples collected from hCG-treated monkeys were assayed for LH/hCG bioactivity using mouse Leydig cell bioassay as reported previously (Van Damme et al., 1974
).
Statistical analysis
Wherever applicable, data were expressed as mean±SEM. The data (hormone values and relative levels of mRNA) were analysed by one-way ANOVA, followed by the NewmanKeuls multiple comparison test (PRISM Graph Pad, version 2; Graph Pad Software, Inc., USA). P<0.05 was considered statistically significant.
| Results |
|---|
|
|
|---|
Differential display of products amplified from CL collected from control and GnRH antagonist-treated monkeys
In order to examine regulation of gene expression by LH in the CL, we performed two independent rounds of differential display RTPCR on pooled total RNA isolated from CL of control and Cetrorelix-treated (48 h) monkeys (mean±SEM progesterone concentrations in control and treatment monkeys were 4.77±0.57 and 0.45±0.24 ng/ml respectively). From the electrophoretic analysis of the amplified products on DNA sequencing gels, 13 differentially amplified products plus a single product not differentially regulated (to serve as an internal control for Northern blot and semiquantitative RTPCR analyses) were identified (Figure 1A). All 14 bands were excised (Figure 1B), PCR-amplified and electrophoresed (Figure 1C). Sequence comparison of the 14 amplified products revealed nine non-redundant and five redundant cDNA. As differential display technique often results in false positives, total RNA extracted from CL of control and Cetrorelix-treated monkeys as well as CL collected from different experimental conditions were further subjected to Northern blot analysis in order to assess number of transcripts and transcript-specific changes in the mRNA expression of genes identified to be differentially expressed in RTPCR. Additionally, semiquantitative RTPCR analysis was performed to quantitatively determine changes in steady state mRNA levels of the differentially expressed genes in CL collected during different experimental conditions. Northern blot analysis confirmed the regulation in the mRNA expression of seven fragments (D1/2/4, D3, 5/9/11, 6, 8/12, 13 and 14) and revealed presence of multiple transcripts for some of the genes. One fragment (D10) was determined to be a false positive as mRNA expression levels between control and treatment were not different (data not shown). The differentially expressed genes identified were observed to be either up-regulated (D3, 6, 8/12, 13 and 14) or down-regulated (D1/2/4, 5/9/11) following inhibition of pituitary LH secretion. Nucleotide sequences of all seven differentially regulated non-redundant sequences and D7 (Ribosomal Protein Large P1; used as an internal control for Northern blot and semiquantitative RTPCR analyses) have been deposited with GenBank and the details of each fragment are provided in Table II.
|
Changes in serum LH and progesterone during Cetrorelix treatment, different stages of CL development and simulated early pregnancy
Circulating serum LH (or bioactive LH equivalents) and progesterone concentrations determined during Cetrorelix treatment, different stages of CL (early, mid- and late luteal phase) and after hCG treatment are represented in Figure 2. Circulating serum LH and progesterone levels decreased significantly (P<0.05) after Cetrorelix treatment within 12 h and remained low throughout the treatment period (Figure 2A). Although circulating serum progesterone levels were higher (P<0.05) during the mid-luteal phase compared to other stages of the luteal phase, LH levels did not vary at different stages of the luteal phase (Figure 2B). On day 14 of the luteal phase, bioactive LH equivalents measured by mouse Leydig cell bioassay were low in serum samples collected from control monkeys, but significantly higher (P<0.05) in samples of hCG-treated monkeys (Figure 2C). Mean (±SEM) serum progesterone concentrations on day 14 of the luteal phase were low (1.07±0.23 ng/ml), but increased significantly (P<0.05) in serum samples collected from hCG-treated monkeys (5.9±0.6 and 11.75±1.75 ng/ml following hCG treatment during days 513 and 913 of the luteal phase respectively; Figure 2C).
|
Temporal changes in the expression of genes identified as LH responsive by differential display
Following identification of genes responsive to inhibition of pituitary LH secretion, their temporal pattern of expression at different times after GnRH antagonist treatment, during different stages of CL development and during simulated early pregnancy were examined by Northern blot and semiquantitative RTPCR analyses. The expression of DDRTPCR fragment D7 (RPLP1), which did not change under different experimental conditions (data not shown), was utilized as internal control for both the Northern blot and semiquantitative RTPCR analyses. The expression pattern of two genes (LDLr and Aldose reductase) identified as down-regulated following inhibition of LH secretion, are presented in Figures 3 and 4. As seen in Figure 3A, LDLr gene expression revealed the presence of three transcripts (5.3, 3.7 and 2 kb) and expression of all three transcripts decreased after antagonist treatment. Semiquantitative RTPCR results indicated that mRNA expression was significantly (P<0.05) lower at 12 h after Cetrorelix treatment and remained low throughout the period of observation (Figure 3B and C). Expression of LDLr was high (P<0.05) in mid-stage and low in late stage CL (Figure 3A), whereas the CL of hCG-treated monkeys had higher (P<0.05) expression compared to CL from untreated monkeys (Figure 3A). Northern blot analysis of Aldose reductase expression revealed the presence of a single transcript whose expression was significantly (P<0.05) lower at 48 h after Cetrorelix treatment (Figure 4A). mRNA levels of aldose reductase were significantly higher (P<0.05) during mid- and late stage CL compared to the early stage and the expression was also higher (P<0.05) in CL retrieved from monkeys receiving 913 days of hCG treatment (Figure 4A). Next, we examined the expression pattern of five genes (Humanin, RNA helicase, Lyric protein, Acidic ribosomal phosphoprotein and KIAA1750) identified as up-regulated following inhibition of LH secretion (Figures 59). Humanin gene expression revealed the presence of three transcripts (1.6, 1.2 and 1.0 kb; Figure 5A) and semiquantitative RTPCR data indicated that mRNA expression was significantly (P<0.05) high at all time points after Cetrorelix treatment (Figure 5B and C). mRNA levels of Humanin increased progressively in mid- and late stage CL, but the expression was lower after hCG treatment (Figure 5A). RNA helicase gene expression revealed the presence of two transcripts (4.2 and 2.4 kb) and the expression of larger transcript increased after Cetrorelix treatment (Figure 6A) which was further confirmed by semiquantitative RTPCR data (Figure 6B and C). The expression of RNA helicase progressively increased (P<0.05) from mid- to late stage CL, but decreased (P<0.05) significantly after hCG treatment (Figure 6A). Northern blot analysis of Lyric protein expression showed the presence of two transcripts (4.7 and 3.4 kb) and semiquantitative RTPCR data indicated >2-fold increase in expression at 48 h after Cetrorelix treatment compared to the control (P<0.05, Figure 7A). The expression of Lyric protein was significantly higher (P<0.05) in mid- compared to early and late stage CL, whereas the expression was lower (P<0.05) in CL retrieved from monkeys receiving 913 days of hCG treatment (Figure 7A). A single transcript (0.65 kb) was observed for Acidic ribosomal phosphoprotein gene (Figure 8A) and the expression was >3-fold higher (P<0.05) 2448 h after Cetrorelix treatment (Figure 8B and C). The expression progressively increased from mid- to late stage CL, but decreased (P<0.05) after hCG treatment (Figure 8A). The expression of KIAA1750 was higher 1224 h after Cetrorelix treatment to reach >2-fold expression at 48 h (Figure 9A). The expression of KIAA1750 was higher in the mid- and late luteal stage, but became lower after hCG treatment (Figure 9A).
|
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
Although circulating LH is essential for function and survival of the primate CL during the menstrual cycle, its ability to sustain CL function appears to decline during the late luteal phase resulting in the regression of the CL (Ottobre and Stouffer, 1984
Genes whose expressions were identified as up-regulated in response to inhibition of pituitary LH secretion in the monkey CL included translation machinery proteins (RNA helicase and Acidic ribosomal phosphoprotein), apoptosis regulating protein (Humanin), cellcell interaction protein (Lyric protein) and a protein with predicted function for nucleotide binding (KIAA1750). Recently, Tang et al. (1999)
reported characterization of a testis-specific RNA helicase also referred to as Gonadotrophin-regulated testis helicase that was observed to be up-regulated following desensitization of Leydig cells to a large bolus of hCG injection. RNA helicase has not been characterized in the ovary. Our results are the first to describe the expression of this gene in the ovary. In the monkey CL, although the expression was low during the mid-luteal phase, two transcripts that corresponded to the reported transcript sizes of testis-specific RNA helicase were observed (Endoh et al., 1999
). In the present study, the observation that GnRH antagonist treatment resulted in a significant up-regulation of RNA helicase suggests that, as observed in the testis, a similar gonadotrophin-regulated RNA helicase expression appears to be present in the ovary.
It has recently been reported that Humanin functions as an anti-apoptotic factor in neuronal cells/tissue (Tajima et al., 2002
) and it has been suggested that it could be used as a potential anti-apoptotic drug for treatment of Alzheimer's disease (Maximov et al., 2002
). In the present study, Humanin expression was increased during the late luteal phase and after GnRH antagonist treatment; in both conditions the process of luteolysis would be present, but the expression was decreased during simulated early pregnancy, a condition analogous to rescue of CL seen during early pregnancy. The results of Humanin expression in the present study appear to suggest a different function in the CL, a non-neuronal tissue, than reported in the literature. However, in accordance with the findings of a previous report (Tajima et al., 2002
), Humanin may play an important role in the survival/demise of the CL. Lyric protein is a novel protein and has been predicted to be associated with cellcell adhesion molecules. An up-regulation of expression that occurs at the time of expected luteolysis leads us to speculate that it may be important for clearance of the luteal cells and replacement by the connective tissue during the process of luteolysis. Acidic ribosomal phosphoprotein identified in the present study may represent any of the three phosphoproteins P0, P1 and P2 that have previously been shown to be associated with the ribosomal machinery and all the three phosphoproteins have been reported to contain identical C-terminal tails. As differential display analysis represents the 3' end of mRNA, it is not possible to know which form of protein was identified in the present study, and therefore the full length of the gene needs to be cloned to identify the fragment observed here. All three phosphoproteins, components of 60S ribosomal subunit, play important roles in the elongation step of protein synthesis (Rich and Steitz, 1987
; Krowczynska et al., 1989
), and observations in the present study point to their role in the regulation of translation machinery in the CL. The function of KIAA1750 is not clear and so far it has been electronically annotated as nucleotide binding protein (Human KIAA1750 protein accession number: NM_033512).
Based on the findings in the present study, we propose a general working model for gonadotrophin-dependent gene regulation in the primate CL. During the early to mid-luteal phase, the LH-mediated regulation of gene expression involves both suppression and activation of LH-dependent genes that lead to maintenance of CL function. But as the luteal phase progresses, those genes whose expression is promoted by the circulating LH levels decrease and those genes whose expression is suppressed by LH increase in their expression, resulting in luteolysis. However, in the event of establishment of pregnancy the decreased gene responsiveness to LH observed during the late luteal phase is overcome by the higher concentrations of CG, such that the function of the CL is sustained until lutealplacental shift in progesterone secretion occurs. More recently, researchers at the Oregon National Primate Research Center using GnRH antagonist to inhibit LH secretion reported identification of several novel genes in the monkey CL employing DNA microarray analysis approach (Xu et al., 2003
; Young et al., 2003
) consistent with the findings in the present study that LH regulates gene expression in the primate CL.
| Acknowledgements |
|---|
We are grateful to Dr S.G.Ramachandra of the Primate Research Laboratory for help with surgery and to Mr C.K.Aravind for his technical help with DDRTPCR. Dr A.F.Parlow kindly supplied the monkey LH radioimmunoassay kit. This work was supported financially by the Department of Biotechnology, the Indian Council of Medical Research and infrastructure grant support by the University Grants Commission. Mr Vijay Kumar Yadav is supported by Senior Research Fellowship from the CSIR.
| References |
|---|
|
|
|---|
Benyo DF, Little-Ihrig L, Selvaraj N, Medhamurthy R, Moudgal NR and Zeleznik AJ (1992) Cellular Events associated with the rescue of the primate corpus luteum. In Program of the 25th annual meeting of the Society for the Study of Reproduction. Raleigh, North Carolina, Abstract 299.
Benyo DF, Little-Ihrig L and Zeleznik AJ (1993) Noncoordinated expression of luteal cell messenger ribonucleic acids during human chorionic gonadotropin stimulation of the primate corpus luteum. Endocrinology 133, 699704.
Brown MS and Goldstein JL (1986) A receptor-mediated pathway for cholesterol homeostasis. Science 232, 3447.
Cao D, Fan ST and Chung SS (1998) Identification and characterization of a novel human aldose reductase-like gene. J Biol Chem 273, 1142911435.
Duffy DM, Stewart DR and Stouffer RL (1999) Titrating luteinizing hormone replacement to sustain the structure and function of the corpus luteum after gonadotropin-releasing hormone antagonist treatment in rhesus monkeys. J Clin Endocrinol Metab 84, 342349.
Duijkers IJ, Klipping C, Willemsen WN, Krone D, Schneider E, Niebch G and Hermann R (1998) Single and multiple dose pharmacokinetics and pharmacodynamics of the gonadotrophin-releasing hormone antagonist Cetrorelix in healthy female volunteers. Hum Reprod 13, 23922398.
Endoh H, Maruyama K, Masuhiro Y, Kobayashi Y, Goto M, Tai H, Yanagisawa J, Metzger D, Hashimoto S and Kato S (1999) Purification and identification of p68 RNA helicase acting as a transcriptional coactivator specific for the activation function 1 of human estrogen receptor alpha. Mol Cell Biol 19, 53635372.
Fraser HM, Lunn SF, Harrison DJ and Kerr JB (1999) Luteal regression in the primate: different forms of cell death during natural and gonadotropin-releasing hormone antagonist or prostaglandin analogue-induced luteolysis. Biol Reprod 61, 14681479.
Jez JM, Flynn TG and Penning TM (1997) A new nomenclature for the aldo-keto reductase superfamily. Biochem Pharmacol 54, 639647.[CrossRef][Web of Science][Medline]
Kohen P, Castro O, Palomino A, Munoz A, Christenson LK, Sierralta W, Carvallo P, Strauss JF 3rd and Devoto L (2003) The steroidogenic response and corpus luteum expression of the steroidogenic acute regulatory protein after human chorionic gonadotropin administration at different times in the human luteal phase. J Clin Endocrinol Metab 88, 34213430.
Krowczynska AM, Coutts M, Makrides S and Brawerman G (1989) The mouse homologue of the human Acidic ribosomal phosphoprotein PO: a highly conserved polypeptide that is under translational control. Nucleic Acids Res 17, 6408.
Liang P and Pardee AB (1992) Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257, 967971.
Liang P, Averboukh L and Pardee AB (1993) Distribution and cloning of eukaryotic mRNAs by means of differential display: refinements and optimization. Nucleic Acids Res 21, 32693275.
Maximov V, Martynenko A, Hunsmann G and Tarantul V (2002) Mitochondrial 16S rRNA gene encodes a functional peptide, a potential drug for Alzheimer's disease and target for cancer therapy. Med Hypoth 59, 670673.[CrossRef][Web of Science][Medline]
Medhamurthy R and Gupta P (2004) Analysis of cAMP response element binding protein (CREB) expression in the bonnet monkey corpus luteum. In Program of the 37th annual meeting of the Society for the Study of Reproduction. Vancouver, Canada, Abstract 19.
Moudgal NR, Macdonald GJ and Greep RO (1972) Role of endogenous primate LH in maintaining corpus luteum function in the monkey. J Clin Endocrinol Metab 35, 113116.
Neill JD and Knobil E (1972) On the nature of the initial luteotropic stimulus of pregnancy in the Rhesus monkey. Endocrinology 90, 3438.
Niswender GD, Juengel JL, Silva PJ, Rollyson MK and McIntush EW (2000) Mechanisms controlling the function and life span of the corpus luteum. Physiol Rev 80, 129.
Ottobre JS and Stouffer RL (1984) Persistent versus transient stimulation of the macaque corpus luteum during prolonged exposure to human chorionic gonadotropin: a function of age of the corpus luteum. Endocrinology 114, 21752182.
Ravindranath N, Little-Ihrig L, Benyo DF and Zeleznik AJ (1992) Role of luteinizing hormone in the expression of cholesterol side-chain cleavage cytochrome P450 and 3-beta-hydroxysteroid dehydrogenase, delta 5-4 isomerase messenger ribonucleic acids in the primate corpus luteum. Endocrinology 131, 20652070.
Rich BE and Steitz JA (1987) Human Acidic Ribosomal Phospho-proteins P0, P1 and P2: analysis of cDNA clones, in vitro synthesis and assembly. Mol Cell Biol 7, 40654074.
Richards JS (2001) New signaling pathways for hormones and cyclic adenosine 3',5'-monophosphate action in endocrine cells. Mol Endocrinol 15, 209218.
Selvaraj N, Medhamurthy R, Ramachandra SG, Sairam MR and Moudgal NR (1996) Assessment of luteal rescue and desensitization of macaque corpus luteum brought about by human chorionic gonadotrophin and de-glycosylated human chorionic gonadotrophin treatment. J Biosci 21, 497510.[CrossRef][Web of Science]
Somers JP, Benyo DF, Little-Ihrig L and Zeleznik AJ (1995) Luteinization in primates is accompanied by loss of a 43-kilodalton adenosine 3', 5'-monophosphate response element-binding protein isoform. Endocrinology 136, 47624768.[Abstract]
Srinath BR (1979) Husbandry and breeding of bonnet monkeys (Macaca radiata). In Anand Kumar TC (eds), Nonhuman Primate Models for the Study of Human Reproduction. S.Karger, Basel, pp. 1722.
Srisuparp S, Strakova Z, Brudney A, Mukherjee S, Reierstad S, Hunzicker-Dunn M and Fazleabas AT (2003) Signal transduction pathways activated by chorionic gonadotropin in the primate endometrial epithelial cells. Biol Reprod 68, 457464.
Sugino N, Suzuki T, Kashida S, Karube A, Takiguchi S and Kato H (2000) Expression of Bcl-2 and Bax in the human corpus luteum during the menstrual cycle and in early pregnancy: regulation by human chorionic gonadotropin. J Clin Endocrinol Metab 85, 43794386.
Tajima H, Niikura T, Hashimoto Y, Ito Y, Kita Y, Terashita K, Yamazaki K, Koto A, Aiso S and Nishimoto I (2002) Evidence for in vivo production of Humanin peptide, a neuroprotective factor against Alzheimer's disease-related insults. Neurosci Lett 324, 227231.[CrossRef][Web of Science][Medline]
Tang PZ, Tsai-Morris CH and Dufau ML (1999) A novel gonadotropin-regulated testicular RNA helicase. A new member of the dead-box family. J Biol Chem 74, 3793237940.
Uma J, Muraly P, Verma-Kumar S and Medhamurthy R (2003) Determination of onset of apoptosis in granulose cells of the preovulatory follicles in the bonnet monkey (Macaca radiata): correlation with mitogen-activated protein kinase activities. Biol Reprod 69, 13791387.
Van Damme MP, Robertson DM and Diczfalusy E (1974) An improved in vitro bioassay method for measuring luteinizing hormone (LH) activity using mouse Leydig cell preparations. Acta Endocrinol (Copenh) 77, 655671.
Vander Jagt DL, Kolb NS, Vander Jagt TJ, Chino J, Martinez FJ, Hunsaker LA and Royer RE (1995) Substrate specificity of human aldose reductase: identification of 4-hydroxynonenal as an endogenous substrate. Biochim Biophys Acta 1249, 117126.[CrossRef][Medline]
Vandevoort CA, Molskness TA and Stouffer RL (1988) Adenylate cyclase in the primate corpus luteum during chorionic gonadotropin treatment simulating early pregnancy: homologous versus heterologous desensitization. Endocrinology 122, 734740.
Wittmaack FM, Gafvels ME, Bronner M, Matsuo H, McCrae KR, Tomaszewski JE, Robinson SL, Strickland DK and Strauss JF, 3rd (1995) Localization and regulation of the human very low density lipoprotein/apolipoprotein-E receptor: trophoblast expression predicts a role for the receptor in placental lipid transport. Endocrinology 136, 340348.[Abstract]
Xu J, Stouffer RL and Hennebold JD (2003) Discovery of luteinizing hormone (LH) regulated genes in the primate corpus luteum. In Program the 85th annual meeting of the Endocrine Society. Philadelphia, USA, Abstract P3-2.
Yabe-Nishimura C (1998) Aldose reductase in glucose toxicity: a potential target for the prevention of diabetic complications. Pharmacol Rev 50, 2133.
Yadav VK, Sudhagar RR and Medhamurthy R (2002) Apoptosis during spontaneous and prostaglandin F(2alpha)-induced luteal regression in the buffalo cow (Bubalus bubalis): involvement of mitogen-activated protein kinases. Biol Reprod 67, 752759.
Young KA, Hennebold JD and Stouffer RL (2003) Global patterns of gene expression throughout the life span of the primate corpus luteum in the menstrual cycle. In Program of the 36th annual meeting of the Society for the Study of Reproduction. Cincinnati, USA, Abstract 67.
Zeleznik AJ (1998) In vivo responses of the primate corpus luteum to luteinizing hormone and chorionic gonadotropin. Proc Natl Acad Sci USA 95, 1100211007.
Zeleznik AJ and Benyo DF (1994) Control of follicular development, corpus luteum function and the recognition of pregnancy in higher primates. In Knobil E and Neill JD (eds), The Physiology of Reproduction. Raven Press, New York, USA, pp 751.
Submitted on May 10, 2004; resubmitted on June 3, 2004; accepted on June 14, 2004.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S. Priyanka, P. Jayaram, R. Sridaran, and R. Medhamurthy Genome-Wide Gene Expression Analysis Reveals a Dynamic Interplay between Luteotropic and Luteolytic Factors in the Regulation of Corpus Luteum Function in the Bonnet Monkey (Macaca radiata) Endocrinology, March 1, 2009; 150(3): 1473 - 1484. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. V. Bishop, J. D. Hennebold, and R. L. Stouffer The effects of luteinizing hormone ablation/replacement versus steroid ablation/replacement on gene expression in the primate corpus luteum Mol. Hum. Reprod., March 1, 2009; 15(3): 181 - 193. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Cherian-Shaw, M. Puttabyatappa, E. Greason, A. Rodriguez, C. A. VandeVoort, and C. L. Chaffin Expression of Scavenger Receptor-BI and Low-Density Lipoprotein Receptor and Differential Use of Lipoproteins to Support Early Steroidogenesis in Luteinizing Macaque Granulosa Cells Endocrinology, February 1, 2009; 150(2): 957 - 965. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Natesampillai, J. Kerkvliet, P. C. K. Leung, and J. D. Veldhuis Regulation of Kruppel-like factor 4, 9, and 13 genes and the steroidogenic genes LDLR, StAR, and CYP11A in ovarian granulosa cells Am J Physiol Endocrinol Metab, February 1, 2008; 294(2): E385 - E391. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Priyanka and R. Medhamurthy Characterization of cAMP/PKA/CREB signaling cascade in the bonnet monkey corpus luteum: expressions of inhibin-{alpha} and StAR during different functional status Mol. Hum. Reprod., June 1, 2007; 13(6): 381 - 390. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. K. Yadav and R. Medhamurthy Dynamic Changes in Mitogen-Activated Protein Kinase (MAPK) Activities in the Corpus Luteum of the Bonnet Monkey (Macaca radiata) during Development, Induced Luteolysis, and Simulated Early Pregnancy: A Role for p38 MAPK in the Regulation of Luteal Function Endocrinology, April 1, 2006; 147(4): 2018 - 2027. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. K. Yadav, G. Lakshmi, and R. Medhamurthy Prostaglandin F2{alpha}-mediated Activation of Apoptotic Signaling Cascades in the Corpus Luteum during Apoptosis: INVOLVEMENT OF CASPASE-ACTIVATED DNase J. Biol. Chem., March 18, 2005; 280(11): 10357 - 10367. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Xu, R.L. Stouffer, R.P. Searles, and J.D. Hennebold Discovery of LH-regulated genes in the primate corpus luteum Mol. Hum. Reprod., March 1, 2005; 11(3): 151 - 159. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||












