Mol. Hum. Reprod. Advance Access originally published online on August 26, 2005
Molecular Human Reproduction 2005 11(8):607-614; doi:10.1093/molehr/gah214
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility
Department of Paediatrics, Università degli Studi di Padova, via Giustiniani, Padova, Italy
1 To whom correspondence should be addressed at: Department of Paediatrics, Università degli Studi di Padova, via Giustiniani 3, 35128, Padova, Italy. E-mail: squart{at}unipd.it
| Abstract |
|---|
|
|
|---|
Human infertility in relation to mutations affecting the cystic fibrosis transmembrane regulator (CFTR) gene has been investigated by different authors. The role of additional variants, such as the possible forms of the thymidine allele (5T, 7T and 9T) of the acceptor splice site of intron 8, has in some instances been considered. However, a large-scale analysis of the CFTR gene and number of thymidine residues, alone and in combination, in the two sexes had not yet been addressed. This was the aim of this study. Two groups were compared, a control group of 20 532 subjects being screened for perspective reproduction, and the patient group represented by 1854 idiopathically infertile cases. Analyses involved PCR-based CFTR mutations assessment, reverse dot-blot IVS8-T polymorphism analyses, denaturing gradient gel electrophoresis (DGGE) and DNA sequencing. The expected 5T increase in infertile men was predominantly owing to the 5/9 genotypic class. The intrinsic rate of 5T fluctuated only slightly among groups, but some gender-related differences arose when comparing their association. Infertile men showed a significantly enriched 5T + CFTR mutation co-presence, distributed in the 5/9 and 5/7 classes. In contrast, females, from both the control and the infertile groups, showed a trend towards a pronounced reduction of such association. The statistical significance of the difference between expected and observed double occurrence of 5T + CFTR traits in women suggests, in line with other reports in the literature, a possible survival-hampering effect. Moreover, regardless of the 5T status, CFTR mutations appear not to be involved in female infertility. These results underline the importance of (i) assessing large sample populations and (ii) considering separately the two genders, whose genotypically opposite correlations with these phenomena may otherwise tend to mask each other.
Key words: CFTR/infertility/IVS8-T/IVS8-TG
| Introduction |
|---|
|
|
|---|
Infertility, defined as inability of couples to achieve clinically or biochemically (HCG) recognizable pregnancy after at least 12 months of sexual intercourse, occurs in about 15% of the worlds population. In 4050% of the cases, the problem is ascribed to male infertility. In men, the genetic causes account for about 30% (Küpker et al., 1999
Cystic fibrosis (CF) mutations are involved in many forms of obstructive azoospermia: congenital bilateral absence of vas deferens (CBAVD; Chillon et al., 1995
; Jarvi et al., 1995
; Dörk et al., 1997
), congenital unilateral absence of vas deferens (CUAVD; Mickle et al., 1995
; Dörk et al., 1997
); other congenital conditions are also apparently related to mutations of the CF transmembrane regulator (CFTR) gene (Riordan et al., 1989
), such as bilateral ejaculatory duct obstruction (BEDO; Meschede et al., 1997
), epidydimal obstructive azoospermia (Jarvi et al., 1995
). The use of inter- or extragenic marker haplotypes has been recommended to facilitate the screening of mutations (Dörk et al., 1992
).
Infertility in women varies by geographic and social areas (Healy et al., 1994
). Causes include tubal factor (36%), ovulatory disorders (33%), endometriosis (6%) and unclear determinants (40%).
There is a scarcity of statistic data about fertility in women with CF, and it is generally assumed that fertility is reduced in women presenting with this disease, although not as dramatically as in men. Women with CF, unlike men, present an anatomically normal genital tract. CF women are believed to be subfertile mainly because of the presence of thick cervical mucus (Kopito et al., 1973
). Concomitant ovarian cysts are often present (Shawker et al., 1983
). Amenorrhoea and delayed menarche have frequently been observed (Stead et al., 1987
). A CFTR mutation screening is recommended in infertile men bearing CBAVD or CUAVD (Foresta et al., 2002
), and both partners of couples planning pregnancy via assisted reproduction techniques are routinely advised to undergo CFTR mutation tests (Lewis-Jones et al., 2000
). CF is the most common severe autosomic recessive disease in the white population, in which it affects 1 in 2500 newborns (Welsh et al., 1995
). Different CFTR mutation frequencies have been found in the worlds population (Bobadilla et al., 2002
), where more than 1000 alleles have been described (Cystic Fibrosis Genetic Analysis Consortium, 2005
). Other variants have been defined as mild, leading to a less severe clinical disease; these include the 5T allele. The polymorphic locus of the acceptor splice site IVS8-T, within the CFTR gene, can assume three forms: 5T, 7T and 9T, termed after the number of adjacent thymidine residues. The 5T case, leading to higher rates of exon 9 skipping (Chu et al., 1993
), is the most prominent allele found in categories of infertile men, such as those affected by CBAVD (Chillon et al., 1995
; Dörk et al., 1997
; Claustres et al., 2000
) accounting for 12% of the infertile male population (Jecquier et al., 1985
; Mak and Jarvi, 1996
; Okada et al., 1999
).
In this study, we aimed at analysing the frequencies of the different CFTR mutations, those of each allele of the IVS8-T polymorphic locus, and their reciprocal associations, in two groups of subjects, one of which was affected by idiopathic infertility, and the other undergoing the same analyses for preventive screening purposes. Both groups were for the majority represented by couples. As very few studies have so far examined the above mutations and polymorphisms in women, one of the aims of this work was to verify possible sex-related differences in the frequencies at which each of the analysed traits would occur, both alone and in combination. Moreover, as the control group of over 20 000 subjects requesting a preventive screening represents a large sample from the general population, our investigation also addresses the hitherto unexplored proportion of these genetic configurations outside the boundaries of infertility or CF.
| Materials and methods |
|---|
|
|
|---|
Study design
The 5T, 7T and 9T alleles of the IVS8-T polymorphic locus and 48 CFTR mutations were sought by reverse dot blot. The choice of the mutations was made on the basis of their frequency in northeastern Italy, where these represent 90% of all mutations found (Bonizzato et al., 1995
Patients
The henceforth defined infertile group of patients comprised 1854 subjects from northeast Italy (1478 of which belonging to 739 couples, and the remaining 376 being singles), reporting medically assessed infertility, having been sent by gynaecologists, or assisted reproduction centres, to the Paediatrics Department at the University of Padova through the years 19992002. As concerns symptomatically diagnosable CF, all patients were in good health and showed no clinical evidence of CF. None of them reported respiratory tract symptoms, such as childhood pneumonia, repeated sinusitis or bronchitis, and had no relatives with CF.
Parallel data were gathered from a large group of controls comprising 20 532 subjects, from the same geographical origin, who contacted our service voluntarily for a pre-reproductive preventive screening during the years 19972002. As in the infertility patients set, only subjects not reporting CF familiarity were included in the data set used for this analysis.
DNA analyses
DNA was extracted from 200 µl of peripheral blood lymphocytes using the Biorobot Multiprobe® II Packard (Packard Instrument Company, Meriden, CT, USA) and the QIAamp® 96 DNA Blood Biorobot® Qiagen kit (Qiagen GmbH, Hilden, Germany).
CFTR gene alterations were first scored by PCR and reverse dot blot (Chehab and Wall, 1992
), targeted to the detection of the following mutations:
F508, G85E, 541
C, D110H, R117H, 621+1G
T, 711+5G
A, R334W, R334Q, T338I, 1078
T, R347H, R352Q,
I507, 1609
CA, E527G, 17171G
A, 17178G
A, G542X, R347P, S549N, S549R A
C, Q552X, R553X, A559T, D579G, Y577F, E585X, 1898+3A
G, 2183AA
G, R709X, 2789+5G
A, 3132
TG, 327226A
G, L1077P, L1065P, R1070Q, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC
T, G1244E, W1282R, W1282X, N1303K and 4016
T. Primers used for the amplification of exons 3, 4, 5, 7, 9, 10, 11, 12, 13, 14b, 17a, 17b, 18, 19, 20 and 21 (Wall et al., 1995
) and intron 19 (Zielenski et al., 1991
) have been described previously. Each sample of DNA was subjected to four multiplex PCR amplification reactions. PCR conditions were the following: a first denaturation at 95°C for 5 min, 35 cycles with denaturation at 95°C for 30 s, annealing at 62°C for 45 s and extension at 72°C for 45 s, followed by a final 7 min of extension at 72°C. The reaction mixture contained 5 µl of PCR buffer (6.5 mM MgCl2, 65 mM TrisHCl, 17 mM NH4SO3 and 5 µM Biotin), 100 µM dNTPs, 20 pmol of each primer and 1.2 units of Taq polymerase in a final volume of 30 µl containing 50100 ng of DNA. The 5T, 7T and 9T alleles of the polymorphic IVS8-T locus in exon 9 were amplified using the following primers: CATAAAACAAGCATCTATTGAAAAT (forward) and CACTACACCCATACATTCTCCT (reverse).
Membrane-fixed primers were used for the 5T, 7T and 9T alleles and for the 1540A and 1540G polymorphisms, featuring the sequences GTGTGTGTTTTTAACAGG, TGTGTGTTTTTTTAACAGG, TGTGTGTTTTTTTTTAACAG, CTTCTAATGATGATTATGG and CCATAATCACCATTAGAA, respectively.
TGm repeat and phase of TG-T repeats were determined by automated DNA sequencing with an ABI PRISM 310 unit (Applied Biosystems, Foster City, CA, USA).
Rare mutations were sought by denaturing gradient gel electrophoresis (DGGE) (Costes et al., 1993
), and abnormal migration was confirmed by automated DNA sequencing.
Statistical analyses
Differences in proportions of mutations or alleles among group pairs were compared by chi-square contingency tests and by z-test proportion analysis, both with Yates continuity correction and by two-tailed Fisher exact test. Only P values below 0.05 were considered statistically significant.
| Results |
|---|
|
|
|---|
Frequency of CFTR mutations and of the 5T allele
The frequencies of CFTR mutations and of the 5T allele data are summarized in Table I. The two groups under study are compared, reporting the number of cases carrying at least one of the different CFTR mutations identified, along with those bearing at least one of the three possible 5T genotypes, namely 5/5 or 5/7 or 5/9. The last column lists the number of cases displaying the combination of the two above traits. Concerning the presence of a 5T allele, similar values are observed between the infertile cohort and its control group represented by the couples walking in voluntarily for a preventive screening. The CFTR mutations show a slight increase in the infertile group. But looking at each sex separately, one notices that the increase is solely because of a male contribution. Infertile women appear not to be enriched at all as regards CFTR mutations. This difference between male and female in terms of CFTR mutant genotypes will be better appreciated upon comparing the total number of mutations identified in each gender (Table II) which unmasks a statistically significant difference. Coming to the comparison of the double occurrence of both 5T allele and a CFTR mutation, two trends arise: (i) there is an increase in the infertile group (from 0.23 to 0.75%) and (ii) there is an opposite trend between male and female subjects. The significance of these data will be thoroughly weighed in the Discussion.
|
|
Distribution analysis of the different CFTR mutations
Table II compiles the partition of mutations found in the 1854 patients of the infertile group, along with the corresponding IVS8-T genotype. The number of patients carrying mutations is 85, whereas the total number of instances of mutation is 89 as four of these patients carried two different mutations. Two of these had been already reported as CBAVD-affected by their physicians (Table III). The kinds of different mutations identified are 20; the dominant case being, as expected,
F508 whose allele frequency is of 0.81% in women and 1.49% in men (16 cases over 1974 chromosomes and 26 cases over 1734 chromosomes, respectively). The percentage of carriers of this mutation in each sex is 1.62 of the female and 2.99 of the male subjects. The total number of mutations observed in women is 36, a figure statistically different (P = 0.018) from the value of 53 recorded for men. As regards other mutations, (among over 1000 described in the literature) not included in the 90% most frequent ones in northeast Italy, we limited our analysis, for the strict sake of disease prevention, to those couples in which one partner had tested positive to either 5T or one CFTR mutation. In that case, the DNA from the other partner was analysed by DGGE followed by nucleotide sequencing of cases showing abnormal migration. This test involved nine subjects from the infertile group, revealing the occurrence of the following rare mutations: E217G, T1054A, W356X, D443Y and 3667insTC in males and L997F and R297Q in females and 29 subjects from the control, in which we found: A1009T, D110Y, E826K, G1069R, G1130A, G194V, I556V, L320F, M348K, M82V, P1290T, R117C, R352W, R74W, S42F, S660T, S911R, S912L, T1086A, T582S, V920L and Y89C. All these rare mutations, having been sought only in one partner, and only in the appropriate cases, are not included in the data discussed in Tables I, II and IV.
|
|
Finally, as regards the mutations found in women of the control group, who bore 5T and a CFTR mutation, these 15 subjects presented eight cases of
F508 and single instances of the following: R117H, G542X, W1282X, R1162X, N1303K, 2183 aa/g and D1152H. The severity of these mutations, with the exception of the last case, is considered high. Concerning instead the mutations found in the male group, besides
F508 the following have been found: 2789+5 g/a, 711+5 g/a, D1152H, G85E, N1303K, Q552X, R1158X, R117H, R334Q, R334W and R553X. Although the phase has not been experimentally assessed, according to our statistical records, all these mutations are normally found in trans with respect of 5T.
IVS8-T polymorphism
According to the literature, different ratios of the IVS8-T genotype would be expected when comparing control and infertile patients as a result of an increase of the 5T allele in the latter (Chillon et al., 1995
; Dörk et al., 1997
; Claustres et al., 2000
).
Table V summarizes the distribution of the IVS8-T genotypes in the two groups. Among a generally stable picture, the relevant changes appear to be relative to the 5/9 class that doubles its frequency in the infertile male, and the 9/9 that conversely drops to about one third in the same group.
|
Mutation frequency with respect to the IVS8-T genotypic class
The results of this analysis, aimed at evaluating in which of the different 5T classes do CFTR mutations vary in relation to fertility and gender, are summarized in Table IV. Infertile males have a more than triple rate of CFTR mutation frequency in the 5/9 class, passing from 17.89 to 68.75%, and a lesser increase in the class 5/7 (from 2.71 to 4.08%).
Distribution of the IVS8-(TG)m, IVS8-(T)n and 1540A/G genotypes
On a subsample of the 5T carriers, including 125 patients from the infertile group (equal to 94% of the 5T carriers found) and a comparable number (131) randomly chosen among the 5T carriers of the preventive screening population, we also determined the distribution of the (TG)m polymorphism. Data are summarized in Table VI. In the infertile group, we noticed only a slight increase of 5T-TG12(TG13) haplotype frequency over the total number of 5T chromosomes (including the 5/5 configuration). These combinations in the infertile group were at a frequency of 38.81 in women and 32.79 in men versus values of 35.38 and 30.12, respectively, in the control group.
|
Overall, the most frequent genotypic combinations were the 12/11TG-5/7T1540GG and 11/11TG-5/7T1540AG in both the infertile and control groups. The abundance of these genotypes was higher for infertile women that carry these combinations at a frequency of 21.54 and 38.46%, respectively (versus 16.39 and 27.87% in the preventive screening group), whereas men in the same group scored 11.67 and 21.67% [versus 11.43 and 21.43% in the corresponding control (data not shown)].
| Discussion |
|---|
|
|
|---|
First, it should be underlined that this study, taking into account more than 20 000 subjects in the control group and over 1800 in the infertile situation, constitutes a very large screening among the available literature. A second relevant premise is the even distribution of male and female subjects in both groups allowed a balanced comparison of gender-related phenomena.
When evaluating the results in the infertile group, one must also consider that genotypic correlations are in part underestimated being the subjects mostly represented by couples, in the majority of which only one of the two partners is responsible of the infertility.
From these data however, one major point arising is the importance of considering separately male and female subjects. Upon splitting our results by gender, we could define the net differences existing between the two groups. The 5T + CFTR mutation increase shown by the infertile group is all due to a male contribution, who display a more than three-fold increase in frequency (from 0.33 to 1.50%, and the difference does remain significant also if the two CBAVD cases are removed from the count), whereas the female subjects show a decrease from an already low value (from 0.14 to 0.10%).
Indeed regardless of the group, preventive screening control or infertile couples, the female subjects reveal a generalized low value of co-presence for the two traits. This discrepancy will be better analysed by calculating the theoretical likelihood of the double occurrence as further summarized in Table I. Column 3 expresses the frequency of subjects carrying at least one 5T allele. As stated, no correlation between idiopathic infertility and 5T itself appears. Both in the preventive screening population and in the one with ascertained infertility problems, the occurrence of a 5T allele is around 7%, whereas at the same time the chance of a CFTR mutation is 3.83 or 4.58%, respectively. In considering the effect of the two conditions together, we have introduced, in the role of a null hypothesis, the theoretical value shown in the fourth column. If the two traits, 5T and CFTR mutation were completely independent in their assembling, the likelihood of finding a double occurrence would be simply given by the mathematical product of each of the frequencies. This turns out to be the case for the control group, which is assumed to closely represent the general population (0.23% versus a predicted 0.29%). If a correlation exists between the two variables, the fact of belonging to one group or the other of the patients, would affect the outcome, leading to a difference in the observed result shown in column 6. This was indeed the case for the infertile males, showing a positive correlation, and for the females of both groups shown indicating a negative correlation. This is essentially represented by the comparison of the two figures (0.14 versus 0.28%). Likewise, there is a pronounced gap between the male and female subjects carrying CFTR and 5T in both the control and infertile group. It appears therefore that at least 50% of the genetic configurations presenting a CFTR mutation and a 5T allele might be either lethal or conducive of a condition that would keep a woman off from addressing reproductive diagnostics.
The above results also indicate that, in women, neither CFTR mutations nor 5T are more represented in infertile conditions and that, unlike in men, the concomitance of both is not linked to infertility. Furthermore, Table II highlights the large difference emerging between male and female infertile subjects in the number of CFTR mutations per subject (6.11 versus 3.65%). This discrepancy, occurring regardless of the 5T status, suggests a gender-related different involvement of the CFTR gene in infertility. In this case however, if the five cases of CBAVD are subtracted from the infertile males, the difference is no longer statistically significant.
Hints on a sex-related difference in the mortality of CF patients can be found in the literature. It was shown that two thirds of patients who died from CF consequences before age 24 were females, whereas the same sex accounted for about only one third of those who died at an older age (Kerem et al., 1992
). A different study reports that, after adjustment for all potential explanatory variables in CF mortality, females between 1 and 20 years of age are 60% more likely to die than males, whereas, outside this age range, male and female survival rates are not significantly different (Rosenfeld et al., 1997
). Causes include worse pulmonary functionality and susceptibility to earlier colonization by Pseudomonas aeruginosa in CF women between 6 and 15 years of age. Another investigation further emphasizes the earlier occurrence of P. aeruginosa infection in women (Demko et al., 1995
). Macek et al. (1997)
recorded very different ratios for the 5' polymorphisms of the CFTR gene when considering groups of apparently healthy females over 75, compared with newborns and young cohorts, and postulated the association of a defined allelic status with postnatal female survival. Other papers also confirm the association between female gender and higher risk of death (Fogarty et al., 2000
; OConnor et al., 2002
; Stallings, 2003
). A further link involves nitric oxide, whose production is higher in males (Tsang et al., 2001
), and it is generally reduced in CF patients (Grasemann et al., 1997
). Women with several repeats show further reduction in their nitric oxide production, whereas men are unaffected (Grasemann et al., 2003
); therefore, authors postulated a survivor effect implying that women with higher nitric oxide levels would succumb at earlier stages (Accurso and Sontag, 2003
). In the light of these data, it can be commented that our observed reduction in the expected number of women carrying CFTR mutations and 5T, among couples aiming at reproduction, could be, in part, caused by the fact that a proportion of them, higher than that of their male counterparts, has been selected out before reaching reproductive age. However, as manifest CF affects on average 0.04% of the population, its sole contribute cannot be responsible for major effects in negatively selecting the subjects of this study. The presence of the 5T allele in homozygosity, or in compound heterozygosity, does not necessarily translate in men infertility, the outcome depending on the genotype of other loci; this observation has led to the definition of the 5T allele as mutation with partial penetrance (Chillon et al., 1995
; Zielenski et al., 1995
). Alternatively, the observation of other polymorphic loci involved in the modulation of CFTR expression, as the TGm repeat and M470V (1540A/G), that can display either adenine or guanine in position 1540, has led to suggestions that the combination of these alleles can be sufficient to determine the pathogenity of the 5T allele (Cuppens et al., 1998
; de Meeus et al., 1998
; Niksic et al., 1999
; Noone et al., 2000
; Groman et al., 2004
).
Studies on the M470V status (data not shown) in the 15 females from the control as well as in the single case found in the infertile group, presenting 5T and a CFTR mutation indicated an absence of the GG genotype, whose expected frequency was around 20%, and an underrepresentation of the 5/7 11/11 AG genotype, limited to 15.3%, versus the 27.87% expected as calculated from the 61 cases analysed for the IVS8 genotypes in Table VI. Several studies indicate that genes other than CFTR and environmental factors can modify the phenotypic consequences of CF genotypes. CF patients that present identical double CFTR mutations can show different clinical outcomes. The degree of lung deterioration and the susceptibility to P. aeruginosa infections seem to depend on different genes indicated as modifier genes (reviewed in Acton and Wilmott, 2001
).
The observed frequency differences between male and female subjects call for the evaluation of one main aspect related to both infertility and CFTR gene, which is moreover exclusive of the masculine gender: the aforementioned congenital absence of deferent ducts (CBAVD). This syndrome is estimated to affect 1/1000 males in the general population and to represent 12% of the causes of infertility (Jecquier et al., 1985
; Mak and Jarvi, 1996
; Okada et al., 1999
).
In our study, seven CBAVD cases were reported within the 867 infertile men, and their distribution was as follows: one carrying 5T without CFTR mutations, two carrying 5T and CFTR mutations, three with CFTR mutations without 5T and one in the remaining group of 764 patients with other genotypes. These figures regard the main set of data presented in Tables I and II, i.e. the groups in which the CFTR mutation analyses routinely involved mutations representing the 90% most frequent in our study area. To this, we can add also three extra CBAVD cases that concern patients in which rare mutations were detected by DGGE, and these three patients present also the 5/7 genotype.
Coming to the analysis of relative CFTR mutations (Table II), we noticed against our expectations, an underrepresentation of
F508 in women. In this respect, it is also worth remarking that, in male subjects, 11 cases over 24 carrying
F508 belong to the 5/9 genotype whereas all the female cases fell either into the 7/9 or into the 9/9 classes. This further points in favour of the above discussed apparent intolerance of 5T and CFTR mutation co-presence in women. Indeed on 36 female cases carrying mutations, only one had a 5T allele (5/7 associated with mutation 3849+10Kb), whereas in male subjects the proportion is 13 of 49.
Data on the IVS8-T polymorphism frequencies were compiled both on the whole groups (Table V) and on the subgroups of CFTR mutation carriers (Table IV). As regards the first set of data, these showed that the 5/9 assemblage displayed doubled frequencies in infertile males.
The 5T allele frequency for each group is also shown (this is not merely the doubling of carrier frequency values in seen in Table I because, in a minority of the subjects, both chromosomal alleles did present the 5T condition). The already discussed general reduction of the CFTR-mutated 5T female carriers of both control and infertile groups can be further seen in Table IV. Infertile males showed a more pronounced increase of CFTR mutation frequency in 5/9 class (from 17.89 to 68.75%), indicating that in more than half of the cases carrying this genotype, one finds a CFTR mutation. The infertile males show also an increase in the class 5/7. As regards the increase in the 5/9 class, it was consistently with the preferential occurrence of the
F508 on the 9T chromosome. The demise of female subjects against probabilistic expectations and in total opposition to male trends is further dissected by these data, whereas for the control classes of the 7/7, 7/9 and 9/9 genotypes, male and female frequencies are quite comparable, in the 5/7 and 5/9 classes, the females are cut down to less than half the male values.
As regards TG repeats, we noticed the abovementioned slight increase of the 5T-TG12(TG13) haplotype. As these genotypes are conducive of CBAVD or CUAVD in male subjects, and as these syndromes account for a mere 12% of the infertility causes (Jecquier et al., 1985
; Okada et al., 1999
), the limited difference observed is in line with the predictable proportions.
A further worth-mentioning aspect is the occurrence of 5T cases associated with TG10, which, to our knowledge, has not been observed (data not shown).
In conclusion, many gender-specific differences arise from these data; one main aspect is that infertile men display an almost double rate of CFTR mutations per subject compared with infertile women, mostly because of CBAVD. As regards the genotypic coupling of CFTR mutations with the 5T allelic condition, this also unfolds in a gender-dependent fashion. In subjects belonging to infertile ranks, such differences are enhanced, mostly as a consequence of the male sex enrichment. Female counts point towards the opposite direction, including those within the large control cohort representative of the general population. To verify the consistency of this trend, it would be advisable that prenatal screening services recommend paediatricians to follow the conditions and the development of female children from healthy couples in which one parent carries a 5T allele (occurring in more than 7% of the general population) and the other a mutation in the CFTR gene (occurring in about 4% of the general population). Nonetheless, any child with the co-presence of a CF mutation and the 5T allele is at risk for a phenotype ranging from normal to CF and will need to be closely followed for related signs and symptoms. It can be added that in current routine services, the result of the IVS8T polymorphism is normally communicated only to patients tested for infertility-related analyses. We would recommend in this respect an increased level of attention and communication between genetic analysis services, patients and paediatricians. All these practices could concur to implement disease-preventing measures offered by pre-reproductive diagnostics.
| Acknowledgements |
|---|
This research was funded by the Veneto Regional Center for Rare Diseases, through a grant for the development of diagnostic tests on cystic fibrosis. The authors thank Katia Pettenò, Rossella Zordan and Caterina Perto for skillful assistance, and Stefania Boni for specimen collection from infertile patients. We thank Antonio Baldini for critically reading the manuscript. Andrea Squartini is gratefully acknowledged for contributing to the interpretation and discussion of the findings reported in this work.
| References |
|---|
|
|
|---|
Accurso FJ and Sontag MK (2003) Seeking modifier genes in cystic fibrosis. Am J Respir Crit Care Med 167,289290.
Acton JD and Wilmott RW (2001) Phenotype of CF and the effects of possible modifier genes. Paediatr Respir Rev 2,332339.[CrossRef][Medline]
Bobadilla JL, Macek M Jr, Fine JP and Farrell PM (2002) Cystic fibrosis: a worldwide analysis of CFTR mutations-correlation with incidence data and application to screening. Hum Mutat 19,575606.[CrossRef][Web of Science][Medline]
Bonizzato A, Bisceglia L, Marigo C, Nicolis E, Bombieri C, Castellani C, Borgo G, Zelante L, Mastella G, Cabrini G et al. (1995) Analysis of the complete coding region of the CFTR gene in a cohort of CF patients from North East Italy: identification of 90% of the mutations. Hum Genet 95,397402.[Web of Science][Medline]
Chehab FF and Wall J (1992) Detection of multiple cystic fibrosis mutations by reverse dot blot hybridization: a technology for carrier screening. Hum Genet 89,163168.[Web of Science][Medline]
Chillon M, Casals T, Mercier B, Bassas L, Lissens W, Silber S, Romey M-C, Ruiz-Romero J, Verlingue C, Claustres M et al. (1995) Mutations in the cystic fibrosis gene in patients with congenital absence of the vas deferens. N Engl J Med 332,14751480.
Chu CS, Trapnell BC, Curristin SM, Cutting GR and Crystal RG (1993) Genetic basis of variable exon skipping in cystic fibrosis transmembrane conductance regulator mRNA. Nat Genet 3,151156.[CrossRef][Web of Science][Medline]
Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G et al. (2000) Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France. Hum Mutat 16,143156.[CrossRef][Web of Science][Medline]
Costes B, Fanen P, Goossens M and Ghanem (1993) A rapid, efficient, and sensitive assay for simultaneous detection of multiple cystic fibrosis mutations. Hum Mutat 2,185191.[CrossRef][Web of Science][Medline]
Cuppens H, Lin W, Jaspers M, Costes B, Teng H, Vankeerberghen A, Jorissen M, Droogmans G, Reynaert I, Goossens M et al. (1998) Polyvariant mutant cystic fibrosis transmembrane conductance regulator genes. The polymorphic (TG)m locus explains the partial penetrance of the T5 polymorphism as a disease mutation. J Clin Invest 101,487496.[Web of Science][Medline]
Cystic Fibrosis Genetic Analysis Consortium (2005) Available from http://www.genet.sickkids.on.ca/cftr/
Demko CA, Byard PJ and Davis PB (1995) Gender differences in cystic fibrosis: Pseudomonas aeruginosa infection. J Clin Epidemiol 48,10411049.
de Meeus A, Guittard C, Desgeorges M, Carles S, Demaille J and Claustres M (1998) Linkage disequilibrium between the M470V variant and the IVS8 polyT alleles of the CFTR gene in CBAVD. J Med Genet 35,594596.
Dörk T, Neumann T, Wulbrand U, Wulf B, Kälin N, Maaß G, Krawczak M, Guillermit H, Ferec C and Horn G (1992) Intra- and extragenic marker haplotypes of CFTR mutations in cystic fibrosis families. Hum Genet 88,417425.[CrossRef][Web of Science][Medline]
Dörk T, Dworniczak B, Aulehla-Sholz C, Wieczorek D, Bohm I, Mayerova A, Seydewitz HH, Nieschlag E, Meschede D, Horst J et al. (1997) Distinct spectrum of CFTR gene mutations in congenital absence of vas deferens. Hum Genet 100,365377.[CrossRef][Web of Science][Medline]
Fogarty A, Hubbard R and Britton J (2000) International comparison of median age at death from cystic fibrosis. Chest 117,16561660.
Foresta C, Ferlin A, Gianaroli L and Dallapiccola B (2002) Guidelines for the appropriate use of genetic tests in infertile couples. Eur J Hum Genet 10,303312.[CrossRef][Web of Science][Medline]
Grasemann H, Michler E, Wallot M and Ratjen F (1997) Decreased concentration of exhaled nitric oxide (NO) in patients with cystic fibrosis. Pediatr Pulmonol 24,173177.[CrossRef][Web of Science][Medline]
Grasemann H, vans Gravesande KS, Büsher R, Drazen JM and Ratjen F (2003) Effects of sex and of gene variants in constitutive nitric oxide synthases on exhaled nitric oxide. Am J Respir Crit Care Med 167,11131116.
Groman JD, Hefferon TW, Casals T, Bassas L, Estivill X, Des Georges M, Guittard C, Koudova M, Fallin MD, Nemeth K et al. (2004) Variation in a repeat sequence determines whether a common variant of the cystic fibrosis transmembrane conductance regulator gene is pathogenic or benign. Am J Hum Genet 74,176179.[CrossRef][Web of Science][Medline]
Healy DL, Trounson AO and Andersen AN (1994) Female infertility: causes and treatment. Lancet 343,15391544.[CrossRef][Web of Science][Medline]
Jarvi K, Zielenski J, Wilschanski M, Durie P, Buckspan M, Tullis E, Markiewicz D and Tsui L-C (1995) Cystic fibrosis transmembrane conductance regulator and obstructive azoospermia. Lancet 345,1578.
Jecquier AM, Ansell ID and Bullimore NJ (1985) Congenital absence of the vasa deferentia presenting with infertility. J Androl 6,1519.
Kerem E, Reisman J, Corey M, Canny GJ and Levison H (1992) Prediction of mortality in patients with cystic fibrosis. N Engl J Med 326,11871191.[Abstract]
Kopito LE, Kosasky HJ and Shwachman H (1973) Water and electrolytes in cervical mucus from patients with cystic fibrosis. Fertil Steril 24,512516.[Web of Science][Medline]
Küpker W, Schwinger E, Hiort O, Ludwig M, Nikolettos N and Schlegel Diedrich K (1999) Genetic of male infertility: consequences for the clinical workup. Hum Reprod 14,2437.
Lewis-Jones DI, Gazvani MR and Mountford R (2000) Cystic fibrosis in infertility: screening before assisted reproduction: opinion. Hum Reprod 15,24152417.
Macek M Jr, Macek M Sr, Krebsova A, Nash E, Hamosh A, Reis A, Varon-Mateeva R, Schmidtke J, Maestri NE, Sperling K et al. (1997) Possible association of the allele status of the CS.7/HhaI polymorphysm 5" of the CFTR gene with postnatal female survival. Hum Genet 99,565572.[CrossRef][Web of Science][Medline]
Mak V and Jarvi KA (1996) The genetics of male infertility. J Urol 156,12451257.[CrossRef][Web of Science][Medline]
Meschede D, Dworniczak B, Behre HM, Kliesch S, Claustres M, Nieschlag E and Horst J (1997) CFTR gene mutations in men with bilateral ejaculatory-duct obstruction and anomalies of the seminal vescicles. Am J Hum Genet 61,12001202.[CrossRef][Web of Science][Medline]
Mickle J, Milunsky A, Amos JA and Oates RD (1995) Congenital unilateral absence of the vas deferens: a heterogeneous disorder with two distinct subpopulations based upon aetiology and mutational status of the cystic fibrosis gene. Hum Reprod 10,17281735.
Niksic M, Romano M, Buratti E, Pagani F and Baralle FE (1999) Functional analysis of cis-acting elements regulating the alternative splicing of human CFTR exon 9. Hum Mol Genet 8,23392349.
Noone PG, Pue CA, Zhou Z, Friedman KJ, Wakeling EL, Ganeshanathan M, Simon RH, Silverman LM and Knowles MR (2000) Lung disease associated with the IVS8 5T allele of the CFTR gene. Am J Respir Crit Care Med 162,19191924.
OConnor GT, Quinton HB, Kahn R, Robichaud P, Maddock J, Lever T, Detzer M and Brooks JG (2002) Case-mix adjustment for evaluation of mortality in cystic fibrosis. Pediatr Pulmonol 33,99105.[CrossRef][Web of Science][Medline]
Okada H, Yoshimura K, Fujioka H, Tatsumi N, Gotoh A, Fujisawa M, Gohji K, Arakawa S, Kato H, Kobayashi S-I et al. (1999) Assisted reproduction technology for patients with congenital bilateral absence of vas deferens. J Urol 161,11571162.[CrossRef][Web of Science][Medline]
Rendine S, Calafell F, Cappello N, Gagliardini R, Caramia G, Rigillo N and Silvetti M (1997) Genetic history of cystic fibrosis mutations in Italy. I. Regional distribution. Ann Hum Genet 61,411424.[CrossRef][Web of Science][Medline]
Riordan JR, Rommens JM, Kerem B-S, Alon N, Rozmahel R, Grzelczak Z, Zielenski J, Lok S, Plavsic N, Chou J-L et al. (1989) Identification of the cystic fibrosis gene: cloning and characterization of complementary DNA. Science 245,10661072.
Rosenfeld M, Davis R, FitzSimmons S, Pepe M and Ramsey B (1997) Gender gap in cystic fibrosis mortality. Am J Epidemiol 145,794803.
Shawker RH, Hubbard VS, Reichert CM and Guerreiro De Matox OM (1983) Cystic ovaries in cystic fibrosis: an ultrasound and autopsy study. J Ultrasound Med 2,439444.[Abstract]
Sokol RZ (2001) Infertility in men with cystic fibrosis. Curr Opin Pulm Med 7,421426.[CrossRef][Medline]
Stallings VA (2003) Gender, death and cystic fibrosis: is energy expenditure a component? J Pediatr 142,4146.[CrossRef][Web of Science][Medline]
tead RJ, Hodson ME, Batten JC, Adams J and Jacobs HS (1987) Amenorrhoea in cystic fibrosis. Clin Endocrinol (Oxf) 26,187195.[Medline]
Tsang KW, Ip SK, Leung R, Tipoe GL, Chan SL, Shum IH, Ip MS, Yan C, Fung PC, Chan-Yeung M et al. (2001) Exhaled nitric oxide: the effects of age, gender and body size. Lung 179,8391.[CrossRef][Web of Science][Medline]
Wall J, Shiping C and Chehab FF (1995) A 31 mutation assay for cystic fibrosis testing in the clinical molecular diagnostics laboratory. Hum Mutat 5,333338.[CrossRef][Web of Science][Medline]
Welsh MJ, Tsui L-C, Boat TF and Beaudet AL (1995) Cystic fibrosis. In Scriver CR, Beaudet AL, Sly WS and Valle D (eds), The Metabolic and Molecular Bases of Inherited Disease. McGraw-Hill, New York, pp. 37993876.
Zielenski J, Rozmahel R, Bozon D, Kerem B-S, Grzelczak Z, Riordan JR, Rommens J and Tsui L-C (1991) Genomic DNA sequence of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Genomics 10,214228.[CrossRef][Web of Science][Medline]
Zielenski J, Patrizio P, Corey M, Handelin B, Markiewicz D, Asch R and Tsui L-C (1995) CFTR gene variant for patients with congenital absence of vas deferens. Am J Hum Genet 57,958960.[Web of Science][Medline]
Submitted on March 24, 2005; resubmitted on July 8, 2005; accepted on July 19, 2005.
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||