Skip Navigation


Mol. Hum. Reprod. Advance Access originally published online on January 3, 2006
Molecular Human Reproduction 2005 11(11):779-784; doi:10.1093/molehr/gah219
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
11/11/779    most recent
gah219v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (13)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Harris, S. E.
Right arrow Articles by Shelling, A. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Harris, S. E.
Right arrow Articles by Shelling, A. N.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2006. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oupjournals.org

INHA promoter polymorphisms are associated with premature ovarian failure

Sarah E. Harris1, Ashwini L. Chand1, Ingrid M. Winship2, Ksenija Gersak3, Yoshihiro Nishi4, Toshihiko Yanase4, Hajime Nawata4 and Andrew N. Shelling1,5

1Department of Obstetrics and Gynaecology, 2Department of Molecular Medicine, University of Auckland, Auckland, New Zealand, 3Department of Obstetrics and Gynaecology, University Medical Centre, Ljubljana, Slovenia and 4Department of Medicine and Bioregulatory Science (Third Department of Internal Medicine), Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan

5 To whom correspondence should be addressed at: Department of Obstetrics and Gynaecology, Faculty of Medical and Health Sciences, Private Bag 92019, University of Auckland, Auckland, New Zealand. E-mail: a.shelling{at}auckland.ac.nz


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Inhibin is an important glycoprotein that is involved in folliculogenesis. INHA, the gene encoding the inhibin alpha subunit, was recently proposed as a candidate for premature ovarian failure (POF), a syndrome that leads to the cessation of ovarian function under the age of 40 years. 70 POF patients and 70 controls were screened for the previously identified INHA –16C>T transition mutation. The T allele was found in 31/70 (44.3%) of controls, but only 18/70 (25.7%) of POF patients. This result indicates that the T allele is significantly underrepresented in the POF patient population (Fisher’s exact test, two-tail: P = 0.033). Sequence analysis of the INHA promoter in 50 POF patients and 50 controls identified a highly polymorphic imperfect TG repeat at approximately –300 bp, that consisted of four common haplotypes (A, B, C and D). The –16T allele is linked to the shortest repeat haplotype (haplotype C). Despite the association between haplotype C and POF, no significant difference was found between the promoter activity of a luciferase reporter construct containing haplotype C, and most of the other haplotypes tested. Interestingly, haplotype B failed to show any promoter activity. We conclude that the inheritance of specific INHA promoter haplotypes predispose to the development of premature ovarian failure.

Key words: infertility/inhibin/polymorphism/ovarian failure/TG repeat


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Inhibins are dimeric glycoproteins consisting of a common inhibin alpha subunit (INHA, 14 kDa) covalently linked to one of two related inhibin beta subunits (INHBA, 18 kDa and INHBB, 18 kDa), which respectively form inhibin A and inhibin B. Inhibins were originally isolated from porcine and bovine follicular fluid (Ling et al., 1985Go; Miyamoto et al., 1985Go; Rivier et al., 1985Go; Robertson et al., 1985Go) and the main production sites are now known to be the granulosa cells in the female and sertoli cells in the male (Vale et al., 1988Go). Inhibin A and B both inhibit the secretion of FSH, which is involved in the recruitment and development of ovarian follicles during folliculogenesis, but are themselves secreted by the ovarian follicles at different times during the menstrual cycle. Inhibin B levels are highest at the mid-follicular phase, followed by a decline in the late follicular phase (Groome et al., 1994Go, 1996Go). The inhibin A levels rise at mid-cycle, indicative of production and secretion from the preovulatory follicle, then rise again during the luteal phase indicative of production by the corpus luteum (Groome et al., 1994Go, 1996Go). Therefore, it is proposed that the role of inhibin B is in the recruitment and initiation of folliculogenesis in small preantral follicles, whereas inhibin A has the endocrine role of pituitary FSH suppression. The activins, which stimulate FSH activity, are composed of homo- or heterodimers of the inhibin beta subunits (Ling et al., 1986Go; Vale et al., 1986Go). The inhibin subunits are all members of the transforming growth factor (TGF)-ß superfamily, a group of molecules that are involved in cell growth and differentiation.

The genes encoding the three inhibin subunits were recently proposed as candidates for premature ovarian failure (POF) due to inhibin’s role in the negative feedback control of FSH (Shelling et al., 2000Go). POF is a syndrome that leads to the cessation of ovarian function under the age of 40 years. It affects 1% of all women and occurs in 0.1% before the age of 30 years (Coulam et al., 1986Go). POF may result from either a decreased number of follicles being formed during ovarian development, or by an increased rate of follicle loss. Alternatively, follicles may be present, but unresponsive to hormonal stimulation. The most commonly known causes of POF are X-chromosome abnormalities (Shelling, 2000Go), but in the majority of women, with a normal karyotype, there is no known cause. Approximately 20–30% of women with POF will have other affected female family members, suggesting that an inherited predisposition to the condition is common. We, and others, have identified mutations in a small number of patients, in the genes encoding the FSH receptor (Aittomaki et al., 1995Go; Beau et al., 1998Go; Touraine et al., 1999Go), the LH/choriogonadotrophin receptor (Latronico et al., 1996Go) and FOXL2 (Harris et al., 2002Go). We have also identified a coding variant, 769G>A, in the INHA gene that results in a non-conservative amino acid change, A257Thr, in 7% of POF patients. This has recently been corroborated by an Italian group, who showed that 4.5% of POF patients and 25% of patients with primary amenorrhoea were heterozygous for the INHA variant (Marozzi et al., 2002Go). This same group also reported an increased prevalence of the C allele of an INHA 5'untranslated region (5'UTR) single-nucleotide polymorphism (SNP), 129C>T, in POF patients, than in a control group. This SNP had previously been shown to be in linkage disequilibrium with a silent coding SNP (675C>T) and not to be linked to dizygotic twinning (Montgomery et al., 2000Go).

Expression of all three inhibin subunit genes is stimulated by FSH. However, this expression varies several fold in a tissue-specific manner (Meunier et al., 1988Go), suggesting that the three genes are regulated by different mechanisms. Analysis of the human and murine promoter sequences of these genes corroborates this theory (Feng et al., 1989Go; Pei et al., 1991Go; Su and Hsueh, 1992Go; Dykema and Mayo, 1994Go; Tanimoto et al., 1996Go; Ardekani et al., 1998Go; Yoshida et al., 1998Go; Debieve and Thomas, 2002Go). Typical of many housekeeping genes neither INHA nor INHBB contain either TATA or CCAAT boxes, and the INHBB promoter, though not the INHA promoter, is GC rich. Human INHA transcription is initiated from three transcription start sites, although only the major one is shared by multiple species (Debieve and Thomas, 2002Go) and an adjacent GA-rich region is believed to play a role in initiating this transcription. An interesting feature of the INHA promoter is the presence of an imperfect TG repeat, that is longer in the human than in the mouse or rat. The INHA promoter also contains several response elements, including a cAMP response element (CRE), an adjacent steroidogenic factor 1 (SF1) site and AP1 and AP2 sites, suggesting that it is regulated by cAMP. Indeed, several reporter-gene-assay-based studies have shown that an intact CRE element is required for cAMP-induced up-regulation of murine INHA expression (Pei et al., 1991Go; Su and Hsueh, 1992Go). The INHBA gene is also regulated by cAMP, and like INHA, its promoter contains a CRE element and AP1 and AP2 sites and a TG repeat. However, unlike INHA and INHBB, the INHBA promoter has both TATA and CCAAT boxes. Although INHBB contains AP2 sites, it has no CRE element in either of its two promoters (that initiate the transcription of 4 kb and 3 kb transcripts) and does not appear to be regulated by cAMP (Dykema and Mayo, 1994Go; Feng et al., 1995Go).

The purpose of our study was to characterize the INHA 5'UTR/promoter in a cohort of POF patients and normal control samples, to test our hypothesis that promoter sequence variants, leading to altered INHA expression levels, are associated with POF.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Patient information and DNA extraction
Fifty New Zealand and 20 Slovenian women, with POF, were recruited for this study by the Department of Obstetrics and Gynaecology in Auckland, New Zealand, and the Department of Obstetrics and Gynaecology in Ljubljana, Slovenia. POF was defined as cessation of menses for a duration of 6 months or more before the age of 40 years, along with a FSH concentration of >40 IU/l. A complete medical and gynaecological history was taken from each patient as previously described (Shelling et al., 2000Go). 50 normal control samples were obtained from the general population of New Zealand and 20 from the general population of Slovenia.

Genomic DNA was extracted from 10 ml samples of blood as previously described (Shelling et al., 2000Go) and 100 ng was used as a template in a PCR.

DNA sequencing of the INHA promoter region
Primers were designed that flanked a 1 kb region of the INHA promoter (Figure 1) using the primer select module in the DNAStar computer program from Lasergene (1994) (DNASTAR Inc., Madison, WI, USA) and are as follows: INHA5'F: 5'gctcccggctcgcctccttacc3' (nucleotides 42262–42284, accession number AC009955 [GenBank] ) and Inha3'r: 5'cctggccctgctagtggggaactc3' (nucleotides 43257–43234, accession number AC009955 [GenBank] ). Reaction conditions were 0.4 µM of each primer, 0.2 mM of each dNTP, 0.625 U Taq polymerase, 1x Q solution and 1x PCR buffer (Qiagen GmbH, Hilden, Germany) in a 25 µl total volume. 30 cycles of PCR were performed, consisting of 1 min at 94°C, 1 min at 62°C and 2 min at 72°C, with a final 10 min extension at 72°C.


Figure 1
View larger version (12K):
[in this window]
[in a new window]
 
Figure 1. Schematic of INHA promoter showing the locations of primers used for sequencing (INHA5'F and INHA3'R) and SSCP (INHA3'F and INHA3'R). The major transcription start site and the translation start are also indicated and all numbering is based on the translation start site, beginning at +1. The region of the promoter that was subcloned to create the pGL3 enhancer constructs is depicted with the TG repeat region shaded and the locations of the –252C>A, –124A>G and –16C>T single-nucleotide polymorphisms (SNPs) are given.

 

PCR products to be sequenced were purified using Roche’s High Pure PCR Product Purification Kit (Roche Diagnostics GmbH, Mannheim, Germany). Sequencing reactions were performed using the ABI PRISMTM BIG DYE Terminator Sequencing Kit under standard conditions with an annealing temperature of 55°C. Sequencing products were separated either on a ABI PRISMTM 377 DNA Sequencer XL machine or a ABI PRISMTM 3100 Genetic Analyzer (PE Biosystems, Foster City, CA, USA) at the Centre for Gene Technology, University of Auckland. Primers used for sequencing were INHA5'F and INHA3'R (Figure 1).

Restriction fragment length polymorphism analysis
To rapidly screen all 70 patients and 70 controls for the –16C>T polymorphism an restriction fragment length polymorphism analysis (RFLP) assay was performed as described previously (Montgomery et al., 2000Go).

Forced restriction fragment length polymorphism analysis
To confirm the sequencing data and to rapidly screen all New Zealand samples for the –124A>G polymorphism, identified in the INHA promoter, a forced restriction fragment length polymorphism analysis (FRFLP) assay was devised. Primers were designed to amplify the region of INHA promoter containing the polymorphism, such that a Sau3AI restriction site was introduced by the reverse primer into samples containing an A at position –124, but not those containing a G. The primers were Frflpf: 5'aggtcgcttgaggcgaaatccttcc3' and Frflpr: 5'tcccacacccaccctcttctacccttctga3'.

PCR conditions were as above with the exception that an extension time of 1 min and no Q solution were used. A Sau3AI digestion resulted in the 196 bp PCR fragment forming two fragments of 168 bp and 28 bp in the presence of the A allele.

Single-stranded conformation polymorphism
To rapidly screen all New Zealand samples for the polymorphic repeat identified in the INHA promoter, an single-stranded conformation polymorphism (SSCP) assay was used. The region of the promoter containing the repeat was amplified by PCR using primers INHA3'F: 5'TATTGAAAGGGGCCCCAGAAGGTC3' (nucleotides 42721–42744, accession number AC009955 [GenBank] ) and INHA3'R. PCR conditions used were the same as for the FRFLP assay. SSCP was performed as described previously (Shelling et al., 2000Go), using a 14% (w/v) polyacrylamide gel without glycerol.

Construction of reporter genes
To subclone INHA promoter regions containing eight different haplotypes, they were amplified from the relevant DNA samples by PCR using the primers: INHAClF: 5'CCGGCTAGCGCTCCCAGGCTCCTG3', which contains a NheI restriction site and INHAClR: 5'AGCACTCGAGCTCACCTGGCCCTG3', which contains a XhoI restriction site. PCR conditions used were the same as for the FRFLP assay, with the exception that a proof reading polymerase, Pfu (Promega, Sydney, Australia) plus Q solution was used. The final nucleotide of INHAClR annealed to –16C/T, allowing us, through the use of a proof reading polymerase, to clone haplotype C with either a C or a T at that position. The PCR products were initially subcloned into pCR®4Blunt-TOPO® (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. The integrity of the inserts was confirmed by DNA sequencing. The inserts were then released from the vector by a NheI/XhoI restriction digest and subcloned into pGL3-Enhancer (Promega), upstream of the firefly luciferase gene. The integrity of the inserts were again confirmed by DNA sequencing. Plasmids were propagated in JM109 cells (Promega) and purified using a Plasmid Midi kit (Qiagen).

Transfection of human granulosa cell lines and luciferase assays
A human granulosa cell line (KGN) (Nishi et al., 2001) was plated in a 24 well plate, at a density of 2 x 105 viable cells per well, in Dulbecco’s modified Eagle’s medium (DMEM)/F12, 10% fetal calf serum (FCS), the day before transfection. Cells were co-transfected with 800 ng of the relevant pGL3-Enhancer construct and 5 ng of the Renilla luciferase control reporter, Promega Renilla luciferase-cytomegalovirus (pRL–CMV), diluted in 200 µl DMEM/F12, using 2µl of lipofectamine and 4µl of PLUS reagent (Invitrogen). After 7 h at 37°C, 5% CO2, 750µl DMEM/F12 and 13.3% FCS were added. After a further 41 h incubation, cells were harvested and luciferase activity determined using the dual-luciferase® reporter assay system (Promega) in a Victor2 (Wallac, MD, USA), according to manufacturer’s instructions. Comparisons between groups were made using one-way analysis of variance (ANOVA).


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Initial DNA sequence analysis of the INHA promoter identified a polymorphism at position –16C>T. After further analysis, we realized that the –16C>T SNP was identical to the previously identified 129C>T SNP (Montgomery et al., 2000Go; Marozzi et al., 2002Go). We use the widely accepted nomenclature guidelines (den Dunnen and Antonarakis, 2000Go) where the first nucleotide of the translation start codon is labelled as +1. Therefore, the –16C>T variant we have identified probably corresponds to the 129C>T variant reported previously (Montgomery et al., 2000Go; Marozzi et al., 2002Go).

Fifty New Zealand and 20 Slovenian POF patients, and the same number of controls, were screened for the –16C>T (Figure 1) transition in the 5'UTR of INHA. 29 of 70 (41.4%) controls were heterozygous for this transition and 2 (2.9%) controls were homozygous for T. However, only 18 of 70 (25.7%) POF patients were heterozygous and no T homozygotes were identified. These results indicate that the T allele is significantly underrepresented in the POF patient population (Fisher’s exact test, two-tail: P = 0.033).

To analyse the INHA promoter sequence upstream of the –16C>T SNP, approximately 1 kb fragment of 5'UTR was amplified by PCR and sequenced in 38 of the New Zealand POF patients and 10 of the New Zealand controls. The imperfect TG repeat element located approximately 300 bp upstream of the ATG start site (Figure 1) was found to be highly polymorphic. To determine the exact sequences of both alleles from several of the samples, it was necessary to subclone them into pCR®4Blunt-TOPO® and then sequence using vector primers. Initially, 5 haplotypes were identified [A–D and D(i), Table I]. A –124A>G SNP was also identified and shown to be inherited co-ordinately with the polymorphic repeat, with haplotypes A and B having –124A and haplotypes C, D and D(i), –124G. No other variants were identified. To rapidly type the remaining New Zealand samples, a FRFLP/SSCP combined assay was devised (Figure 2) and all 50 New Zealand POF patients and 50 controls were screened by this method. Where a novel or unclear SSCP pattern was identified, the sample was sequenced and where necessary cloned into pCR®4 Blunt-TOPO® before sequencing. In total, 7 repeat polymorphism haplotypes were typed [A–D and D(i–iii), Table I] along with a third SNP, –252C>A (Figure 1) in one of the control samples (genotype B/C). Haplotype D(i) was found in a single POF patient and haplotypes D(ii) and D(iii) were each identified in single controls. The repeat region varied in length from 94 nucleotides in haplotype A to only 76 nucleotides in haplotype C. Table II details the genotypes identified in both the POF and control populations. Our results indicate that in the New Zealand population, repeat polymorphism haplotype C is in linkage disequilibrium with –16T, as every sample that was heterozygous for –16T was also heterozygous for haplotype C and the control that were homozygous for one was also homozygous for the other. Interestingly, haplotype C contains the shortest repeat polymorphism, being at least 10 nucleotides shorter than the other variants. The C haplotype was underrepresented in the patients (14%), compared to controls (23%) (Table III), however, due to the smaller number of patients following stratification by haplotype, this was not a statistically significant difference. Due to the large number of variables we did not have the statistical power to perform further analyses on this data. With the exception of haplotype C being underrepresented in the POF patients, no other obvious correlation between genotype (haplotype) and phenotype was observed.


View this table:
[in this window]
[in a new window]
 
Table I. Repeat polymorphisms in the INHA promoter

 

Figure 2
View larger version (63K):
[in this window]
[in a new window]
 
Figure 2. Forced restriction fragment length polymorphism analysis/single-stranded conformation polymorphism (FRFLP/SSCP) analysis of INHA promoter. (A) FRFLP analysis of –124A>G using Sau3AI. Undigested DNA and digested DNA samples, homozygous for –124G, give a band of 196 bp. DNA samples heterozygous for –124G>A, yield two bands of 196 bp and 168 bp when digested with Sau3AI and samples homozygous for –124A a single band of 168 bp. (B) SSCP analysis of the TG repeat and –124A>G. An example of each genotype identified in the New Zealand patients and controls is illustrated.

 

View this table:
[in this window]
[in a new window]
 
Table II. INHA promoter genotypes in premature ovarian failure (POF) patients and controls

 

View this table:
[in this window]
[in a new window]
 
Table III. INHA promoter genotypes according to allele in premature ovarian failure (POF) patients and controls

 

To determine whether or not INHA promoters containing haplotype C possess significantly different activity to other INHA promoters, we made several luciferase reporter constructs which were tested in transient transfection assays. The constructs consisted of INHA promoter fragments from approximately –460 to –1, containing the polymorphic TG repeat region, upstream of the luciferase gene (Figure 1). Constructs containing haplotypes A-D, D(i), D(ii) and C with the –252C>A transversion [C(var)] were all created. A mutant version of haplotype C [C(mut)], with a C instead of a T at nucleotide –16, was also made, to distinguish between effects caused by the repeat polymorphism and those caused by the –16 SNP. A human granulosa cell line (KGN) (Nishi et al., 2001Go), that was determined by RT–PCR to express INHA (data not shown), was transfected with either, one of the constructs or the empty reporter vector (pGL3 enhancer) and luciferase activity was measured 48 h after the onset of transfection. Figure 3 shows that the luciferase activities of all constructs, with the exception of B, were approximately 5x higher than that of the empty reporter vector, which was a significant increase in activity (ANOVA, P = 0.018). Interestingly, expression levels of construct B were below background luminescence levels (mean reading from six duplicates taken during three separate experiments, corrected for background reading = –0.034 ± 0.01 SEM), indicating that there was no promoter activity from this construct. The sequence of construct B was reanalysed to confirm its integrity. There was no significant difference (ANOVA, P = 0.91) between the luciferase activity measured from the other 7 constructs [constructs A, C, C(var), C(mut), D, D(i) and D(ii)].


Figure 3
View larger version (12K):
[in this window]
[in a new window]
 
Figure 3. Luciferase activity of the INHA promoter constructs, A, B, C, C(mut), C(var), D, D(i), D(ii) and pGL3 enhancer, 48 h after the onset of transfection. Results are shown as means ± SEM of three independent experiments each performed in duplicate (n = 6).

 


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Previous studies have revealed the importance of inhibin in follicular development and have shown a strong association between a coding variant, 769G>A, in INHA, that causes a non-conservative amino acid change, A257Thr, and POF. More recent studies have identified a pair of linked INHA SNPs, 129C>T and 675C>T (Montgomery et al., 2000Go). The 129C>T SNP has been associated with susceptibility to POF (Marozzi et al., 2002Go). We analysed the INHA promoter region by DNA sequence analysis, and identified SNP’s, including the –16C>T SNP. After further analysis, we realized that the –16C>T SNP was identical to the previously identified 129C>T SNP (Montgomery et al., 2000Go; Marozzi et al., 2002Go). The difference in SNP assignment is due to earlier papers (Montgomery et al., 2000Go; Marozzi et al., 2002Go) numbering nucleotides from the beginning of the GenBank DNA sequence, rather than the widely accepted nomenclature guidelines (den Dunnen and Antonarakis, 2000Go) where the first nucleotide of the translation start codon is labelled as +1.

We have screened 70 POF patients and 70 controls from the populations of New Zealand and Slovenia for the –16C>T SNP and detected the T allele in 31 of 70 (44.3%) of the control population, but only 18 of 70 (25.7%) of POF patients, showing a statistically significant difference between the two populations (Fisher’s exact test, two-tail: P = 0.033). Our findings are similar to those of Marozzi et al. (2002)Go assuming they are the same SNP, as they identified the T allele in 33% of women who experienced physiological menopause and in only 19.7% of POF patients (Marozzi et al., 2002Go). Overall, we found the T allele at a slightly higher frequency than Marozzi et al. (2002)Go in both control and POF patient populations, and this may be a reflection of either the different populations sampled (Italians versus New Zealanders and Slovenians) or be chance events due to the relatively small number of samples analysed. Like Marozzi et al. (2002)Go we found that none of the patients in whom we previously identified the 769G>A transition (Shelling et al., 2000Go) carried a –16T allele. Interestingly, it is the less common variant (–16T) that is underrepresented in the POF patients when compared with the general population. We conclude that the –16T allele represents a susceptibility allele, and protects women from the early development of POF. An alternative presentation of this data is that the –16C allele predisposes women to an early menopause.

Despite the association between the –16C>T SNP and POF, it is unlikely that an SNP located between the transcription and translation start sites, could on its own significantly affect expression from INHA. Because the only coding sequence polymorphism that –16C>T was linked to was the silent substitution, 531C>T (675C>T) (Montgomery et al., 2000Go) we sequenced a approximately 1 kb region of the promoter upstream from this SNP, in 38 New Zealand POF patients and 10 controls to identify any other, potentially more causative variants. The region of promoter sequenced contained several known response elements and had previously been shown to have promoter activity in both human and murine reporter gene assays (Su and Hsueh, 1992Go; Debieve and Thomas, 2002Go). From this small initial study we discovered that the extended imperfect TG repeat at approximately –300 is considerably polymorphic in both the POF patient and control populations, with the repeat region ranging from 76 to 94 bp in length and that –16T is linked to the shortest haplotype (haplotype C). Analysis of the remaining New Zealand samples by FRFLP and SSCP confirmed this linkage and lead to the discovery of a total of seven different variants at the repeat locus.

Because –16T is underrepresented in the 70 New Zealand and Slovenian POF patients and is linked to repeat polymorphism haplotype C in the 50 New Zealand POF patients and 50 New Zealand controls, we inferred that the TG repeat polymorphism haplotype C is also underrepresented in the POF patient population. The C haplotype was underrepresented in patients (14%) compared to controls (23%) (Table III), although this was not statistically significant. TG repeats are widely dispersed throughout eukaryotic genomes, with a copy number of approximately 105 in the human genome (Hamada et al., 1982Go; Hamada and Kakunaga 1982Go). They are associated with the transition from B- to Z-DNA which may be involved in the activation of transcription. Of specific interest, calcium, which was shown to induce a conformational change from B- to Z-DNA in a TG repeat (Dobi and Agoston, 1998Go), is known to stimulate inhibin production in cultured term placental trophoblast cells (Keelan et al., 1994Go).

With the exception of haplotype B, the approximately 500 bp region of promoter that was subcloned upstream of the luciferase gene showed an equal level of promoter activity in the KGN cell line, no matter which repeat polymorphism haplotype was present. Haplotype C, despite being underrepresented in the POF patient population, did not have a significantly different level of expression under the conditions used, as might have been predicted. Further investigations are required to determine whether or not the short repeat does indeed alter the expression levels of INHA compared to the longer repeats. It is possible that the repeat itself is linked to another polymorphism that is causative in POF and therefore we shall be screening the region of the genome surrounding the INHA gene. A study of the mouse Inha promoter determined that although a 2.5 kb region upstream of the gene was sufficient to a drive reporter gene in a transgenic mouse, a 6 kb fragment drove expression in pre-antral follicles and in the adrenal glands of immature mice, that was not seen with the 2.5 kb fragment (Hsu et al., 1995Go). This experiment implied that important regulatory elements are present greater than 2.5 kb upstream from the transcription start site, and therefore warrants further investigation. Future investigations may look at DNA samples from women who have undergone a late menopause to ascertain whether or not –16T/haplotype C is over-represented in this population of women.

The main function of inhibin in women is its regulation of pituitary FSH secretion. It is well established that a decline in serum inhibin levels occurs when ovarian follicular reserves begin to decline, leading to an increase in FSH secretion (Shelling et al., 2000Go). Because Haplotype C is underrepresented in women with POF, we propose that in vivo, INHA alleles with haplotype C express a greater amount of INHA than those with other haplotypes. We propose that this leads to an increase in inhibin levels and thus a decrease in FSH levels, which in turn leads to a decrease in the rate of follicle loss, and thus a later menopause. It will be interesting to determine INHA and corresponding FSH levels in the serum of women to see if there is a correlation with different INHA promoter genotypes.

Surprisingly, haplotype B showed no promoter activity. Despite careful scrutiny of the construct sequence, no mutations could be detected. There was no obvious reason why haplotype B should have no promoter activity, although we did note that despite being present in 22% of our samples, no haplotype B homozygotes were detected.

In summary we have shown that the imperfect TG repeat in the INHA promoter is highly polymorphic and that the shortest repeat (haplotype C) is linked to –16T, which is underrepresented in POF patients compared to normal controls. Under the conditions used in our experiments we failed to demonstrate that haplotype C conveyed a significantly different promoter activity to the INHA promoter, compared to the majority of other haplotypes tested. This work underlines the importance of inhibin in the regulation of follicle loss, and indicates that variation in the INHA promoter may predispose to premature ovarian failure.


    Acknowledgements
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
We thank the POF patients for their involvement in this study. We also thank the many clinicians who provided these patients. Funding was provided by the University of Auckland Research Committee, the Health Research Council of New Zealand and the Auckland Medical Research Foundation.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Aittomaki K, Lucena JL, Pakarinen P, Sistonen P, Tapanainen J, Gromoll J, Kaskikari R, Sankila EM, Lehvaslaiho H, Engel AR et al. (1995) Mutation in the follicle-stimulating hormone receptor gene causes hereditary hypergonadotropic ovarian failure. Cell 82,959–968.[CrossRef][Web of Science][Medline]

Ardekani AM, Romanelli JC and Mayo KE (1998) Structure of the rat inhibin and activin betaA-subunit gene and regulation in an ovarian granulosa cell line. Endocrinology 139,3271–3279.[Abstract/Free Full Text]

Beau I, Touraine P, Meduri G, Gougeon A, Desroches A, Matuchansky C, Milgrom E, Kuttenn F and Misrahi M (1998) A novel phenotype related to partial loss of function mutations of the follicle stimulating hormone receptor. J Clin Invest 102,1352–1359.[Web of Science][Medline]

Coulam CB, Adamson SC and Annegers JF (1986) Incidence of premature ovarian failure. Obstet Gynecol 67,604–606.[Web of Science][Medline]

Debieve F and Thomas K (2002) Control of the human inhibin alpha chain promoter in cytotrophoblast cells differentiating into syncytium. Mol Hum Reprod 8,262–270.[Abstract/Free Full Text]

den Dunnen JT and Antonarakis SE (2000) Mutation nomenclature extensions and suggestions to describe complex mutations: a discussion. Human Mutation 15,7–12.[CrossRef][Web of Science][Medline]

Dobi AV and Agoston D (1998) Submillimolar levels of calcium regulates DNA structure at the dinucleotide repeat (TG/AC)n. Proc Natl Acad Sci USA 95,5981–5986.[Abstract/Free Full Text]

Dykema JC and Mayo KE (1994) Two messenger ribonucleic acids encoding the common beta B-chain of inhibin and activin have distinct 5'-initiation sites and are differentially regulated in rat granulosa cells. Endocrinology 135,702–711.[Abstract]

Feng ZM, Li YP and Chen CL (1989) Analysis of the 5'-flanking regions of rat inhibin alpha- and beta-B-subunit genes suggests two different regulatory mechanisms. Mol Endocrinol 3,1914–1925.[Abstract/Free Full Text]

Feng ZM, Wu AZ and Chen CL (1995) Characterization and regulation of two testicular inhibin/activin beta B-subunit messenger ribonucleic acids that are transcribed from alternate initiation sites. Endocrinology 136,947–955.[Abstract]

Groome NP, Illingworth PJ, O’Brien M, Cooke I, Ganesan TS, Baird DT and McNeilly (1994) Detection of dimeric inhibin throughout the human menstrual cycle by two-site enzyme immunoassay. Clin Endocrinol 40,717–723.[Medline]

Groome NP, Illingworth PJ, O’Brien M, Pai R, Rodger FE, Mather JP and McNeilly (1996) Measurement of dimeric inhibin B throughout the human menstrual cycle. J Clin Endocrinol Metab 81,1401–1405.[Abstract]

Hamada H and Kakunaga T (1982) Potential Z-DNA forming sequences are highly dispersed in the human genome. Nature 298,396–398.[CrossRef][Medline]

Hamada H, Petrino MG and Kakunaga T (1982) A novel repeated element with Z-DNA-forming potential is widely found in evolutionarily diverse eukaryotic genomes. Proc Natl Acad Sci USA 79,6465–6469.[Abstract/Free Full Text]

Harris SE, Chand AL, Winship IM, Gersak K, Aittomaki K and Shelling AN (2002) Identification of novel mutations in FOXL2 associated with premature ovarian failure. Mol Hum Reprod 8,729–733.[Abstract/Free Full Text]

Hsu SY, Lai RJ, Nanuel D and Hsueh AJ (1995) Different 5'-flanking regions of the inhibin-alpha gene target transgenes to the gonad and adrenal in an age-dependent manner in transgenic mice. Endocrinology 136,5577–5586.[Abstract]

Keelan J, Song Y and France JT (1994) Comparative regulation of inhibin, activin and human chorionic gonadotropin production by placental trophoblast cells in culture. Placenta 15,803–818.[Web of Science][Medline]

Latronico AC, Anasti J, Arnhold IJ, Rapaport R, Mendonca BB, Bloise W, Castro M, Tsigos C and Chrousos GP (1996) Brief report: testicular and ovarian resistance to luteinizing hormone caused by inactivating mutations of the luteinizing hormone-receptor gene. N Engl J Med 334,507–512.[Free Full Text]

Ling N, Ying SY, Ueno N, Esch F, Denoroy L and Guillemin R (1985) Isolation and partial characterization of a Mr 32,000 protein with inhibin activity from porcine follicular fluid. Proc Natl Acad Sci USA 82,7217–7221.[Abstract/Free Full Text]

Ling N, Ying SY, Ueno N, Shimasaki S, Esch F, Hotta M and Guillemin R (1986) A homodimer of the beta-subunits of inhibin A stimulates the secretion of pituitary follicle stimulating hormone. Biochem Biophys Res Commun 138,1129–1137.[CrossRef][Web of Science][Medline]

Marozzi A, Porta C, Vegetti W, Crosignani PG, Tibiletti MG, Dalpra L and Ginelli E (2002) Mutation analysis of the inhibin alpha gene in a cohort of Italian women affected by ovarian failure. Hum Reprod 17,1741–1745.[Abstract/Free Full Text]

Meunier H, Rivier C, Evans RM and Vale W (1988) Gonadal and extragonadal expression of inhibin alpha, beta A, and beta B subunits in various tissues predicts diverse functions. Proc Natl Acad Sci USA 85,247–251.[Abstract/Free Full Text]

Miyamoto K, Hasegawa Y, Fukuda M, Nomura M, Igarashi M, Kangawa K and Matsuo H (1985) Isolation of porcine follicular fluid inhibin of 32K daltons. Biochem Biophys Res Commun 129,396–403.[CrossRef][Web of Science][Medline]

Montgomery GW, Duffy DL, Hall J, Haddon BR, Kudo M, McGee EA, Palmer JS, Hsueh AJ, Boomsma DI and Martin NG (2000) Dizygotic twinning is not linked to variation at the alpha-inhibin locus on human chromosome 2. J Clin Endocrinol Metab 85,3391–3395.[Abstract/Free Full Text]

Nishi Y, Yanase T, Mu Y, Oba K, Ichino I, Saito M, Nomura M, Mukasa C, Okabe T, Goto K et al. (2001) Establishment and characterization of a steroidogenic human granulosa-like tumor cell line, KGN, that expresses functional follicle-stimulating hormone receptor. Endocrinology 142,437–445.[Abstract/Free Full Text]

Pei L, Dodson R, Schoderbek WE, Maurer RA and Mayo KE (1991) Regulation of the alpha inhibin gene by cyclic adenosine 3',5'-monophosphate after transfection into rat granulosa cells. Mol Endocrinol 5,521–534.[Abstract/Free Full Text]

Rivier J, Spiess J, McClintock R, Vaughan J and Vale W (1985) Purification and partial characterization of inhibin from porcine follicular fluid. Biochem Biophys Res Commun 133,120–127.[CrossRef][Web of Science][Medline]

Robertson DM, Foulds LM, Leversha L, Morgan FJ, Hearn MT, Burger HG, Wettenhall RE and de Kretser DM (1985) Isolation of inhibin from bovine follicular fluid. Biochem Biophys Res Commun 126,220–226.[CrossRef][Web of Science][Medline]

Shelling AN (2000) X chromosome defects and premature ovarian failure. Aust N Z J Med 30,5–7.[Web of Science][Medline]

Shelling AN, Burton KA, Chand AL, van Ee CC, France JT, Farquhar CM, Milsom SR, Love DR, Gersak K, Aittomaki K et al. (2000) Inhibin: a candidate gene for premature ovarian failure. Hum Reprod 15,2644–2649.[Abstract/Free Full Text]

Su JG and Hsueh AJ (1992) Characterization of mouse inhibin alpha gene and its promoter. Biochem Biophys Res Commun 186,293–300.[CrossRef][Web of Science][Medline]

Tanimoto K, Yoshida E, Mita S, Nibu Y, Murakami K and Fukamizu A (1996) Human activin betaA gene. Identification of novel 5' exon, functional promoter, and enhancers. J Biol Chem 271,32760–32769.[Abstract/Free Full Text]

Touraine P, Beau I, Gougeon A, Meduri G, Desroches A, Pichard C, Detoeuf M, Paniel B, Prieur M, Zorn JR et al. (1999) New natural inactivating mutations of the follicle-stimulating hormone receptor: correlations between receptor function and phenotype. Mol Endocrinol 13,1844–1854.[Abstract/Free Full Text]

Vale W, Rivier C, Hsueh A, Campen C, Meunier H, Bicsak T, Vaughan J, Corrigan A, Bardin W, Sawchenko P et al. (1988) Chemical and biological characterization of the inhibin family of protein hormones. Recent Prog Horm Res 44,1–34.[Web of Science][Medline]

Vale W, Rivier J, Vaughan J, McClintock R, Corrigan A, Woo W, Karr D and Spiess J (1986) Purification and characterization of an FSH releasing protein from porcine ovarian follicular fluid. Nature 321,776–779.[CrossRef][Medline]

Yoshida E, Tanimoto K, Murakami K and Fukamizu A (1998) Isolation and characterization of 5'-regulatory region of mouse activin beta A subunit gene. Biochem Mol Biol Int 44,325–332.[Web of Science][Medline]

Submitted on June 21, 2005; accepted on July 26, 2005.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Hum ReprodHome page
T. Corre, J. Schuettler, S. Bione, A. Marozzi, L. Persani, R. Rossetti, F. Torricelli, I. Giotti, P. Vogt, D. Toniolo, et al.
A large-scale association study to assess the impact of known variants of the human INHA gene on premature ovarian failure
Hum. Reprod., April 10, 2009; (2009) dep090v1.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
H. Kang, S. K. Lee, M.-H. Kim, J. Song, S. J. Bae, N. K. Kim, S.-H. Lee, and K. Kwack
Parathyroid hormone-responsive B1 gene is associated with premature ovarian failure
Hum. Reprod., June 1, 2008; 23(6): 1457 - 1465.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Tsigkou, S. Marzotti, L. Borges, A. Brozzetti, F. Reis, P. Candeloro, M. Luisa Bacosi, V. Bini, F. Petraglia, and A. Falorni
High Serum Inhibin Concentration Discriminates Autoimmune Oophoritis from Other Forms of Primary Ovarian Insufficiency
J. Clin. Endocrinol. Metab., April 1, 2008; 93(4): 1263 - 1269.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
B. Mandon-Pepin, P. Touraine, F. Kuttenn, C. Derbois, A. Rouxel, F. Matsuda, A. Nicolas, C. Cotinot, and M. Fellous
Genetic investigation of four meiotic genes in women with premature ovarian failure
Eur. J. Endocrinol., January 1, 2008; 158(1): 107 - 115.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Z. Altuntas, J. M. Johnson, and V. K. Tuohy
Autoimmune Targeted Disruption of the Pituitary-Ovarian Axis Causes Premature Ovarian Failure
J. Immunol., August 1, 2006; 177(3): 1988 - 1996.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
11/11/779    most recent
gah219v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (13)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Harris, S. E.
Right arrow Articles by Shelling, A. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Harris, S. E.
Right arrow Articles by Shelling, A. N.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?