Skip Navigation


Mol. Hum. Reprod. Advance Access originally published online on July 23, 2004
Molecular Human Reproduction 2004 10(9):641-650; doi:10.1093/molehr/gah092
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
10/9/641    most recent
gah092v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (12)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Pilka, R.
Right arrow Articles by Casslén, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pilka, R.
Right arrow Articles by Casslén, B.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Human Reproduction vol. 10 no. 9 © European Society of Human Reproduction and Embryology 2004; all rights reserved

Endometrial TIMP-4 mRNA is high at midcycle and in hyperplasia, but down-regulated in malignant tumours. Coordinated expression with MMP-26

R. Pilka1,4, H. Domanski2, S. Hansson1, P. Eriksson3 and B. Casslén1,5

Departments of 1Obstetrics & Gynaecology and 2Pathology, University Hospital, S-221 85 Lund, 3Atherosclerosis Research Unit, King Gustav V Research Institute, Karolinska Hospital, S-171 76 Stockholm, Sweden and 4Department of Obstetrics & Gynaecology, Palacky University, 775 20 Olomouc, Czech Republic

5 To whom correspondence should be addressed: Biomedical Centre C 14, Lund, S-221 84 Sweden. Email: bertil.casslen{at}gyn.lu.se


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
We have previously reported that endometrial expression of matrix metalloproteinase (MMP)-26 mRNA comes to a maximum in the early secretory phase. Since tissue inhibitor of metalloproteinase (TIMP)-4 is a potent inhibitor of MMP-26, the objective of this study was to identify the pattern of TIMP-4 mRNA expression in the normal endometrial cycle. We also evaluated hyperplastic, pre-malignant (atypical hyperplasia) and malignant endometrial tissue. Endometrial TIMP-4 mRNA was localized in tissue sections using in situ hybridization, and quantified in tissue extracts using real-time PCR. Estrogen receptor {alpha} (ER{alpha}) was assayed in the same set of samples using immunohistochemistry. In situ hybridization demonstrated TIMP-4 mRNA in the stroma of both normal and pathological tissues. TIMP-4 mRNA increased in the proliferative phase to a maximum in the early secretory phase, and then decreased in the late part of the cycle. Expression was comparable in normal and hyperplastic (including atypical) endometrial samples, whereas lower levels were detected in malignant tumours. Since this general pattern of expression suggests estrogen dependence, we evaluated ER{alpha} in our samples. Tissue sections from the normal proliferative phase, hyperplasia and pre-malignant atypical hyperplasia tissue stained strongly for ER{alpha}, whereas weak staining was seen in the secretory phase and in malignant tumours. Thus, low level of ER{alpha} was accompanied by down-regulated TIMP-4 mRNA, supporting the hypothesis that ER{alpha} contributes to regulation of the TIMP-4 gene. In addition, we identified a putative estrogen response element (ERE) in the promoter region of the TIMP-4 gene at position –930 to –916. Similarities in the cyclic patterns of TIMP-4 mRNA and MMP-26 mRNA, together with the fact that TIMP-4 is a potent inhibitor of MMP-26, suggest a functional relationship, and furthermore a role in human implantation.

Key words: estrogen receptor/human/implantation/pre-malignant/protease inhibitor


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The activity of matrix metalloproteinases (MMP) is regulated locally within tissues by specific inhibitors, belonging to the tissue inhibitor of metalloproteinase (TIMP) family. Currently, four mammalian TIMP (TIM-1, -2, -3, -4) have been identified (Welgus and Stricklin, 1983Go; Stetler-Stevenson et al., 1989Go; Apte et al., 1995Go; Greene et al., 1996Go). They form tight 1:1 complexes with activated MMP, inhibiting their enzymatic activity. Specificity and affinity of the TIMP for individual MMP vary (Woessner, 1991Go; Gomis-Ruth et al., 1997Go; Brew et al., 2000Go).

The TIMP-4 gene has high sequence identity with the TIMP-2 gene (Greene et al., 1996Go). Also, TIMP-4 and TIMP-2 have functional characteristics in common, i.e. they bind MMP-2 within the same region (Stratmann et al., 2001Go), and they are the strongest known inhibitors of MMP-19 (Stracke et al., 2000Go). Kinetic studies of the inhibitory capacity of TIMP-4 revealed IC50 to be 19, 3, 45, 8, 83 and 0.4 nmol/l for MMP-1, -2, -3, -7, -9 and -26 respectively, thus demonstrating that TIMP-4 has highest affinity for MMP-26 among these MMP (Liu et al., 1997Go; Zhang et al., 2002Go).

TIMP-2 is constitutively and widely expressed, whereas TIMP-1 and TIMP-3 are expressed in response to signals such as cytokines, hormones and mitogens (Stetler-Stevenson et al., 1990Go; Lotz and Guerne, 1991Go; Mann et al., 1991Go; Sato et al., 1991Go; Wick et al., 1994Go). Tissue expression of TIMP-4 differs from the other members of the family by being more limited. The highest level of expression is reportedly in the heart, with much lower levels in the kidney, pancreas, colon and testes (Greene et al., 1996Go).

Both MMP and TIMP are expressed at low levels in most adult tissues under physiological conditions. Exceptions with higher expression include endometrial tissue in the menstrual phase, mammary gland involution, and pathophysiological conditions such as wound healing and tumour progression (Birkedal-Hansen, 1995Go).

The monthly cycle of the endometrium involves menstrual desquamation followed by re-growth and differentiation. Endometrial expression of many MMP is associated with tissue degradation during menstruation, whereas others are involved in tissue remodelling during re-growth (Curry and Osteen, 2001Go). MMP-1, -3, -7, -8, -9, -10, -11, -12 are all mainly or exclusively associated with the menstrual phase of the endometrial cycle (Hampton and Salamonsen, 1994Go; Rodgers et al., 1994Go; Marbaix et al., 1995Go; Goffin et al., 2003Go), whereas MMP-2 (Rodgers et al., 1994Go) and MMP-19 (Goffin et al., 2003Go) are constitutively expressed over the cycle. In contrast to most MMP, which are expressed by stromal cells, MMP-7 is mainly or exclusively found in epithelial cells (Rodgers et al., 1993Go; Rawdanowicz et al., 1994Go; Rodgers et al., 1994Go; Wilson and Matrisian, 1996Go).

MMP-26 is a novel metalloproteinase, which shares functional and structural similarities with MMP-7 (de Coignac et al., 2000Go; Park et al., 2000Go; Uria and Lopez-Otin, 2000Go; Marchenko et al., 2001Go). We recently reported that endometrial MMP-26 mRNA is localized in epithelial cells, and that expression is maximal in the early secretory phase (Pilka et al., 2003Go).

Endometrial expression of TIMP-1 and -3 is typically increased in the late secretory and menstrual phases, whereas TIMP-2 is constitutively expressed over the cycle (Hampton and Salamonsen, 1994Go; Rodgers et al., 1994Go; Zhang and Salamonsen, 1997Go; Maatta et al., 2000Go; Goffin et al., 2003Go). Localization of these TIMP is stromal, but TIMP-3 is also found in epithelial cells in the proliferative phase (Rodgers et al., 1994Go; Maatta et al., 2000Go).

TIMP-4 was reported in the endometrium using immunohistochemistry, but no significant cyclical pattern was demonstrated (Chegini et al., 2003Go; Tunuguntla et al., 2003Go).

Over-expression of MMP has been associated with malignant tumours of various origins (Egeblad and Werb, 2002Go). Endometrial tumours have been reported to have enhanced production of MMP-1, -2, -7, -9, MT1-MMP, TIMP-1, -2 and -3, either in the tumour cells or in the tumour stroma (Takemura et al., 1992Go; Soini et al., 1997Go; Iurlaro et al., 1999Go; Ueno et al., 1999Go; Maatta et al., 2000Go; Di Nezza et al., 2002Go).

Expression of the TIMP-4 mRNA has not previously been reported in normal, hyperplastic, or malignant endometrial tissue. Thus, we used in situ hybridization and real-time PCR for localization and quantification of TIMP-4 mRNA in these tissues. In addition, the cyclic pattern of TIMP-4 mRNA was compared to those of MMP-26 mRNA and estrogen receptor {alpha} (ER{alpha}). The TIMP-4 gene was searched upstream from the coding region for a sequence with high homology to the consensus sequence of an estrogen response element (ERE).


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Tissue sampling and processing
Samples of normal, hyperplastic and malignant endometrial tissue were obtained at diagnostic curettage or at hysterectomy. Normal endometrial tissue was obtained from patients operated for benign non-endometrial pathology (e.g. leiomyoma, cervical dysplasia, uterine prolapse etc.) and who were of mean age 43 (range 34–45) years. Tissue samples from patients receiving steroid treatment were not included in the study. All specimens were classified according to an ideal 28 day reproductive cycle as early (n=8), mid (n=6) and late (n=7) proliferative phase, early (n=4), mid (n=4) and late (n=4) secretory phase, pre-menstrual (n=3), and menstrual phase (n=3) (Hendrickson and Kempson, 1980Go; Noyes, 1950Go).

Endometrial samples with hyperplasia were classified as: simple (n=6), complex (n=3), or complex with atypia (n=6). Patients were of mean age 53 (range 42–78) years. All the malignant samples had endometrioid histology and were classified as: well (n=7), intermediately (n=7) and poorly (n=6) differentiated. Patients were of mean age 65 (range 40–86) years. Samples were collected at the Department of Gynaecology and Obstetrics, and sampling was approved by the Review Board for studies in Human Subjects at the Lund University Hospital. One part of every tissue sample was immediately cut into pieces (maximum 4 x 4x4 mm), frozen on dry ice and subsequently stored at –80°C until further processed for in situ hybridization and real-time PCR. The other part was formalin-fixed and paraffin-embedded for histopathological examination and immunohistochemistry.

Extraction of mRNA
One portion of each frozen sample was disintegrated with a microdismembrator and weighed. Total RNA was extracted in 1 ml of Trizol ReagentTM (Life Technologies, Sweden) per 50 mg of tissue and subsequently centrifuged for 15 min at 4°C and 12 000 g. The supernatant was incubated for 10 min at room temperature before 0.2 ml of chloroform per 50 mg tissue was added. Samples were vortexed for 15 s and subsequently centrifuged for 15 min at 4°C and 12 000 g. The chloroform phase was mixed with isopropanol and salt solution (Na-citrate 0.8 mol/l and NaCl 1.2 mol/l) 0.75 ml per 50 mg tissue, and kept at –20°C for 60 min. After thawing, samples were centrifuged for 30 min at 4°C and 12 000 g. The pellet was dried with 75% ethanol, 1 ml per 50 mg of tissue. The RNA pellet was air-dried and diluted in RNAse-free water. The total amount of RNA was assayed spectrophotometrically.

The other portion of the endometrial samples was used for in situ hybridization.

Preparation and labelling of cRNA probes
For the human TIMP-4 mRNA, a probe corresponding to 440 nt (231–670) was used, GenBank accession nm_003256 (Greene et al., 1996Go). DNA templates were generated by PCR amplification from the human TIMP-4 cDNA using bipartite primers consisting of either a modified T7 RNA promoter and a downstream gene-specific sequence (GTGCCGTCAACATGCTTCATA) (anti-sense) or a modified T3 RNA promoter and an upstream gene-specific primer (GTTCCGGCCAGTGCAGACCCT) (sense). Single-stranded RNA probes were prepared from cloned matrix metalloproteinase cDNA. PCR reactions using 1 ng human TIMP-4 cDNA, 1 mg primers, 200 mmol/l dNTP, 3 mmol/l MgCl2, 10 mmol/l Tris, pH 8.3, 50 mmol/l KCl, 2.5 IU Taq polymerase (Invitrogen) were amplified at 95°C for 1 min, 62°C for 1 min and 72°C for 1 min for 30 cycles with a final extension at 72°C for 10 min. Full-length size of transcripts was verified with electrophoresis. DNA templates were purified from agarose gels using QIAquick Gel Extraction Kit (250) (Qiagen). Complementary RNA (cRNA) probes were transcribed from 5 ng of gel-purified DNA template using [35S]UTP (Dupont NEN, 1300 Ci/mmol), and either T3 or T7 RNA polymerase, according to instructions by the manufacturer (Ambion MAXIscript), to generate sense and antisense probes respectively.

Quantification of mRNA with real-time PCR
Aliquots of mRNA (500 ng) from each sample were reverse-transcribed using superscript II according to the manufacturer's manual (Invitrogen, USA). Subsequently, after dilution of the cDNA 5-fold, 3 µl cDNA was amplified by real-time PCR with 1 x TaqMan universal PCR mastermix (Applied Biosystems, USA). A TIMP-4 Assay on Demand Kit from Applied Biosystems (primer set # Hs00162784_m1) was used. The TaqMan probe included the nucleotide (nt) region 122–146. For ß-actin, 200 µmol/l of each primer and 1.25 pmol/l of probe were used and primers were designed using the Primer Express software (Applied Biosystems). ß-Actin was used as a housekeeping gene to normalize the results; the primers for ß-actin were: ß-actin-FW: 5-CTGGCTGCTGACCGAGG-3 and ß-actin-RW: 5-GAAGGTCTCAAACATGATCTGGGT-3; and the probe was: ß-actin-TM: 6FAM5'-CCCTGAACCCCAAGGCCAACCG-3'TAMRA. Each sample was analysed in duplicate using ABI prism 7000 (Applied Biosystem). The PCR amplification was related to a standard curve.

Localization of mRNA
One piece of frozen tissue from each sample was processed for in situ hybridization.

Cryostat sections, 14 mm thick, were collected on siliconized glass slides and stored at –80°C.

The radiolabelled cRNA probe was transcribed from a template using 20 mmol/l [35S]UTP (800 CI/mmol). The RNA polymerases used were T3 for sense and T7 for antisense. Prior to hybridization, tissue sections were pre-treated as described (Young, 1990Go).

Sections were thawed directly in 4% formaldehyde in phosphate-buffered saline (PBS) and fixed for 5 min, rinsed twice in PBS, and acetylated in 0.1 mol/l triethanolamine–HCl, 0.25% acetic anhydride, pH 8 for 10 min. Sections were then rinsed twice in 2 x saline–sodium citrate (SSC), dehydrated in ethanol 70% for 1 min, 80% for 1 min, 95% for 2 min, 100% for 1 min, and 95% for 1 min, prior to air drying. Hybridization with cRNA was performed as described by Cox et al. (1984)Go) and Whitfield et al. (1990)Go.

[35S]cRNA probes were denatured at 65°C for 5 min and placed on ice for 5 min. Final hybridization buffer, with 1 x 106 cpm of denatured [35S]cRNA probe per 50 ml, consisted of 20 mmol/l Tris–HCl (pH 7.4), 1 mmol/l EDTA (pH 8.0), 300 mmol/l NaCl, 50% formamide, 10% dextrasulphate, 1 x Denhardt's, 25 g/l yeast tRNA, 100 mg/l salmon sperm DNA, 250 mg/l total yeast RNA (fraction XI), 100 mmol/l dithiothreitol (DTT), 0.1% sodium thiosulphate, and 0.1% sodium dodecyl sulphate.

Hybridization buffer (70 ml/15 cm2) was applied to tissue sections on each slide and covered with untreated glass cover slips. Slides were then incubated at 56°C in chambers humidified with 2xSSC with 50% formamide for 24 h. After hybridization, slides were cooled to room temperature, and coverslips were floated off the slides in 4xSSC. Slides were then rinsed in four rounds of 4 x SSC followed by immersion in 20 mg/l RNAse A at 37°C for 30 min. Sections were desalted in graded SSC solutions and washed twice in 0.1 x SSC at 65°C for 30 min. Sections were air-dried after dehydration in graded ethanol solutions.

After hybridization, slides were incubated with Kodak Bio-Max MR film for 1–4 days. Slides were then coated with undiluted nuclear track emulsion (NTB-3, Kodak) and following exposure for 4–5 weeks at 4°C, slides were developed in D-19 (Kodak) and counterstained with 1% Toluidine Blue.

All slides were evaluated by two independent observers (R.P. and H.D.). In order to allow semiquantitative evaluation, the intensity of the signal was graded as negative (0) when the signal was indistinguishable from the background; faint (1) when intensity was distinguishable from the background; moderate (2) when signal intensity was less than half-maximal; strong (3) when the signal was more than half-maximal; very strong (4) when the signal was maximal.

Immunohistochemistry
Formalin-fixed, paraffin-embedded sections were treated with 10 mmol/l citrate buffer pH 6.0 in a microwave oven at 550 W for 17 min for antigen retrieval (Shi et al., 1991Go). Immunostaining was performed in an automated immunostainer, TechMate 500 (Ventana Biotek, USA) using the biotin–streptavidin–peroxidase system with diaminobenzidine as the chromogen. ChemMateTM Detection Kit (haematoxylin) was used for counterstaining (Dao, Denmark). The primary antibody was a monoclonal for the estrogen receptor {alpha} (ER{alpha}; Clone 1D5; DakoCytomation, Denmark) diluted 1:100. Immunostaining was evaluated by two independent observers (H.D. and R.P.). The number of positive nuclei was semiquantitatively given as 0, 1 (<25%), 2 (25–75%) and 3 (<75%).

Statistical methods
Results are presented as median and percentiles of groups. Mann–Whitney U-test was used to evaluate the significance of differences between groups. Progressive variation during the menstrual cycle was evaluated with {chi}2-test for trend.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The TIMP-4 mRNA signal was evenly distributed within stroma in normal and hyperplastic endometrial samples (Figures 1 and 2). In contrast, the stromal signal was unevenly distributed in malignant samples. No signal was detected in normal epithelial cells or in tumour cells. Sections hybridized with the sense probe had no signal.



View larger version (126K):
[in this window]
[in a new window]
 
Figure 1. Photomicrographs showing hybridization of the 35S-labelled antisense probe to TIMP-4 mRNA in bright-field (A, C) and dark-field (B, D). Sections of endometrial tissue represent the early secretory phase (A, B) and well-differentiated cancer (C, D). Images reveal TIMP-4 mRNA positive cells (arrows) in the stroma (S). No signal was detected in glandular epithelial cells (G). The 35S-labelled sense probe to TIMP-4 mRNA did not hybridize with sections of endometrial tissue taken in the early secretory phase as shown in bright-field (E) and dark-field (F). Scale bars = 50 µm.

 


View larger version (102K):
[in this window]
[in a new window]
 
Figure 2. Hybridization of the 35S-labelled antisense probe to TIMP-4 mRNA in sections of endometrial tissue is shown in bright-field (A, C, E, G, I, K) and dark-field (B, D, F, H, J, L). Tissue sections represent the early proliferative phase (A, B), late proliferative phase (C, D), early secretory phase (E, F), late secretory phase (G, H), hyperplasia with atypia (I, J) and poorly differentiated endometrial cancer (K, L). Varying strength of stromal signal is seen in all samples except for the late secretory phase and the poorly differentiated cancer samples. Scale bar = 100 µm.

 
Intensity of the hybridization signal was evaluated using a semiquantitative scoring system (see Materials and methods). TIMP-4 mRNA signal intensity was generally low, but nevertheless, a clear cyclical pattern emerged (Figure 3). The signal increased during the proliferative phase to a maximum in the early secretory phase, and then decreased gradually through the mid and late secretory phases to lowest levels in the menstrual phase. Hyperplastic samples had similar TIMP-4 mRNA signal intensity as samples from the early part of the cycle. The signal was sometimes strong, sometimes absent in well-differentiated samples, and sometimes weak but mostly absent in poorly differentiated samples.



View larger version (11K):
[in this window]
[in a new window]
 
Figure 3. Semiquantitative evaluation of signal intensity in endometrial tissue sections (n=71) hybridized to the TIMP-4 antisense probe. Tissue samples were classified as early (EP; n=7), mid (MP; n=6) and late (LP; n=7) proliferative phase, early (ES; n=4), mid (MS; n=4) and late (LS; n=7) secretory phase, and the menstrual (M; n=3) phase. Pathological samples were classified as hyperplasia without atypia (Hyp; n=7); hyperplasia with atypia (Atyp; n=6); well (Well; n=7), intermediately (Inter; n=7) and poorly (Poor; n=6) differentiated cancer. Intensity of the signal was classified as negative (0), faint (1), moderate (2), strong (3), or very strong (4) on a relative scale. Intensity increased from the early proliferative phase to a maximum in the early secretory phase (P<0.0001), and then decreased from the early secretory phase to the menstrual phase (P<0.0001). Intensity of the signal was higher in normal (P<0.0001) and hyperplastic (Hyp + Atyp) (P=0.001) than in malignant (Well + Inter + Poor) samples. Normal and hyperplastic samples were not different. Box plot showing median, 25th and 75th percentiles.

 
TIMP-4 mRNA was quantified by real-time PCR in extracts of samples from the same tissue specimens as used in in situ hybridization. Results were normalized to ß-actin mRNA. A representative real-time experiment is shown in Figure 4. The PCR product is difficult to visualize with gel electrophoresis, since TaqMan is using very short fragments. Real-time PCR data demonstrated a similar cyclic pattern of TIMP-4 mRNA as the semiquantitative in situ data, i.e. an increase from the early proliferative phase to a peak in the early secretory phase, and then a gradual decrease to the menstrual phase (Figure 5). The amount of TIMP-4 mRNA was not different between normal and hyperplastic tissue samples (with and without atypia), but was lower in malignant tumour samples.



View larger version (71K):
[in this window]
[in a new window]
 
Figure 4. Representative real-time PCR experiment for TIMP-4 mRNA and ß-actin mRNA. Standard curve for ß-actin mRNA was between 18 and 20, and all samples were within this interval. Standard curve for TIMP-4 mRNA was between 28 and 38 and all samples were within this interval. Threshold is indicated by the arrow.

 


View larger version (12K):
[in this window]
[in a new window]
 
Figure 5. TIMP-4 mRNA and ß-actin mRNA was quantified by real-time PCR of RNA extracted from normal, hyperplastic and malignant endometrial tissue samples. EP (n=7), MP (n=6), LP (n=7), ES (n=4), MS (n=4), LS (n=7), M (n=2), Hyp (n=6), Atyp (n=6), Well (n=6), Inter (n=6), Poor (n=4). Abbreviations as in Figure 3. Expression increased from the early proliferative phase to a maximum in the early secretory phase (P=0.0002), and decreased from the early secretory to the menstrual phase (P=0.0002). TIMP-4 mRNA levels were higher in normal (P=0.0005) and hyperplastic samples (Hyp + Atyp) (P=0.0002) than in malignant (Well + Inter + Poor) samples. Levels were not different between normal and hyperplastic samples, and also not between the histological groups of malignant tumours. Box plot showing median, 25th and 75th percentiles.

 
Nuclear staining for ER{alpha} was evaluated in the complete set of tissue samples by semiquantitative assessment of specific immunostaining. Stromal staining for ER{alpha} in the normal cycle was high in the proliferative phase and reduced in the secretory phase. It was also high in hyperplastic (with or without atypia) but low in malignant tissue samples. Within the malignant group, staining for ER{alpha} was gradually reduced with loss of histological differentiation to be absent in poorly differentiated tumours (Figure 6).



View larger version (12K):
[in this window]
[in a new window]
 
Figure 6. Semiquantitative assessment of immunostaining for the estrogen receptor {alpha} (ER{alpha}) in endometrial stromal cells. Tissue samples are identical to those described in Figure 3. The number of positive nuclei was estimated and given a score of 0, 1, 2 or 3. The number of ER{alpha} positive nuclei was higher in the proliferative than in the secretory phase of the normal cycle (P<0.0001), and higher in hyperplastic than in malignant tissue samples (P<0.0001). Box plot showing median, 25th, and 75th percentiles.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
TIMP-4 mRNA has been identified in a variety of normal human tissues, e.g. heart, kidney, pancreas, colon, testes, cytotrophoblast (Greene et al., 1996Go; Zhang et al., 2002Go), but has previously not been reported in the endometrial tissue. We found TIMP-4 mRNA in the stroma of normal as well as pathological human endometrial tissues. Also, the TIMP-4 protein has been immunohistologically localized in endometrial tissue (Chegini et al., 2003Go; Tunuguntla et al., 2003Go). In contrast to our in situ hybridization data, these authors found the protein in both stromal and epithelial cells. This may represent release of TIMP-4 protein from stromal to epithelial cells. Taken together with the findings of others, all known human TIMP have now been reported in endometrial tissue. TIMP-1 mRNA and TIMP-2 mRNA have been localized in stromal and vascular endothelial cells, whereas TIMP-3 mRNA was found both in stromal and epithelial cells (Rodgers et al., 1994Go; Maatta et al., 2000Go).

The expression of TIMP-1 and TIMP-3 mRNA was typically higher in the late secretory and menstrual phases than in the proliferative and early secretory phases (Rodgers et al., 1994Go; Maatta et al., 2000Go; Goffin et al., 2003Go). In contrast, the level of TIMP-2 mRNA was stable over the menstrual cycle. No quantitative data have been reported on the cyclical pattern of TIMP-4 protein in endometrial tissue, but immunostaining data suggest highest protein content in the early and mid parts of the secetory phase (Chegini et al., 2003Go; Tunuguntla et al., 2003Go). Thus, among TIMP family members, the cyclical pattern of expression is unique for TIMP-4. Up-regulation pre-menstrually of TIMP-1 and -3 versus at midcycle of TIMP-4 suggests different regulatory mechanisms. In contrast, TIMP-2 appears to be constitutively expressed during the cycle.

The cyclic pattern of TIMP-4 mRNA in the endometrial stroma, with a peak in the early secretory phase, mimics very closely that of MMP-26 mRNA in endometrial epithelium (see Figure 7) (Pilka et al., 2003Go). Co-expression of MMP-26 and TIMP-4 is likely to have physiological relevance, since TIMP-4 has highest inhibitory capacity towards MMP-26 (Stracke et al., 2000Go; Zhang et al., 2002Go). Timing in the cycle suggests that MMP-26 is relevant to the implantation process, and co-regulation of its main inhibitor TIMP-4 is important for controlled MMP-26 activity. The enzyme is likely to reach peak concentration in the endometrial epithelium at the time of blastocyst adhesion and penetration. One potential function for MMP-26 may be to activate embryonic pro-MMP-9, and active MMP-9 can provide a crucial proteolytic capacity during penetration of the epithelial barrier (Librach et al., 1991Go; Zhang et al., 2003Go). The high inhibitory capacity of TIMP-4 for MMP-26 suggests one level of protecting the stroma against proteolytic activity, i.e. epithelial MMP-26 may be neutralized by TIMP-4 if released in the stroma. Thus, TIMP-4 might be ascribed a function in human implantation, similar to what has been observed in mouse implantation (Zhang et al., 2003Go).



View larger version (11K):
[in this window]
[in a new window]
 
Figure 7. Cyclic variation of endometrial tissue content of MMP-26 mRNA, as quantified by real-time PCR and expressed relative to ß-actin mRNA. The graph has been included for comparison (Pilka et al., 2003Go: with permission, ©ESHRE). Box plot showing median, 25th and 75th percentiles. For abbreviations, see Figure 3.

 
TIMP-4 mRNA has previously been localized in tumour cells or in the vasculature in a variety of tumours such as brain, breast and renal cancer and choriocarcinoma (Greene et al., 1996Go; Groft et al., 2001Go; Hagemann et al., 2001Go; Hurst et al., 2001Go; Jiang et al., 2001Go; Zhang et al., 2002Go). In contrast, we localized TIMP-4 mRNA in the stromal compartment of hyperplastic, pre-malignant and malignant endometrial tissues. This discrepancy emphasizes the substantial differences between tumour types in utilizing a specific enzyme or inhibitor. An immunohistochemical study of endometrial cancer found TIMP-4 in the carcinoma cells, particularly in the invading cells, as well as in vascular endothelial cells, smooth muscle cells and inflammatory cells of the stroma (Tunuguntla et al., 2003Go).

Also, we found that the amount of TIMP-4 mRNA is not different between normal and hyperplastic samples, but is lower in endometrial cancer. Levels were not different between the histological groups of malignant tumours. Tunuguntla et al. (2003)Go also observed no significant difference in the staining intensity for TIMP-4 protein between endometrial tumours of different grades. In contrast, expression of TIMP-1, -2 and -3 was increased in endometrial cancer, but was negligible in hyperplasia (Maatta et al., 2000Go). Thus, the unique expression pattern for TIMP-4 observed in the normal cycle is accompanied by an equally unique expression pattern in pathological endometrial conditions. While TIMP-1 mRNA was localized in the tumour stroma, TIMP-2 and TIMP-3 mRNA were found in both stromal and tumour cells (Maatta et al., 2000Go). Thus, stromal distribution of TIMP-4 mRNA in endometrial tumours is similar to that of TIMP-1 mRNA.

Peak levels at midcycle and higher levels in hyperplastic than in malignant endometrial samples suggest estrogen regulation of TIMP-4 mRNA. Transcriptional regulation by estrogenic compounds is mediated by the nuclear estrogen receptors (ER), which, after dimerization, function as transcription factors and interact with estrogen response elements (ERE) within the promoter region of target genes.

In order to compare the cyclic pattern of TIMP-4 mRNA with that of ER{alpha} in the endometrial stroma, we assessed immunohistochemical staining for ER{alpha} in paraffin sections of the same set of endometrial samples. We found ER{alpha} staining to be maximal in the proliferative phase of the normal cycle and in hyperplasia. Low levels were detected in the secretory phase of the normal cycle, and in malignant samples. This pattern is in agreement with the reports by others (Punnonen et al., 1993Go; Kato et al., 1999Go; Matsuzaki et al., 1999Go; Kounelis et al., 2000Go; Utsunomiya et al., 2000Go; Lecce et al., 2001Go; Mertens et al., 2001Go). Since the stromal content of ER{alpha} was maximal throughout the proliferative phase, increment of the TIMP-4 gene transcription may require additional regulatory factor(s), e.g. the midcycle peak of estradiol. Down-regulation of TIMP-4 mRNA in the mid and late secretory phase follows down-regulation of ER{alpha} by progesterone. High levels of TIMP-4 mRNA in the pre-malignant cases, i.e. atypical hyperplasia, may in fact suggest that down-regulation of TIMP-4 in malignancy is not a direct effect of the malignant process, but is rather secondary to down-regulation of ER{alpha}, since ER{alpha} is high in the pre-malignant cases.

Studies of estrogen responsive genes have revealed a common sequence motif representing the ERE, with high affinity binding of dimerized ER (Walker et al., 1983Go; Klein-Hitpass et al., 1986Go; Peale et al., 1988Go). Experiments with constructs, in which the ERE sequence was inserted upstream of a reporter gene, confirmed that a 13 bp inverted repeat was an essential element for estrogen responsiveness (Klein-Hitpass et al., 1988Go). A consensus ERE sequence with stable ER binding has been reported (Figure 8) (Seiler-Tuyns et al., 1986Go; Klein-Hitpass et al., 1988Go; Driscoll et al., 1998Go). Substitutions in this optimal sequence decrease the affinity for ER dimers. We searched the promoter region of the TIMP-4 gene for a potential ERE (Young et al., 2002Go). A sequence with homology to the consensus ERE is present at position –930/–916 (Figure 8). This sequence has two substitutions within the core but they are balanced by guanines in the immediate flanking regions. Even with two substitutions in the core sequence, the ERE is able to bind ER homodimers (Driscoll et al., 1998Go). These data predict that the identified sequence within the TIMP-4 promoter region has high ER binding.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 8. (A) A sequence of the TIMP-4 promoter region, derived from GenBank accession # AY072631 (Young et al., 2002Go), which contains a putative estrogen response element (ERE) at position –930/–916 (enlarged). Adjacent to this site is a myogenin transcription factor-binding site. (B) Sequence with optimal estrogen receptor (ER) binding capacity (Driscoll et al., 1998Go). The core consensus is underlined. The bases in the ERE are numbered starting from the nucleotide at the centre, with negative numbers upstream and positive numbers downstream. Sequence –930 to –916 has high homology with the consensus sequence. With only two substitutions in the core consensus, at + 5 and + 6, the identified ERE should be able to bind ER homodimers (Driscoll et al., 1998Go).

 


    Acknowledgements
 
This project was supported by grants from the Swedish Cancer fund; the Medical Faculty at Lund University; the Lund University Hospital fund for cancer research; Nilsson, Crafoord and Kamprad foundations; the Swedish Medical Research Council (12660; 14358; 14187) and the King Gustaf V and Queen Victoria Foundation. The skilled technical assistance of Mrs Christine Andersson is acknowledged.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Apte SS, Olsen BR and Murphy G (1995) The gene structure of tissue inhibitor of metalloproteinases (TIMP)-3 and its inhibitory activities define the distinct TIMP gene family. J Biol Chem 270, 14313–14318.[Abstract/Free Full Text]

Birkedal-Hansen H (1995) Matrix metalloproteinases. Adv Dent Res 9, 16.[Free Full Text]

Brew K, Dinakarpandian D and Nagase H (2000) Tissue inhibitors of metalloproteinases: evolution, structure and function. Biochim Biophys Acta 1477, 267–283.[CrossRef][Medline]

Chegini N, Rhoton-Vlasak A and Williams RS (2003) Expression of matrix metalloproteinase-26 and tissue inhibitor of matrix metalloproteinase-3 and -4 in endometrium throughout the normal menstrual cycle and alteration in users of levonorgestrel implants who experience irregular uterine bleeding. Fertil Steril 80, 564–570.[CrossRef][Web of Science][Medline]

Cox KH, DeLeon DV, Angerer LM and Angerer RC (1984) Detection of mRNA in sea urchin embryos by in situ hybridization using asymmetric RNA probes. Dev Biol 101, 485–502.[CrossRef][Web of Science][Medline]

Curry TE Jr and Osteen KG (2001) Cyclic changes in the matrix metalloproteinase system in the ovary and uterus. Biol Reprod 64, 1285–1296.[Abstract/Free Full Text]

de Coignac AB, Elson G, Delneste Y, Magistrelli G, Jeannin P, Aubry JP, Berthier O, Schmitt D, Bonnefoy JY and Gauchat JF (2000) Cloning of MMP-26 A novel matrilysin-like proteinase. Eur J Biochem 267, 3323–3329.[Web of Science][Medline]

Di Nezza LA, Misajon A, Zhang J, Jobling T, Quinn MA, Ostor AG, Nie G, Lopata A and Salamonsen LA (2002) Presence of active gelatinases in endometrial carcinoma and correlation of matrix metalloproteinase expression with increasing tumor grade and invasion. Cancer 94, 1466–1475.[CrossRef][Web of Science][Medline]

Driscoll MD, Sathya G, Muyan M, Klinge CM, Hilf R and Bambara RA (1998) Sequence requirements for estrogen receptor binding to estrogen response elements. J Biol Chem 273, 29321–29330.[Abstract/Free Full Text]

Egeblad M and Werb Z (2002) New functions for the matrix metalloproteinases in cancer progression. Nat Rev Cancer 2, 161–174.[Web of Science][Medline]

Goffin F, Munaut C, Frankenne F, D'Hauterive S, Beliard A, Fridman V, Nervo P, Colige A and Foidart JM (2003) Expression pattern of metalloproteinases and tissue inhibitors of matrix-metalloproteinases in cycling human endometrium. Biol Reprod 69, 976–984.[Abstract/Free Full Text]

Gomis-Ruth FX, Maskos K, Betz M, Bergner A, Berger A, Huber R, Suzuki K, Yoshida N, Nagase H, Brew K, Bourenkov GP et al. (1997) Mechanism of inhibition of the human matrix metalloproteinase stromelysin-1 by TIMP-1. Nature 389, 77–81.[CrossRef][Medline]

Greene J, Wang M, Liu YE, Raymond LA, Rosen C and Shi YE (1996) Molecular cloning and characterization of human tissue inhibitor of metalloproteinase 4. J Biol Chem 271, 30375–30380.[Abstract/Free Full Text]

Groft LL, Muzik H, Rewcastle NB, Johnston RN, Knauper V, Lafleur MA, Forsyth PA and Edwards DR (2001) Differential expression and localization of TIMP-1 and TIMP-4 in human gliomas. Br J Cancer 85, 55–63.[CrossRef][Web of Science][Medline]

Hagemann T, Gunawan B, Schulz M, Fuzesi L and Binder C (2001) mRNA expression of matrix metalloproteases and their inhibitors differs in subtypes of renal cell carcinomas. Eur J Cancer 37, 1839–1846.[CrossRef][Web of Science][Medline]

Hampton AL and Salamonsen LA (1994) Expression of messenger ribonucleic acid encoding matrix metalloproteinases and their tissue inhibitors is related to menstruation. J Endocrinol 141, R1–R3.[Abstract/Free Full Text]

Hendrickson MR and Kempson RL (1980) Surgical pathology of the uterine corpus. Saunders, Philadelphia.

Hurst DR, Li H, Xu X, Badisa VL, Shi YE and Sang QX (2001) Development of characterization of a new polyclonal antibody specifically against tissue inhibitor of metalloproteinases 4 in human breast cancer. Biochem Biophys Res Commun 281, 166–171.[CrossRef][Web of Science][Medline]

Iurlaro M, Loverro G, Vacca A, Cormio G, Ribatti D, Minischetti M, Ria R, Bruno M and Selvaggi L (1999) Angonesis extent and expression of matrix metalloproteinase-2 and -9 correlate with upgrading and myometrial invasion in endometrial carcinoma. Eur J Clin Invest 29, 793–801.[CrossRef][Web of Science][Medline]

Jiang Y, Wang M, Celiker MY, Liu YE, Sang QX, Goldberg ID and Shi YE (2001) Stimulation of mammary tumorigenesis by systemic tissue inhibitor of matrix metalloproteinase 4 gene delivery. Cancer Res 61, 2365–2370.[Abstract/Free Full Text]

Kato K, Horiuchi S, Terao Y, Ueoka Y, Nishida J, Mori D, Yoshikawa Y and Wake N (1999) Relevance of ER to the development of endometrial hyperplasia and adenocarcinoma. Breast Cancer 6, 312–319.[Medline]

Klein-Hitpass L, Schorpp M, Wagner U and Ryffel GU (1986) An estrogen-responsive element derived from the 5' flanking region of the Xenopus vitellogenin A2 gene functions in transfected human cells. Cell 46, 1053–1061.[CrossRef][Web of Science][Medline]

Klein-Hitpass L, Ryffel GU, Heitlinger E and Cato AC (1988) A 13 bp palindrome is a functional estrogen responsive element and interacts specifically with estrogen receptor. Nucleic Acids Res 16, 647–663.[Abstract/Free Full Text]

Kounelis S, Kapranos N, Kouri E, Coppola D, Papadaki H and Jones MW (2000) Immunohistochemical profile of endometrial adenocarcinoma: a study of 61 cases and review of the literature. Mod Pathol 13, 379–388.[CrossRef][Web of Science][Medline]

Lecce G, Meduri G, Meduri G, Ancelin M, Bergeron C and Perrot-Applanat M (2001) Presence of estrogen receptor beta in the human endometrium through the cycle: expression in glandular, stromal and vascular cells. J Clin Endocrinol Metab 86, 1379–1386.[Abstract/Free Full Text]

Librach CL, Werb Z, Fitzgerald ML, Chiu K, Corwin NM, Esteves RA, Grobelny D, Galardy R, Damsky CH and Fisher SJ (1991) 92-kD type IV collagenase mediates invasion of human cytotrophoblasts. J Cell Biol 113, 437–449.[Abstract/Free Full Text]

Liu YE, Wang M, Greene J, Su J, Ullrich S, Li H, Sheng S, Alexander P, Sang QA and Shi YE (1997) Preparation and characterization of recombinant tissue inhibitor of metalloproteinase 4 (TIMP-4). J Biol Chem 272, 20479–20483.[Abstract/Free Full Text]

Lotz M and Guerne PA (1991) Interleukin-6 induces the synthesis of tissue inhibitor of metalloproteinases-1/erythroid potentiating activity (TIMP-1/EPA). J Biol Chem 266, 2017–2020.[Abstract/Free Full Text]

Maatta M, Soini Y, Liakka A and Autio-Harmainen H (2000) Localisation of MT1-MMP, TIMP-1, TIMP-2 and TIMP-3 messenger RNA in normal, hyperplastic and neoplastic endometrium Enhanced expression by endometrial adenocarcinomas is associated with low differentiation. Am J Clin Pathol 114, 402–411.[Web of Science][Medline]

Mann JS, Kindy MS, Edwards DR and Curry TE Jr (1991) Hormonal regulation of matrix metalloproteinase inhibitors in rat granulosa cells and ovaries. Endocrinology 128, 1825–1832.[Abstract/Free Full Text]

Marbaix E, Kokorine I, Henriet P, Donnez J, Courtoy PJ and Eeckhout Y (1995) The expression of interstitial collagenase in human endometrium is controlled by progesterone and by oestradiol and is related to menstruation. Biochem J 305(Pt 3), 1027–1030.[Medline]

Marchenko GN, Ratnikov BI, Rozanov DV, Godzik A, Deryugina EI and Strongin AY (2001) Characterization of matrix metalloproteinase-26, a novel metalloproteinase widely expressed in cancer cells of epithelial origin. Biochem J 356, 705–718.[CrossRef][Web of Science][Medline]

Matsuzaki S, Fukaya T, Suzuki T, Murakami T, Sasano H and Yajima A (1999) Oestrogen receptor alpha and beta mRNA expression in human endometrium throughout the menstrual cycle. Mol Hum Reprod 5, 559–564.[Abstract/Free Full Text]

Mertens HJ, Heineman MJ, Theunissen PH, de Jong FH and Evers JL (2001) Androgen estrogen and progesterone receptor expression in the human uterus during the menstrual cycle. Eur J Obstet Gynecol Reprod Biol 98, 58–65.[CrossRef][Web of Science][Medline]

Noyes RW, Hertig AT and Rock J (1950) Dating the endometrial biopsy. Fertil Steril 1, 3–25.[Medline]

Park HI, Ni J, Gerkema FE, Liu D, Belozerov VE and Sang QX (2000) Identification and characterization of human endometase (matrix metalloproteinase-26) from endometrial tumor. J Biol Chem 275, 20540–20544.[Abstract/Free Full Text]

Peale FV Jr, Ludwig LB, Zain S, Hilf R and Bambara RA (1988) Properties of a high-affinity DNA binding site for estrogen receptor. Proc Natl Acad Sci USA 85, 1042.

Pilka R, Whatling C, Domanski H, Hansson S, Eriksson P and Casslen B (2003) Epithelial expression of matrix metalloproteinase-26 is elevated at mid-cycle in the human endometrium. Mol Hum Reprod 9, 271–277.[Abstract/Free Full Text]

Punnonen R, Mattila J, Kuoppala T and Koivula T (1993) DNA ploidy, cell proliferation and steroid hormone receptors in endometrial hyperplasia and early adenocarcinoma. J Cancer Res Clin Oncol 119, 426–429.[CrossRef][Web of Science][Medline]

Rawdanowicz TJ, Hampton AL, Nagase H, Woolley DE and Salamonsen LA (1994) Matrix metalloproteinase production by cultured human endometrial stromal cells: identification of interstitial collagenase, gelatinase-A, gelatinase-B and stromelysin-1 and their differential regulation by interleukin-1 alpha and tumor necrosis factor-alpha. J Clin Endocrinol Metab 79, 530–536.[Abstract]

Rodgers WH, Osteen KG, Matrisian LM, Navre M, Giudice LC and Gorstein F (1993) Expression and localization of matrilysin, a matrix metalloproteinase, in human endometrium during the reproductive cycle. Am J Obstet Gynecol 168, 253–260.[Web of Science][Medline]

Rodgers WH, Matrisian LM, Giudice LC, Dsupin B, Cannon P, Svitek C, Gorstein F and Osteen KG (1994) Patterns of matrix metalloproteinase expression in cycling endometrium imply differential functions and regulation by steroid hormones. J Clin Invest 94, 946–953.[Web of Science][Medline]

Sato T, Ito A, Mori Y, Yamashita K, Hayakawa T and Nagase H (1991) Hormonal regulation of collagenolysis in uterine cervical fibroblasts. Modulation of synthesis of procollagenase, prostromelysin and tissue inhibitor of metalloproteinases (TIMP) by progesterone and oestradiol-17 beta. Biochem J 275(Pt 3, 645–650.

Seiler-Tuyns A, Walker P, Martinez E, Merillat AM, Givel F and Wahli W (1986) Identification of estrogen-responsive DNA sequences by transient expression experiments in a human breast cancer cell line. Nucleic Acids Res 14, 8755–8770.[Abstract/Free Full Text]

Shi SR, Key ME and Kalra KL (1991) Antigen retrieval in formalin-fixed, paraffin-embedded tissues: an enhancement method for immunohistochemical staining based on microwave oven heating of tissue sections. J Histochem Cytochem 39, 741–748.[Abstract]

Soini Y, Alarakkola E and Autio-Harmainen H (1997) Expression of messenger RNAs for metalloproteinases 2 and 9, type IV collagen and laminin in nonneoplastic and neoplastic endometrium. Hum Pathol 28, 220–226.[CrossRef][Web of Science][Medline]

Stetler-Stevenson WG, Krutzsch HC and Liotta LA (1989) Tissue inhibitor of metalloproteinase (TIMP-2) A new member of the metalloproteinase inhibitor family. J Biol Chem 264, 17374–17378.[Abstract/Free Full Text]

Stetler-Stevenson WG, Brown PD, Onisto M, Levy AT and Liotta LA (1990) Tissue inhibitor of metalloproteinases-2 (TIMP-2) mRNA expression in tumor cell lines and human tumor tissues. J Biol Chem 265, 13933–13938.[Abstract/Free Full Text]

Stracke JO, Hutton M, Stewart M, Pendas AM, Smith B, Lopez-Otin C, Murphy G and Knauper V (2000) BIOCHEMICAL characterization of the catalytic domain of human matrix metalloproteinase 19. Evidence for a role as a potent basement membrane degrading enzyme. J Biol Chem 275, 14809–14816.

Stratmann B, Farr M and Tschesche H (2001) MMP–TIMP interaction depends on residue 2 in TIMP-4. FEBS Lett 507, 285–287.[CrossRef][Web of Science][Medline]

Takemura M, Azuma C, Kimura T, Tokugawa Y, Miki M, Ono M, Saji F and Tanizawa O (1992) Malignant cell-specific gelatinase activity in human endometrial carcinoma. Cancer 70, 147–151.[CrossRef][Web of Science][Medline]

Tunuguntla R, Ripley D, Sang QX and Chegini N (2003) Expression of matrix metalloproteinase-26 and tissue inhibitors of metalloproteinases TIMP-3 and -4 in benign endometrium and endometrial cancer. Gynecol Oncol 89, 453–459.[CrossRef][Web of Science][Medline]

Ueno h, Yamashita K, Azumano I, Inoue M and Okada Y (1999) Enhanced production and activation of matrix metalloproteinase-7 (matrilysin) in human endometrial carcinomas. Int J Cancer 84, 470–477.[CrossRef][Web of Science][Medline]

Uria JA and Lopez-Otin C (2000) Martilysin-2, a new matrix metalloproteinase expressed in human tumors and showing the minimal domain organization required for secretion, latency and activity. Cancer Res 60, 4745–4751.[Abstract/Free Full Text]

Utsunomiya H, Suzuki T, Harada N, Ito K, Matsuzaki S, Konno R, Sato S, Yajima A and Sasano H (2000) Analysis of estrogen receptor alpha and beta in endometrial carcinomas: correlation with ER beta and clinicopathologic findings in 45 cases. Int J Gynecol Pathol 19, 335–341.[Web of Science][Medline]

Walker P, Brown-Luedi M, Germond JE, Wahli W, Meijlink FC, van het Schip AD, Roelink H, Gruber M and Ab G (1983) Sequence homologies within the 5’ end region of the estrogen-controlled vitellogenin gene in Xenopus and chicken. EMBO J 2, 2271–2279.[Web of Science][Medline]

Welgus HG and Stricklin GP (1983) Human skin fibroblast collagenase inhibitor Comparative studies in human connective tissues, serum and amniotic fluid. J Biol Chem 258, 12259–12264.[Abstract/Free Full Text]

Whitfield HJ, Brady LS, Smith MA, Mamalaki E, Fox RJ and Herkenham M (1990) OPTIMIZATION of cRNA probe in situ hybridization methodology for localization of glucocorticoid receptor mRNA in rat brain: a detailed protocol. Cell Mol Neurobiol 10, 145–157.[CrossRef][Web of Science][Medline]

Wick M, Burger C, Brusselbach S, Lucibello FC and Muller R (1994) A novel member of human tissue inhibitor of metalloproteinases (TIMP) gene family is regulated during G1 progression, mitogenic stimulation, differentiation and senescence. J Biol Chem 269, 18953–18960.[Abstract/Free Full Text]

Wilson CL and Matrisian LM (1996) Martilysan an epithelial matrix metalloproteinase with potentially novel functions. Int J Biochem Cell Biol 28, 123–136.[CrossRef][Web of Science][Medline]

Woessner JF, Jr (1991) Matrix metalloproteinases and their inhibitors in connective tissue remodeling. FASEB J 5, 2145–2154.[Abstract]

Young DA, Phillips BW, Lundy C, Nuttall RK, Hogan A, Schultz GA, Leco KJ, Clark IM and Edwards DR (2002) Identication of an initiator-like element essential for the expression of the tissue inhibitor of metalloproteinases-4 (Timp-4) gene. Biochem J 364, 89–99.[Web of Science][Medline]

Young WS (1990) In situ hybridization histochemistry. In Björklund A, Hökfelt T, Wouterlood FG, and van den Pol AN (eds), Handbook of Chemical Neuroanatomy: Analysis of Neuronal Microcircuits and Synaptic Interactions. Elsevier Science Publishers BV,.

Zhang J and Salamonsen LA (1997) Tissue inhibitor of metalloproteinases (TIMP)-1, -2 and -3 in human endometrium during the menstrual cycle. Mol Hum Reprod 3, 735–741.[Abstract/Free Full Text]

Zhang J, Cao YJ, Zhao YG, Sang QX and Duan EK (2002) Expression of matrix metalloproteinase-26 and tissue inhibitor of metalloproteinase-4 in human normal cytotrophoblast cells and a choriocarcinoma cell line, JEG-3. Mol Hum Reprod 8, 659–666.[Abstract/Free Full Text]

Zhang J, Zhao YG, Cao YJ, Sang QX and Duan EK (2003) Expression and implications of tissue inhibitor of metalloproteinases-4 in mouse embryo. Mol Hum Reprod 9, 143–149.[Abstract/Free Full Text]

Submitted on April 29, 2004; resubmitted on May 29, 2004; accepted on July 5, 2004.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
T. A. O'Mara, J. A. Clements, and A. B. Spurdle
The Use of Predictive or Prognostic Genetic Biomarkers in Endometrial and Other Hormone-Related Cancers: Justification for Extensive Candidate Gene Single Nucleotide Polymorphism Studies of the Matrix Metalloproteinase Family and their Inhibitors
Cancer Epidemiol. Biomarkers Prev., September 1, 2009; 18(9): 2352 - 2365.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
R. Pilka, I. Oborna, V. Lichnovsky, P. Havelka, H. Fingerova, P. Eriksson, S. Hansson, and B. Casslen
Endometrial expression of the estrogen-sensitive genes MMP-26 and TIMP-4 is altered by a substitution protocol without down-regulation in IVF patients
Hum. Reprod., December 1, 2006; 21(12): 3146 - 3156.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Hickey, J. Crewe, L. A. Mahoney, D. A. Doherty, I. S. Fraser, and L. A. Salamonsen
Mechanisms of Irregular Bleeding with Hormone Therapy: The Role of Matrix Metalloproteinases and Their Tissue Inhibitors
J. Clin. Endocrinol. Metab., August 1, 2006; 91(8): 3189 - 3198.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
R. Pilka, V. Noskova, H. Domanski, C. Andersson, S. Hansson, and B. Casslen
Endometrial TIMP-4 mRNA is expressed in the stroma, while TIMP-4 protein accumulates in the epithelium and is released to the uterine fluid
Mol. Hum. Reprod., August 1, 2006; 12(8): 497 - 503.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
W. Li, A. Y. Savinov, D. V. Rozanov, V. S. Golubkov, H. Hedayat, T. I. Postnova, N. V. Golubkova, Y. Linli, S. Krajewski, and A. Y. Strongin
Matrix Metalloproteinase-26 Is Associated with Estrogen-Dependent Malignancies and Targets {alpha}1-Antitrypsin Serpin
Cancer Res., December 1, 2004; 64(23): 8657 - 8665.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
10/9/641    most recent
gah092v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (12)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Pilka, R.
Right arrow Articles by Casslén, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pilka, R.
Right arrow Articles by Casslén, B.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?