Mol. Hum. Reprod. Advance Access originally published online on February 25, 2005
Molecular Human Reproduction 2005 11(4):295-298; doi:10.1093/molehr/gah153
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
A deletion of a novel heat shock gene on the Y chromosome associated with azoospermia
1Reproduction, Fertility and Populations, Institut Pasteur, 25 rue du Dr Roux, 75724 Paris Cedex 15, France, 2Institute of Genetics, University of Bucharest, Aleea Portocalelor, nr 1–3, Bucharest and 3Genetics Department, University of Medicine and Pharmacy "Carol Davila", Bucharest, Romania
4 To whom correspondence should be addressed at: Reproduction, Fertility and Populations, Institut Pasteur, 25 rue du Dr Roux, 75724 Paris Cedex 15, France
 |
Abstract |
|---|
 Top Abstract IntroductionPatients and methodsResults and discussionReferences |
|---|
Deletions of the Y chromosome are a significant cause of spermatogenic failure. Three major deletion intervals have been defined and termed AZFa, AZFb and AZFc. Here, we report an unusual case of a proximal AZFb deletion that includes the Y chromosome palindromic sequence P4 and a novel heat shock factor (HSFY). This deletion neither include the genes EIF1AY, RPS4Y2 nor copies of the RBMY1 genes. The individual presented with idiopathic azoospermia. We propose that deletions of the testis-specific HSFY gene family may be a cause of unexplained cases of idiopathic male infertility. This deletion would not have been detected using current protocols for Y chromosome microdeletion screens, therefore we recommend that current screening protocols be extended to include this region and other palindrome sequences that contain genes expressed specifically in the testis.
Key words: AZFb/heat shock gene/male infertility/Y chromosome
|
Introduction |
|---|
|
TopAbstractIntroductionPatients and methodsResults and discussionReferences |
|---|
The underlying genetic basis of male infertility remains largely unknown. In approximately 30–50% of all cases of azoospermia or severe oligozoospermia, a cause cannot be determined and these cases are classified as idiopathic (Krausz and Forti, 2000
). Recently, the availability of improved physical maps of the Y chromosome, together with the identification of a number of candidate fertility genes on the long arm of the Y chromosome, has lead to considerable interest in the role of the Y chromosome in male fertility (Tilford et al., 2001; Skaletsky et al., 2003). Male infertility is estimated to affect around 10% of all men and some cases of idiopathic male infertility are caused by either the absence of or, in rare cases, loss-of-function mutations involving Y-linked genes (McElreavey et al., 2000). In recent years, microdeletions of the long arm of the human Y chromosome define three regions termed azoospermia factor (AZF) which are associated with reduced sperm counts (oligospermia) or the complete absence of spermatozoa in the ejaculate (azoospermia; Vogt et al., 1996; McElreavey et al., 2000).
The most frequent classes of Y chromosome microdeletions associated with infertility (AZFa, AZFb, AZFc and AZFb + AZFc deletions) occur as a consequence of recombination between blocks of repetitive sequences that flank and define the AZF deletion intervals. Deletions of the AZFc region are estimated to occur in 1 in 4000 males and they are the most common class of deletion (around 80% of the total). AZFc deletions are considered to be the consequence of homologous recombination between two direct repeats of 229 kb in length (Kuroda-Kawaguchi et al., 2001). In contrast, AZFa deletions are rare (–1%) but are also thought to result from homologous recombination between direct repeats, which are only 10 kb in length (Blanco et al., 2000; Kamp et al., 2000; Sun et al., 2003). Complete AZFb deletions, which were previously thought to be non-overlapping with AZFc deletions, are actually 6.23 Mb in length and extend 1.5 Mb into the proximal portion of AZFc (Repping et al., 2002). Complete AZFb deletions, as well as AZFb + AZFc deletions are a consequence of recombination between palindromic sequences on the Y chromosome long arm (Repping et al., 2002). It is important to note that in some populations, deletions and duplications of sequences within the male-specific portion of Y chromosome occur as natural polymorphisms and are considered to have no phenotypic consequences (Jobling et al., 1996; Fernandes et al., 2004).
The human MSY palindromes, designated P1–P8, contain many testis-specific genes in their arms and show evidence of gene conversion events (Rozen et al., 2003). Such structures may have a selective advantage and play an important role in the evolution of multi-copy testis gene families by retarding the decay of Y chromosome genes. However, palindromic sequences have the potential to form complex secondary structures and often exhibit considerable instability (Zhou et al., 2001). Bearing this in mind, we decided to screen a series of men who presented with idiopathic male infertility for the absence of one of these palindromic sequences (termed P4), which contains copies of a novel gene encoding a protein with a heat shock motif in each palindromic arm (Skaletsky et al., 2003; Shinka et al., 2004; Tessari et al., 2004). These patients were previously studied for microdeletions of the Y chromosome using a panel of markers recommended by the European Academy of Andrology (EAA) for the regions AZFb and AZFc that are widely used in clinical diagnostic laboratories (Simoni, 2001). Therefore, each patient was considered to carry an intact Y chromosome (Raicu et al., 2003). Here, we identified one of these cases as carrying a deletion of proximal AZFb including the palindrome P4.
|
Patients and methods |
|---|
|
TopAbstractIntroductionPatients and methodsResults and discussionReferences |
|---|
Patients
The study population was recruited and studied through a comprehensive andrological examination, including semen analysis and hormonal analysis at the Human Assisted Reproduction Department, Panait Sarbu Hospital. Semen analysis was performed according to the WHO 1992 guidelines (World Health Organization, 1992
). Light microscopic evaluation of sperm concentration, motility, viability and morphology was performed. Specimens originally considered as azoospermic were centrifuged (1000 g for 20 min) and the pellets were examined for spermatozoa, before confirming azoospermia. Severe oligozoospermia was defined by a sperm concentration <1 x 106/ml. Serum concentrations of FSH, LH and testosterone were performed using immunoradiometric assay (Raicu et al., 2003). Testicular volume was evaluated using an orchidometer. Cases of azoospermia/oligozoospermia resulting from endocrine or obstructive causes or with a constitutional cytogenetic abnormality were excluded from our study. All patients were of Romanian ethnic origin. All subjects gave an informed consent for molecular analysis of their blood samples and the study was approved by a local ethical committee. DNA samples from a total of 100 fertile men of Romanian ethnic origin were used as controls.
Molecular genetic analysis
Human genomic DNA was prepared from peripheral blood leukocytes using conventional methods as follow. Briefly, 2 ml of peripheral blood was collected in EDTA bottles. BLB lysis buffer (3.1 M NH4Cl, 0.2 KHCO3, 20 mM EDTA, pH 7.4) was added to whole blood. Following this, 20% sodium dodecyl sulfate and proteinase K were added and then incubated overnight at 37 °C. The resulting proteins were precipitated with 6 M NaCl. To precipitate DNA, two volumes of 99.5% ethanol was added and then the mixture was washed in 70% ethanol, and dissolved in TE. DNA extracted from each patient was prepared at a concentration of 100 ng/ml DNA. An initial screen of these patients was performed by PCR analysis with a panel of Y chromosome sequence tagged sites (STS) markers recommended by the EAA for AZFb and AZFc (Simoni, 2001; Simoni et al., 2004). For AZFa, the primers are AZFa-proximal 2 and AZFa-distal. Additional deletion analysis was performed using the following Y chromosome markers: for HSFY exon 1, HSFYexon1F1 TAGGCCTTCTGAAGCAGCAT, HSFYexon1R TTTTCAAAAGCTGGTCTTACTGC; HSFY exon 2, HSFYexon2F1 TTGTGTGATGAAAGAGAAATCTGA, HSFYexon2R1 TTGCAGAAATTTTTAGGGTTTTT, sY113/DYS205, sY119/DYS211, sY121/DYS212, sY122/DYS213, sY123/DYS214, G65301
[GenBank]
(within the SMCY gene), sY124/DYS215, sY127/DYS218. Genomic DNA was added to a mixture of 100 mM Tris–CI (pH 8.3), 500 mM KCI, 15 mM MgCI2, 200 mM of dNTP mix, 0.5 mM of each primer pair, 0.2 (l (2 IU) EuroBioTaq DNA polymerase (EuroBio) and adjusted to a final volume of 20 (l. All markers were amplified using the following PCR conditions: –95 °C for 5 min, followed by 35 cycles of 95 °C for 30 s, 55 °C for 30 s and 74 °C for 30 s. A final extension of 72 °C for 10 min was performed in each case. The probe used for Northern blot analysis was prepared using the primers HSFY1F CAGGCCGGAAGAGTAGATAAA, HSFY1R GTCTCTGTTGTCATTCATAAT and included the coding region of the HSFY gene. The PCR amplification conditions are described above.
Each failure of amplification was checked by subsequent PCR analyses using primer pairs and repeated three times with appropriate positive and negative controls to confirm the absence of each STS. Northern blot hybridization was performed on conventional nylon membranes (Clontech Human Multiple Tissue blot II) under standard conditions (Church hybridization medium, 60 °C overnight). The probe used was derived from PCR amplification on testis cDNA (Clontech). Probe labelling with 32PdCTP was carried out using the Megaprime system (Gibco).
|
Results and discussion |
|---|
|
TopAbstractIntroductionPatients and methodsResults and discussionReferences |
|---|
The proximal AZFb region contains two copies of a gene encoding a novel protein with a heat shock factor domain within the P4 palindrome (Figure 1A). Northern blot analysis indicated that the AZFb located HSFY gene copies are expressed specifically in the testis of the human (Figure 1B). Deletions of the entire AZFb region are associated with azoospermia (Krausz et al., 2000
), and since we demonstrated that the HSFY gene is expressed specifically in testis, therefore we considered HSFY a candidate fertility gene. To test this hypothesis, we decided to screen 40 individuals with azoospermia or severe oligozoospermia for deletions of HSFY gene copies using the markers sY113 (DYS205) and sY119 (DYS211), both of which are located in the arms of palindrome P4 immediately adjacent to the HSFY gene copies. All 40 infertile individuals are of Romanian origin and each of them were previously screened for Y chromosome microdeletions using the primers AZFa-proximal 2 and AZFa-distal 1 (AZFa), sY127 and sY134 (AZFb), and sY254 and sY255 (AZFc) and in all cases they were found not to harbour Y microdeletions of the AZFa, AZFb and AZFc regions (Raicu et al., 2003). One azoospermic male was found to be deleted for both Y chromosome-specific markers (sY113 and sY119) in the palindromic arms of P4 in the proximal AZFb region (Figure 1A). We failed to detect this deletion in a control population of 100 fertile men of Romanian origin. In a previous study, we reported the presence of other markers in palindrome P4 (sY114 and sY116) in more than 89 fertile normospermic men indicating that the deletion described here is specifically associated with the infertile phenotype (Krausz et al., 2001). The patient with the proximal AZFb deletion presented with idiopathic azoospermia at 40 years of age (height 1.80 m, weight 74 kg, FSH 12 mIU/ml, normal range 4–8 mIU/ml). A second series of markers in AZFb was used to determine the extent of the deletion in this individual. These data indicated the absence of the HSFY gene and a number of markers distal to it (Figure 1). The deleted region includes the apparently non-coding transcription units TTY9 and TTY14, the Y chromosome open-reading frames CYorf14, CYorf15A and CYorf15B, the pseudogene BCL6 co-repressor-like 2 (BCORL2) and the gene SMCY (also known as JARID1D). BCORL2 is a Y-linked pseudogene of the Xp11.4 located gene BCOR. BCOR can potentiate BCL-6 repression (Huynh et al., 2000). The distal breakpoint was bordered by the markers sY124/DYS215 (deleted) and sY127/DYS218 (present). These markers straddle the proximal and distal boundary of a large block of heterochromatin (DYZ19) that lies within the MSY euchromatin (Skaletsky et al., 2003). Therefore, the distal breakpoint of the deletion lies within or near to the >400 kb of DYZ19. This block of heterochromatin is characterized by >3000 tandem repeats of 125 bp (Skaletsky et al., 2003). The deletion found in the azoospermic male includes only the proximal portion of AZFb. Deletions of the complete AZFb region are associated with azoospermia and gonadal histology consistently reveals spermatogenic arrest at the spermatocyte or spermatid stage (Krausz et al., 2000). Recently, it has been reported that the HSFY gene is expressed in Sertoli cells and germ cells during spermatogenesis and has been proposed as a candidate AZFb fertility gene (Shinka et al., 2004; Tessari et al., 2004). Although the patient described here presented with azoospermia, gonadal histology was not available to determine if he had a phenotype identical to that associated with the complete AZFb deletion. DNA of the father was also unavailable for study, so it is uncertain if the deletion is de novo.
|
The deletion neither include the genes EIF1AY, RPS4Y2 nor copies of the RBMY1 genes (Skaletsky et al., 2003
). A number of RBMY genes are clustered in the AZFb deletion interval and they are related to the gene encoding hnRNPG (RBMX) on the X chromosome (Elliott, 2000; Huynh et al., 2000). Each RBMY gene encodes a protein with an RNA binding motif and interacts with more ubiquitously expressed proteins involved in pre-mRNA splice site selection. Although the RBMY1 gene family has been proposed to be responsible for the AZFb phenotype, this has recently been questioned. A familial case of a deletion of only the distal AZFb region that removed copies of the RBMY1 gene and yet associated with moderate oligozoospermia and fertility was reported (Rolf et al., 2002). We propose that deletions of the testis-specific HSFY gene family may be a cause of other as yet unexplained cases of idiopathic male infertility. This deletion would not have been detected using current protocols for Y chromosome microdeletion screens that are described by the EAA, therefore we recommend that current screening protocols be extended to include this region and other palindrome sequences that contain genes expressed specifically in the testis (Simoni et al., 2004).
|
References |
|---|
|
TopAbstractIntroductionPatients and methodsResults and discussionReferences |
|---|
Blanco P, Shlumukova M, Sargent CA, Jobling MA, Affara N and Hurles M (2000) Divergent outcomes of intrachromosomal recombination on the human Y chromosome: male infertility and recurrent polymorphism. J Med Genet 37, 752–758.
Elliott DJ (2000) RBMY genes and AZFb deletions. J Endocrinol Invest 23, 652–658.[ISI][Medline]
Fernandes S, Paracchini S, Meyer LH, Floridia G, Tyler-Smith C and Vogt PH (2004) A large AZFc deletion removes DAZ3/DAZ4 and nearby genes from men in Y haplogroup N. Am J Hum Genet 74, 180–187.[CrossRef][ISI][Medline]
Huynh KD, Fischle W, Verdin E and Bardwell VJ (2000) BCoR, a novel corepressor involved in BCL-6 repression. Genes Dev 14, 1810–1823.
Jobling MA, Samara V, Pandya A, Fretwell N, Bernasconi B, Mitchell RJ, Gerelsaikhan T, Dashnyam B, Sajantila A, Salo PJ et al. (1996) Recurrent duplication and deletion polymorphisms on the long arm of the Y chromosome in normal males. Hum Mol Genet 5, 1767–1775.
Kamp C, Hirschmann P, Voss H, Huellen K and Vogt PH (2000) Two long homologous retroviral sequence blocks in proximal Yq11 cause AZFa microdeletions as a result of intrachromosomal recombination events. Hum Mol Genet 9, 2563–2572.
Krausz C and Forti G (2000) Clinical aspects of male infertility. Results Probl Cell Differ 28, 1–21.[Medline]
Krausz C, Quintana-Murci L and McElreavey K (2000) Prognostic value of Y deletion analysis: what is the clinical prognostic value of Y chromosome microdeletion analysis? Hum Reprod 15, 1431–1434.
Krausz C, Rajpert-De Meyts E, Frydelund-Larsen L, Quintana-Murci L, McElreavey K and Skakkebaek NE (2001) Double-blind Y chromosome microdeletion analysis in men with known sperm parameters and reproductive hormone profiles: microdeletions are specific for spermatogenic failure. J Clin Endocrinol Metab 86, 2638–2642.
Kuroda-Kawaguchi T, Skaletsky H, Brown LG, Minx PJ, Cordum HS, Waterston RH, Wilson RK, Silber S, Oates R, Rozen S and Page DC (2001) The AZFc region of the Y chromosome features massive palindromes and uniform recurrent deletions in infertile men. Nat Genet 29, 279–286.[CrossRef][ISI][Medline]
McElreavey K, Krausz C and Bishop CE (2000) The human Y chromosome and male infertility. Results Probl Cell Differ 28, 211–232.[Medline]
Raicu F, Popa L, Apostol P, Cimponeriu D, Dan L, Ilinca E, Dracea LL, Marinescu B and Gavrila L (2003) Screening for microdeletions in human Y chromosome–AZF candidate genes and male infertility. J Cell Mol Med 7, 43–48.[ISI][Medline]
Repping S, Skaletsky H, Lange J, Silber S, Van Der Veen F, Oates RD, Page DC and Rozen S (2002) Recombination between palindromes P5 and P1 on the human Y chromosome causes massive deletions and spermatogenic failure. Am J Hum Genet 71, 906–922.[CrossRef][ISI][Medline]
Rolf C, Gromoll J, Simoni M and Nieschlag E (2002) Natural transmission of a partial AZFb deletion of the Y chromosome over three generations: case report. Hum Reprod 17, 2267–2271.
Rozen S, Skaletsky H, Marszalek JD, Minx PJ, Cordum HS, Waterston RH, Wilson RK and Page DC (2003) Abundant gene conversion between arms of palindromes in human and ape Y chromosomes. Nature 423, 873–876.[CrossRef][Medline]
Shinka T, Sato Y, Chen G, Naroda T, Kinoshita K, Unemi Y, Tsuji K, Toida K, Iwamoto T and Nakahori Y (2004) Molecular characterization of heat shock-like factor encoded on the human Y chromosome, and implications for male infertility. Biol Reprod 71, 297–306.
Simoni M (2001) Molecular diagnosis of Y chromosome microdeletions in Europe: state-of-the-art and quality control. Hum Reprod 16, 402–409.
Simoni M, Bakker E and Krausz C (2004) EAA/EMQN best practise guidelines for molecular diagnosis of Y-chromosomal microdeletions. State of the art 2004. Int J Androl 27, 240–249.[CrossRef][ISI][Medline]
Skaletsky H, Kuroda-Kawaguchi T, Minx PJ, Cordum HS, Hillier L, Brown LG, Repping S, Pyntikova T, Ali J, Bieri T et al. (2003) The male-specific region of the human Y chromosome is a mosaic of discrete sequence classes. Nature 423, 825–837.[CrossRef][Medline]
Sun C, Skaletsky H, Rozen S, Gromoll J, Nieschlag E, Oates R and Page DC (2003) Deletion of azoospermia factor a (AZFa) region of human Y chromosome caused by recombination between HERV15 proviruses. Hum Mol Genet 9, 2291–2296.
Tessari A, Salata E, Ferlin A, Bartoloni L, Slongo ML and Foresta C (2004) Characterization of HSFY, a novel AZFb gene on the Y chromosome with a possible role in human spermatogenesis. Mol Hum Reprod 10, 253–258.
Tilford CA, Kuroda-Kawaguchi T, Skaletsky H, Rozen S, Brown LG, Rosenberg M, McPherson JD, Wylie K, Sekhon M, Kucaba TA et al. (2001) A physical map of the human Y chromosome. Nature 409, 943–945.[CrossRef][Medline]
Vogt PH, Edelmann A, Kirsch S, Henegariu O, Hirschmann P, Kiesewetter F, Kohn FM, Schill WB, Farah S, Ramos C et al. (1996) Human Y chromosome azoospermia factors (AZF) mapped to different subregions in Yq11. Hum Mol Genet 5, 933–943.
World Health Organization (1992) WHO Laboratory Manual for the Examination of Human Semen and Sperm–Cervical Mucus Interaction, 3rd edn. Cambridge University Press, Cambridge, UK.
Zhou ZH, Akgun E and Jasin M (2001) Repeat expansion by homologous recombination in the mouse germ line at palindromic sequences. Proc Natl Acad Sci USA 98, 8326–8333.
Submitted on October 18, 2004; accepted on January 7, 2005.
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||