Mol. Hum. Reprod. Advance Access originally published online on March 1, 2006
Molecular Human Reproduction 2006 12(2):113-121; doi:10.1093/molehr/gal012
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tandem duplication and copy number polymorphism of the SRY gene in patients with sex chromosome anomalies and males exposed to natural background radiation
1Molecular Genetics Laboratory, National Institute of Immunology, Aruna Asaf Ali Marg, New Delhi, India and 2JN Medical College, Aligarh Muslim University, Aligarh, India
3 To whom correspondence should be addressed at: Molecular Genetics Laboratory, National Institute of Immunology, Aruna Asaf Ali Marg, New Delhi 110067, India. E-mail: alisher{at}nii.res.in/sheralib5{at}hotmail.com
| Abstract |
|---|
|
|
|---|
Mutations in the SRY gene encompassing the HMG box have been well characterized in gonadal dysgenesis, male infertility and other types of sex chromosome related anomalies (SCRA). However, no information is available on copy number status of this gene under such abnormal conditions. Employing Taqman Probe Assay specific to the SRY gene, we screened 16 DNA samples from patients with SCRA and 36 samples from males exposed to high levels of natural background radiation (HNBR). Patients with SCRA showed 216 copies of the SRY gene of which, one, Oxen (49, XYYYY) had eight copies with sequences different from one another. Of the 36 HNBR samples, 12 had one copy whereas 24 harboured 28 copies of the SRY gene. A HNBR male 33F had one normal and one mutated copy of this gene. Analysis of 25 DNA samples from blood and semen of normal males showed only one copy of this gene. Despite multiple copies in affected males, fluorescence in-situ hybridization (FISH) with SRY probe detected a single signal on the Y chromosome in HNBR males suggesting its possible localized tandem duplication. Copy number status of the other Y-linked loci is envisaged to augment DNA diagnostics facilitating genetic counselling to affected patients.
Key words: background radiations/copy number polymorphism (CNP)/endoreduplication/human Y chromosome/non-disjunction/tandem duplication
| Introduction |
|---|
|
|
|---|
SRY gene located on p11.3 region of the Y chromosome encodes a transcription factor that belongs to the HMG DNA-binding proteins and plays a dominant role in mammalian male sex determination (Gubbay et al., 1990
Analysis of the SRY gene in gonadal dysgenesis, altered karyotypes (e.g. X/XYY), polysomy of the Y chromosome (Sirota et al., 1981
) and XY females (Takagi et al., 1999
) has shown mutations either within or up/down stream regions of the HMG box. Patients with XY gonadal dysgenesis carry point mutations in the SRY gene which affect its binding or bending properties (Hawkins et al., 1992
). In humans, the SRY gene is reported to be single copy and haploid, whereas in some rodents it is present in one or more, monomorphic or polymorphic forms (Lundrigen and Tucker, 1997
). Previously, owing to limitations in the power of detection, it was not feasible to assess copy number status of a gene and correlate the same with genetic anomalies. Real-time PCR enables detection of even a trace amount of DNA (low copy number) and minute differences between the two samples (copy number differences). Despite multiple copies of the Y chromosomes in patients, there is no report on copy number polymorphism (CNP) of the SRY gene and its biological consequence. Here, we report CNP of the SRY gene in patients suffering from sex chromosome related anomalies (SCRA) and males exposed to high levels of natural background radiation (HNBR) from Kerala, (South India) using real-time PCR assays.
The rationale to include HNBR samples is based on the fact that cancers, chromosomal lesions (Cheriyan et al., 1999
) and mutations in the minisatellites and other regions of the genome are induced by the background radiation but its effect on the human Y chromosome has not yet been studied. Long term exposure to ionizing radiation leaves a permanent impression on the genome or on a given chromosome (Hande et al., 2003
). In humans, long-term experimental irradiation and mutational analysis across the generations are impractical and unethical. In view of this, we used samples from a population living in the coastal region of Kerala that offers a natural setting of high background radiation.
In order to establish if the copy number status of the SRY gene is related to its organization on the Y chromosome, we conducted fluorescence in-situ hybridization (FISH) on the metaphase chromosomes of the HNBR males. FISH data showed a single signal of the SRY gene suggesting its localized tandem duplication. Our study demonstrates that human Y chromosome is indeed affected by HNBR showing CNP analogous to that of patients with SCRA. This work is envisaged to augment DNA diagnostics and genetic counselling.
| Materials and Methods |
|---|
|
|
|---|
Collection of blood and semen samples and genomic DNA isolation
Samples were collected with informed consent from 25 normal males (15 blood and 10 semen samples), 16 SCRA patients and four normal females (negative control) from J N Medical College, Aligarh, India, strictly in accordance with the Institutes Ethical and Bio-safety Guidelines. In addition, blood and semen samples of 36 males belonging to 23 families exposed to HNBR (Chavara) and 16 samples (blood and semen each from eight males) living in non-radiation exposed area (Kochi) from Kerala were obtained with their informed consent. The coastal area of Kerala contains the worlds highest levels of natural radioactivity which is due to local abundance of monazite, a mineral containing around 10% thorium phosphate. The radioactivity strip measures an area of only 10 km by 1 km and supports a population of several thousands, whose traditional occupation is fishing (Gruneberg et al., 1966
Primers, Taqman probes and conditions for real-time PCR
For real-time PCR, Assay on Demand specific to SRY gene (ID: Hs00243216_s1, nucleotide location 453) and an endogenous control, RNase P gene (single copy per haploid genome; Catalog number: 4316831) having FAM/TAMRA and FAM/MGB probes, respectively, procured from Applied Biosystem, USA, were used. For the reaction, DNA dilution was adjusted to 5 ng/µl. The universal cyclic conditions for real-time PCR comprised 10 minutes of polymerase activation at 95°C followed by 40 cycles, each at 95°C for 15 seconds and 60°C for 1 minute. The reaction was conducted on Sequence Detection System 7000 (ABI, USA). Taking triplicates of each sample, every assay was repeated at least five times to ensure error-free consistent Ct values (error rate ±0.05).
Copy number estimation of the SRY gene
Copies of the SRY gene were calculated using the formula: copy number = (1 + E)
Ct, where E is the efficiency of the PCR,
Ct difference in threshold cycle value between the test sample and endogenous control. To achieve the maximum efficiency (one) of the real-time PCR, the amplicon size was kept small (5070 bp) so that copy number of the test gene remains 2
Ct.
End point PCR of the SRY gene, agarose gel electrophoresis, cloning and sequencing
SRY gene fragment was amplified from genomic DNA using a set of forward 59GACAATGCAATCATATGCTTCTGC39 and reverse 59CTGTAGCG GTCCCGTTGCTGCGGT39 primers (Bashamboo et al., 2005
) in a 25 µl reaction volume containing Taq Polymerase, 10 X PCR buffer (Promega, Madison, WI, USA), 200 µM dNTPs and 100 ng of target DNA. The reaction was conducted for a total of 30 cycles, each involving denaturation of the template at 95°C for 1 minute, annealing of the primers at 65°C for 1 minute and extension of the same at 72°C for 1 minute. The amplified products resolved on 1.5% agarose gel were purified (QIAGEN Gel Extraction Kit) and cloned in pGEM-T easy vector (Promega, Madison, WI, USA). Twenty recombinant plasmids containing SRY insert from Oxen and ten from HNBR male 33F were sequenced. Distinctly different sequences of the eight independent clones (pSOx1-pSOx8) from Oxen (Accession number: AY998484
[GenBank]
-AY998491), two (pS33F3 and pS33F13) from 33F male (Accession no. DQ062157
[GenBank]
and DQ062158
[GenBank]
), respectively, were deposited in the GenBank. For confirmation of the point mutations, direct sequencing of PCR product was also done.
FISH
Blood from HNBR-exposed males, unexposed males and females was used for chromosome preparation using the standard protocol (Bashamboo et al., 2005
). FISH was conducted using dual colour LSI SRY probe from VYSIS (Part # 32191007). This probe hybridizes simultaneously to band Yp11.3 of the human Y chromosome and Xp11.1-q11.1 locus of the human X chromosome. Hybridization, washing, counterstaining, and mounting of the slides were done using the standard protocol (Rahman et al., 2004
). Slides were screened under the Olympus Fluorescence microscope (BX51) fitted with a vertical fluorescence illuminator U-LH100HG UV, excitation and barrier filters. Metaphase images were captured with a CCD camera and karyotyping was done using Cytovision 2.81 software from Applied Imaging Systems.
| Results |
|---|
|
|
|---|
CNP of the SRY gene in patients with SCRA and HNBR males
Copy number status of the SRY gene studied by real-time PCR was found to be abnormal. Owing to haploid status of the Y chromosome, Ct value for RNase P gene was -1 as compared to that of SRY gene [
Ct = (Ct of SRY-Ct of RNaseP) = 1] in blood (diploid) DNA. The Ct values for RNaseP and SRY genes from the semen DNA (haploid) of the normal males were found to be the same (
Ct = 0) corresponding to single copy status of the SRY gene in normal human males (Figure 1). This was substantiated by subsequent analysis of 15 blood and 10 semen DNA samples used as controls (data not shown).
|
Of all the DNA samples analysed from the patients with SCRA, SRY gene showed CNP in the range of 216 (Table I). This gene was absent in a Turner patient p6697 but present in two others, p2C and p4 showed one and four copies, respectively. An unusually tall Turner patient p65971 was found to have 16 copies, whereas the father of this patient (F-p65971) had two copies of the SRY gene (Table I). A Swyer syndrome patient, p20 and Oxen showed four and eight copies, respectively (Figure 2). DNA analysis of hypogonadism/Cryptorchidism patients p65974 and p65973 showed four copies in each. Clinical details and hormonal status of the patients with SCRA used in the present study have been reported previously (Bashamboo et al., 2005
).
|
|
For the copy number status of the SRY genes in males exposed to HNBR, 36 samples analysed included 23 families. Fathers and sons (F, father; B, boy for son) in several families showed two or more copies of this gene (Table II). Of all the samples analysed, twelve showed single copy of the SRY gene, fifteen showed two, six showed 12 (owing to Y chromosome mosaicism), two showed eight and one sample showed four copies affecting about 66% of the males. A HNBR-exposed male (33F) and his son (33B), both carried two copies of the SRY gene (Figure 3). Yet another HNBR male 7F, and his son 7B had eight and four copies, respectively (Table II). Copy number and sequence of the SRY gene in 16 samples (comprising semen and blood samples from eight males) from Kochi City, a non-radiation area of Kerala was found to be normal upon the analysis (data not shown). Interestingly, end point PCR showed stronger band intensity of the SRY gene in case of males with additional copies compared to that of the normal males (Figure 4).
|
|
|
Uniqueness of the copies of the SRY gene in oxen and 33f
Oxen, which represents a rare instance of Y chromosome polysomy (49, XYYYY) showed eight copies of the SRY gene with unique nucleotide changes at several positions (Table III). In silico peptide analysis (http://www.ncbi.nlm.nih.gov/gorf/ gorf. html) of these sequences showed several known and novel mutations (Figure 5A). Two of the recombinant clones pSOx1 and pSOx2, showed silent nucleotide changes at several places. The pSOx3, representing another copy of the SRY gene showed a known F110S mutation, a characteristic feature of the gonadal dysgenesis and a novel Y163F mutation downstream of the HMG box. In pSOx4, a mutation R59S, upstream to HMG box known to be responsible for poor binding of the SRY protein to target DNA was detected (Harley et al., 2003
). This clone was devoid of an amino acid at position 198. In pSOx5, another change K170E, not reported earlier, was detected whereas in pSOx6, P108A mutation responsible for gonadal dysgenesis and four novel mutations Y198D, A7V, F34S and D58E, also not reported previously, were detected. We observed Y127N change in pSOx7. In an earlier study, the Y127C mutation detected at the same position was found to cause a reduction in the binding of the HMG box with target DNA (Harley et al., 2003
). In pSOx7 and pSOx8, seven amino acid residues DNRLYRD from 160166 were altered into GQQVVQG. In pSOx8, four mutations (A6V, P26S, D73G and Q97R) known to be implicated with gonadal dysgenesis were detected (Table III). Analysis of the tertiary structure of the HMG box (www.searchlauncher.bcm.tmc.edu/seq-search/struc-predict.html) showed a number of alterations in all the eight copies of the SRY peptide (data not shown).
|
|
Similarly, analysis of the two copies of the SRY gene from the HNBR male 33F showed abnormal sequences (Table IV). One clone, pS33F13, showed a massive c-terminal deletion involving half of the HMG box and the other one, pS33F3, showed a point mutation towards the amino terminal and 20 aa deletion in the c-terminal region from residues 179198 (Figure 5B). Details of the nucleotide changes in 33F male are given in Table IV.
|
Possible tandem duplication of the SRY gene
The FISH conducted on the metaphase chromosomes and interphase nuclei of the normal males showed a single signal of the SRY and DXZ1 probes in the interphase nuclei and on the chromosomes (Figures 6ac). A single signal was detected in the centromeric region of each X chromosome in the normal female metaphases taken as negative control (data not shown). Males exposed to HNBR also showed a single signal of the SRY gene even with CNP. The HNBR male 7F carrying eight copies of the SRY gene showed a relatively stronger signal on the Y chromosome compared to that of a normal male (Figures 6df). Depending upon the condensation status of the sister chromatids, two signals of SRY were also detected (Figures 6gk). However, in several cases with 24 copies of the SRY gene, the differences in the signal intensity were not discernible (Figure 7).
|
|
| Discussion |
|---|
|
|
|---|
The human genome contains blocks of duplicated sequences resulting in genomic variation (Sebat et al., 2004
Gene duplication increases the complexity of a genome, particularly when it is not clear if all the copies follow normal levels of expression (He and Zhang, 2005
). Incidentally, it cannot be resolved by Southern blot hybridization (Murthy et al., 2005
). In the present study, this limitation was circumvented by the real-time PCR assay system. The results showed as many as 16 copies of the SRY gene in two cases (p65971 and p65972) (see also Table I) suggesting multiple rounds of tandem duplication. However, presence of two copies of this gene in the father (F-p65971) of a patient (p65971) suggests that the patient did not inherit 16 copies, instead it was due to multiple rounds of tandem duplications. Although no direct evidence is available, these observations suggest that non-disjunction of the Y chromosome and duplication of the SRY gene are independent events. This was also corroborated by the HNBR data where fathers and sons often showed uneven copy number of the SRY gene (Table II). These observations are important because in normal human males, SRY has always remained single copy as substantiated by the analysis of two sets of DNA including that from blood and semen samples from non-exposed areas (see materials and methods).
CNP and Y chromosome mosaicism
Our quest to demonstrate if a single Y chromosome could harbour more than one copy of the SRY gene became clear from the analysis of a patient (p4) with mosaic chromosomes (46,XX/46,XY/45,XO). This patient with a single Y chromosome had four copies of the SRY gene, suggesting two rounds of tandem duplication. Yet another Turner patient (p6697) who had undetectable Y chromosome and SRY gene represented a case of pure XO conceptus (not a mosaic of the Y chromosome) though majority of the Turner cases show varying degrees of Y chromosome mosaicism (Ali and Hasnain, 2003
; Bashamboo et al., 2005
). The instance(s) of pure XO conceptus cannot be demonstrated unequivocally because chromosome analysis does not uncover the lowest level of Y chromosome mosaicism. Thus, employing real-time PCR Assay System, all the ambiguous cases may be resolved. CNP seems to be more common (>80%) in patients suffering from SCRA. However, the SRY gene never remained normal (single copy) in about 66% of the males exposed to HNBR.
Possible mechanism of CNP
A single copy gene gives rise to a number of mRNA transcripts, some of which may be reverse transcribed and transposed into the DNA resulting in its multiple copies (Moran et al., 1996
). Thus, besides putative tandem duplication, reverse transcriptase activity on its mRNA may also contribute to the CNP. However, this seems to be a less likely mechanism because all the SRY copies were in the multiples of the two, and thus far a maximum of only 16 were found. Owing to the availability of a large number of mRNA transcripts, reverse transcriptase like activities would have generated far more numbers of SRY copies.
A classical model suggests that after gene duplication, one copy preserves the ancestral function while the other one is free to conform to a new function (Van Hoof, 2005
; Ohno, 1999
). In an alternate duplication, divergence and complementation model, duplicated genes are preserved because each copy loses some but not all of its functions through degenerating mutations (Hughes, 1994
; Force et al., 1999
). The second model seems to be a more likely explanation for eight copies of the SRY gene in Oxen and two copies in the HNBR male 33F, all having different sequences. It is well established that gene duplication and alternate splicing are inversely correlated evolutionary mechanisms fuelling the process of new biological functions (Kopleman et al., 2005
). In the present study, the results suggest that HNBR also contributes to CNP, perhaps associated with the (initiation) process of duplication. Large-scale CNPs in humans have been described (Sebat et al., 2004
; Sharp et al., 2005
) but the CNP of the SRY gene reported herein seems to be the first such study.
| Conclusion |
|---|
|
|
|---|
Irrespective of the mechanisms involved, CNP of the SRY gene uncovered in the present study provides ample opportunity to establish a correlation between the abnormal genotype, number of Y chromosome(s) and copies of the SRY gene(s).
Screening of the additional Y chromosome(s) and assessment of CNP of more genes together with the chromosome analysis and hormonal assays would enhance our understanding of the biological consequences of such phenomenon, enabling more focused genotype phenotype correlation. Similarly, DNA screening at the prenatal level using real-time PCR assay may be of immense help to monitor high-risk pregnancies, facilitating more accurate prognosis of the genetic anomalies. In turn, this would uplift the accuracy of the DNA diagnostics and enable better genetic counselling to affected patients.
| Acknowledgements |
|---|
|
|
|---|
We thank Dr. Dinkar Sahal for critical review of the manuscript, Dr. Sangeeta Thatai for her most valuable support and Shri Khem Singh Negi for technical assistance. We also thank Alexander Von Humboldt Foundation, Bonn, Germany for Equipment donation. This work was supported by DBT grant no. BT/PR2225/Med/13/077/ 2000 and DST grant no. SP/SO/DO3/99 to SA and a core grant from the Department of Biotechnology, Govt. of India to National Institute of Immunology, New Delhi.
| References |
|---|
|
|
|---|
Ali S and Hasnain SE (2003) Genomics of the human Y-chromosome. 1. Association with male infertility. Gene 321,2537.[CrossRef][ISI][Medline]
Ali S, Muller CR and Epplen JT (1986) DNA fingerprinting by oligonucleotides probes specific for simple repeats. Hum Genet 74,239243.[ISI][Medline]
Bashamboo A, Rahman MM, Prasad A, Sebastian PC, Ahmad J and Ali S (2005) Fate of SRY, PABY, DYS1, DYZ3 and DYZ1 loci in Indian patients harbouring sex chromosomal anomalies. Mol Hum Reprod 11,117127.
Cheriyan VD, Kurien CJ, Das B, Ramachandran EN, Karuppasamy CV, Thampi MV, George KP, Kesavan PC, Koya PK et al. (1999) Genetic monitoring of the human population from high-level natural radiation areas of Kerala on the southwest coast of India. II. Incidence of numerical and structural chromosomal aberrations in the lymphocytes of newborns. Radiat Res 152,S154S158.[ISI][Medline]
Force A, Lynch M, Pickett FB, Amores A and Yan Yi-Lin Postlethwait J (1999) Preservation of duplicate genes by complementary, degenerative mutations. Genetics 151,15311545.
Forster L, Forster P, Lutz-Bonengel S, Willkomm H and Brinkmann B (2002) Natural radioactivity and human mitochondrial DNA mutations. Proc Natl Acad Sci USA 99,1395013954.
Gruneberg H, Bains GS, Berry RJ, Riles LE, Smith CAB and Weiss RA (1966) A search for genetic effects of high natural radioactivity in South India. Her Majestys Stationary Office, London. Medical Research council Special Report 307.
Gubbay J, Collignon J, Koopman P, Capel B, Economou A, Munsterberg A, Vivian N, Goodfellow P and Lovell-Badge R (1990) A gene mapping to the sex-determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature 346,245250.[CrossRef][Medline]
Hande MP, Azizova TV, Geard CR, Burak LE, Mitchell CR, Khokhryakov VF, Vasilenko EK and Brenner DJ (2003) Past exposure to densely ionizing radiation leaves a unique permanent signature in the genome. Am J Hum Genet 72,11621170.[CrossRef][ISI][Medline]
Harley VR, Michael JC and Argentaro A (2003) The molecular action and regulation of testis determining factors, SRY (sex-determining region on the Y chromosome) and SOX9 [sry-related high-mobility group (HMG) Box 9]. Endocrine Rev 24,466487.
Hawkins JR, Taylor A, Berta P, Levilliers J, Vander AB and Goodfellow PN (1992) Detection of the SRY Gene in a 46,XY phenotypic female by the PCR-SSCP method. Hum Genet 88,471474.[CrossRef][ISI][Medline]
He X and Zhang J (2005) Gene complexity and gene duplicability. Curr Biol 15,10161021.[CrossRef][ISI][Medline]
Hughes AL (1994) The evolution of functionally novel proteins after gene duplication. Proc Biol Sci 256,119124.
Jeske YW, Bowels J, Greenfield A and Koopman P (1995) Expression of a linear Sry transcript in the mouse genital ridge. Nat Genet 4,480482.
Kopleman NM, Lancet D and Yanai I (2005) Alternative splicing and gene duplication are inversely correlated evolutionary mechanisms. Nat Genet 37,588589.[CrossRef][ISI][Medline]
Lundrigen BL and Tucker PK (1997) Evidence for multiple functional copies of the male sex-determining locus Sry, in African murine rodents. J Mol Evol 45,6065.[CrossRef][ISI][Medline]
Moran JV, Holmes SE, Naas TP, DeBerardinis RJ, Boeke JD and Kazaarian HH Jr (1996) High frequency retrotransposition in cultured mammalian cells. Cell 29,917927.
Murthy SK, Magliocco AM and Dmetrick DJ (2005) Copy number analysis of c-erb-B2 (HER-2/neu) and topoisomerase II alpha genes in breast carcinoma by quantitative real-time polymerase chain reaction using hybridization probes and fluorescence in situ hybridization. Arch Pathol Lab Med 129,3946.[ISI][Medline]
Nair MK, Nambi KS, Amma NS, Gangadharan P, Jayalekshmi P, Jayadevan S, Cherian V and Reghuram KN (1999) Population study in the high natural back ground radiation area in Kerala. India Radiat Res 152,S145S148.
Ohno S (1999) Gene duplication and the uniqueness of vertebrate genomes circa 197099. Semin Cell Dev Biol 10,517522.[CrossRef][ISI][Medline]
Rahman MM, Bashamboo A, Prasad A, Pathak D and Ali S (2004) Organizational variation of DYZ1 repeat sequences on the human Y chromosome and its diagnostic potentials. DNA Cell Biol 23,561571.[CrossRef][ISI][Medline]
Sebat J, Lakshmi B, Troge J, Alexander J, Young J, Lundin P, Månér S, Massa H, Walker M, Chi M et al. (2004) Large-scale copy number polymorphism in the human genome. Science 305,525528.
Sekido R, Bar I, Narvaez V, Penny G and Lovell-Badge R (2004) SOX9 is up-regulated by the transient expression of SRY specifically in Sertoli cell precursors. Dev Biol 274,271279.[CrossRef][ISI][Medline]
Sharp AJ, Locke DP, McGrath SD, Cheng Z, Bailey JA, Vallente RU, Pertz LM, Clark RA, Schwartz S, Segraves R et al. (2005) Segmental duplications and copy-number variation in the human genome. Am J Hum Genet 77,7888.[CrossRef][ISI][Medline]
Sirota L, Zlotogora Y, Shabtai F, Halbrecht I and Elian E (1981) 49, XYYYY, a case report. Clin Genet 19,8793.[ISI][Medline]
Takagi A, Imai A and Tamaya T (1999) A novel sex-determining region on Y (SRY), nonsense mutation identified in a 45, X/47, XYY female. Fertil Steril 72,167169.[CrossRef][ISI][Medline]
Van Hoof (2005) Conserved functions of yeast genes support the duplication, degeneration and complementation model for gene duplication. Genetics 171,14551461.
Submitted on November 21, 2005; resubmitted on December 20, 2005; accepted on January 9, 2006.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
D. Pathak, S. Premi, J. Srivastava, S. P. Chandy, and S. Ali Genomic Instability of the DYZ1 Repeat in Patients with Y Chromosome Anomalies and Males Exposed to Natural Background Radiation DNA Res, January 1, 2006; 13(3): 103 - 109. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








