Mol. Hum. Reprod. Advance Access originally published online on April 5, 2006
Molecular Human Reproduction 2006 12(5):283-289; doi:10.1093/molehr/gal035
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
cDNA cloning and expression of the human NOBOX gene in oocytes and ovarian follicles
Reproduction and Early Development Research Group, Department of Obstetrics and Gynaecology, University of Leeds, Leeds, UK
1 To whom correspondence should be addressed at: Reproduction and Early Development Research Group, Department of Obstetrics and Gynaecology, University of Leeds, D Floor, Clarendon Wing, Leeds General Infirmary, Belmont Grove, Leeds LS2 9NS, UK. E-mail j.huntriss{at}leeds.ac.uk
| Abstract |
|---|
|
|
|---|
Nobox is a homeobox gene that is preferentially expressed in the oocytes and is essential for folliculogenesis and the regulation of oocyte-specific gene expression in the mouse. The likely human homologue has been identified in silico but has not as yet been confirmed experimentally. Here, we present the first cDNA cloning and transcript expression analysis of the human NOBOX gene. Using RTPCR, we reveal that expression within adult human tissues is limited to the ovary, testis and pancreas. Expression within the ovary is oocyte specific, with expression observed from the primordial stage ovarian follicle through to the metaphase II (MII) oocyte. In complementary studies, we reveal dynamic expression profiles of 14 additional homeobox genes throughout human oogenesis and early development. The expression of HOXA10 is restricted to primordial and early primary follicles. HOXB7 is expressed from primordial and early primary stage follicles through to germinal vesicle (GV) oocytes. Gastrulation brain homeobox 1 (GBX1) and HOXA7 genes are homeobox markers preferentially expressed by GV oocytes. HOXA1 and HEX are homeobox markers preferentially expressed by MII oocytes. In summary, the homeobox gene transcripts that are detected in ovarian follicles and oocytes are distinct from those expressed in human blastocysts (HOXB4, CDX2 and HOXC9) and granulosa cells (HOXC9, HOXC8, HOXC6, HOXA7, HOXA5 and HOXA4).
Key words: homeobox/NOBOX/oocyte/oocyte-specific/oogenesis
| Introduction |
|---|
|
|
|---|
The murine Nobox gene (newborn ovary homeobox-encoding gene) was identified by in silico cDNA library subtraction as a unique expressed sequence tag residing in a mouse newborn ovary cDNA library (Suzumori et al., 2002
Disruption of the murine Nobox gene leads to infertility in Nobox / females (Rajkovic et al., 2004
). Whilst these females have normal ovaries at birth, oocyte growth beyond the primordial stage is inhibited, leading to wide-scale loss of oocytes by day 14. Significantly, disruption of the murine Nobox gene eliminates the expression of other key oocyte-specific genes including genes regulating the essential processes of genomic imprinting (Dnmt1o) and the maternal to zygotic transition (Zar1) among others (Rajkovic et al., 2004
). Nobox can therefore be classed alongside Fig
(Factor in the Germline Alpha; Liang et al., 1997
; Soyal et al., 2000
) as one of the master transcription factors regulating oogenesis, although their roles within the process are distinct.
Additional homeobox genes, Sebox (skinembryobrainoocyte-specific homeobox), and Ohx, have been identified with an expression that is largely restricted to, or mainly associated with, oocytes (Cinquanta et al., 2000
; Yeh et al., 2002
). A family of homeobox genes termed Obox has been described, which are exclusively expressed in murine oocytes (Rajkovic et al., 2002
). Gpbox is a further homeobox gene that is expressed preferentially in murine female germ cells (Takasaki et al., 2000
). The restricted expression pattern of these homeobox genes is indicative of roles specific to the process of oogenesis; however, the precise function of these genes remains to be determined.
In this report, we describe the cDNA cloning of the human NOBOX gene and the expression of the corresponding transcripts in the human female germline. In view of the observations that many homeobox genes have expressions and/or functions specifically associated with oogenesis, we used a degenerate priming assay to assess the expression of homeobox genes in human ovarian follicles and oocytes.
| Materials and methods |
|---|
|
|
|---|
Specimen source and cDNA generation
Methods for sample origination, preparation and validation have been described (Huntriss et al., 2002
PCR for analysis of NOBOX expression
NOBOX-specific primers were designed from the human sequence XM_069612. All NOBOX primers are presented in Table I and are numbered from one to seven according to the exons predicted in XM_069612. Expression analysis was performed using the various NOBOX gene primer combinations illustrated in Figure 1 using 1 µl of SMART cDNA in a 25 µl volume of PCR mix (Bioline, London, UK). PCR was performed for 30 or 40 cycles for 45 s at each step at 94°C, 60°C annealing temperature and 72°C. The housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a positive control for cDNA samples (primers from Weisenberger et al., 2002
) in conjunction with other cell-type-specific positive control genes including FIGLA (primers from Huntriss et al., 2002
) and DNMT1o for oocytes (Hayward et al., 2003
) and CYP19A1/aromatase for granulosa cells (primers 5'3': forward acacacactcctccctcaaa, reverse ctttccaggttagtgtgtgg). Products were run on 1.52.0% agarose gels and visualized using ethidium bromide with reference to 100 bp DNA size markers (Invitrogen Ltd. Paisley UK). All PCRs were repeated a minimum of three times. Where possible, cDNA derived from two ovarian extractions (from different individuals) was analysed.
|
|
PCR amplification of homeodomain sequences
The expression of homeobox-containing genes was assessed using degenerate primers for the Antennapedia homeodomain according to the protocol of Murtha et al. (1991)
. Heterogenous PCR products obtained from the cDNA samples were run on 1.52% agarose gels. The amplicons generated (Antennapedia homeodomain products 166 bp) were isolated using a Qiagen gel-purification kit and were subcloned into the Invitrogen Topo TA sequencing vector. Colonies (minimum of 21) were amplified by direct addition to an M13 PCR.
Sequencing
The M13 primer-amplified PCR products and, occasionally, uncloned NOBOX PCR products were analysed at the Biomolecular Analysis Facility, University of Leeds. Sequences of PCR products were obtained in both directions and were identified by Basic Local Alignment Search Tool (BLAST) (http://www.ncbi.nlm.nih.gov/BLAST).
| Results |
|---|
|
|
|---|
cDNA cloning of the human NOBOX gene
NOBOX-specific PCR primers were designed from the predicted human sequences XM_069612 and XM_380069 on chromosome 7 (LOC135935, gi:51466638, GeneID 135935) that represents the likely human orthologue of the murine Nobox gene. Sequences XM_069612 and XM_380069 have seven predicted exons as does an additional predicted sequence, hmm34764. The Ensembl prediction for the NOBOX gene (Transcript ENST00000223140, a product of gene ENSG00000106410) indicates a 5-exon structure (exons 15). In agreement, previous descriptions of the human NOBOX gene structure have indicated a 5-exon structure (described as exons 26), based on similarity to murine Nobox (Suzumori et al., 2002
In initial PCR experiments to amplify putative NOBOX transcripts, cDNA template was pooled from many human ovarian follicle stages (primordial through to secondary). A series of PCR experiments were conducted utilizing primers within each putative exon (Figure 1) amplifying from the pooled cDNA. All primers were designed with identical annealing temperature (60°C) to maximize many effective combinations. These experiments established a series of overlapping PCR products that were sequenced. A summary of data from these PCR experiments is presented in Figure 1. PCR products generated from the intron-spanning primer combinations utilized forward primers located within exon 3, and exon 4 of XM_069612, corresponding to NOBOX exons 2 and 3 in previous reports (Suzumori et al., 2002
; Zhao et al., 2005
) and exons 1 and 2 in ENSG000000106410. These primers generated products in conjunction with reverse primers in exons 5, 6 and 7 of XM_069612, corresponding to exons 4, 5 and 6 according to previous reports (Suzumori et al., 2002
; Zhao et al., 2005
) and exons 3, 4 and 5 within ENST00000223140. Other working PCR primer combinations included various combinations within exon 3 of XM_069612. These combinations were (i) 3Fa and 3Rb (101 bp), (ii) 3Fa and 3Rc (132 bp), (iii) 3Fa and 3Rd (464 bp) and (iv) 3Fc and 3Rd (352 bp) (data not shown). Given that we isolated mRNA before SMART amplification, genomic contamination is an unlikely source for amplification using these primers within exon 3 (a possibility when using non-intron-spanning primers). This is especially unlikely when using single cells or restricted cell numbers, and furthermore, since amplified cDNA template is in excess compared to any possible residual genomic template, we conclude that these PCR products within exon 3 were in fact derived from NOBOX transcripts.
PCRs using a total of five forward primers within predicted exons 1 and 2 of XM_069612 (primers 1Fa, 1Fb, 1Fc, 2Fa and 2Fb) did not yield any expected product when used in conjunction with verified reverse primers. We were unable to obtain additional NOBOX sequence information using 5' and 3' RACE PCRs that utilized the appropriate SMART primers in conjunction with various NOBOX-specific primers, despite the isolation and sequencing of several PCR amplicons from these experiments.
Our NOBOX cDNA construct, created from overlapping PCR amplicons derived from ovarian follicles (see Figure 1), is revealed in Figure 2a. Five exons were identified with the experimental construct spanning exons 3, 4, 5 and 6 entirely and overlapping into exon 7 (XM_069612). Exon sizes (using exon numbering consistent with XM_069612) are exon 3 (552 bp), exon 4 (107 bp), exon 5 (107 bp), exon 6 (86 bp) and exon 7 (233 bp). This exon structure is at variance with all predicted human NOBOX sequences, namely within exon 3 of XM_069612 (exon 4 of the Ensembl prediction), in that the experimentally deduced exon is 107 bp as opposed to 203 bp for the predicted exon size. In view of this discrepancy, subsequently, all NOBOX PCR products that included these exons were sequenced. Sequencing results obtained from the amplicons generated from many primer combinations using oocytes from different individuals, and furthermore from the human ovary, testis and pancreas samples, were all consistent in revealing an exon of 107 bp. This result is not therefore an artefact or an observation unique to the source individual for the ovarian follicles used for the original isolation of NOBOX transcripts. In addition, we generated a 900 bp partial genomic clone for this region spanning from exons 4 to 6 (primers 4F and 6R) that was consistent with the expected genomic sequence for this region (data not shown). Exonintron boundaries in our experimental construct were tested using the NetGene2 server (http://www.cbs.dtu.dk/services/NetGene2/) that confirmed the exon 2 splice donor site (shown in Figure 2a) with a high degree of confidence (0.91). The exon 3 acceptor site was also predicted (0.97 confidence) and is in agreement with all predicted structures for this exon. Exonintron boundaries are therefore conserved between human and mouse genes. The exons identified in the experimental NOBOX construct are similar in size to the corresponding exons (26) identified for the murine gene (Suzumori et al., 2002
; sizes for exons 26: 399, 108, 107, 86 and 232 bp, respectively).
|
On translation, our partial cDNA construct codes for 294 amino acids (Figure 2a). The remaining predicted amino acid sequence from XP_069612 is also shown. As a result of the shortened exon 4 (XM_069612), translation of the experimentally derived NOBOX sequence (Figure 2a) therefore yields a NOBOX protein that differs from the predicted proteins (represented by sequences XP_069612), namely in view of the fact that our construct does not have a 32-amino acid insertion in the homeodomain. Accordingly, the protein deduced from the experimental construct closely matches the murine Nobox protein (NP_570939 [GenBank] , AAL29683 [GenBank] ) within the homeodomain region [Figure 2b; identities = 55/58 (94%), positives = 56/58 (96%), gaps = 0/58 (0%)]. Our translated construct also matches exactly the entire predicted human NOBOX protein represented in UniProt sequence 060393_HUMAN (http://www.ebi.uniprot.org/) and AAC12957 [GenBank] (http://www.ncbi.nlm.nih.gov/entrez/), with the exception of the 32-amino acid insertion that is common to all predicted sequences.
NOBOX expression in the human female germline
Amplified cDNAs from a range of stages across oogenesis were assessed for the expression of NOBOX gene transcripts using verified primer combinations. These stages included cDNA derived from primordial follicles, early primary follicles, primary follicles, secondary follicles, GV-stage oocytes and MII-stage oocytes. Additionally, cDNAs derived from preimplantation embryos (4-cell, 8-cell, morula and blastocyst stages) and also isolated granulosa cells were included. For comparison, the oocyte-specific gene FIGLA, the oocyte-specific DNMT1o transcript, the granulosa cell marker CYP19A1 (aromatase) and the housekeeping gene GAPDH were analysed for the same samples. Our qualitative method of assessment prevents any firm statements regarding expression levels. However, we analysed experiments over a range of cycle numbers from which our conclusions regarding expression were made. Figure 3 shows the PCR expression results for NOBOX at 30 and 40 cycles of amplification. At 30 cycles, NOBOX expression was detected from the primordial follicle stage through to MII oocytes using primers 4F and 7R. The expression of NOBOX was not detected in preimplantation embryo samples at 30 cycles; however, the appropriate band was detectable at 40 cycles. The expression of NOBOX was not observed in granulosa cells up to 40 cycles. FIGLA transcript expression profiles were similar to the patterns observed for NOBOX (from primordial follicles through to MII oocytes). DNMT1o transcripts were detected from early primary stage ovarian follicles through to the 4-cell/8-cell stages of preimplantation development. CYP19A1 transcripts were detected in all ovarian follicle samples, GV oocytes and isolated granulosa cells. The FIGLA and CYP19A1 PCR controls confirmed the presence of both oocyte-derived mRNA and granulosa cell-derived mRNA in the staged ovarian follicle samples.
|
An additional larger band was co-amplified with primers 4F and 7R exclusively in MII oocytes. In view of the discrepancy between the predicted and experimentally deduced sizes within exon 4 (XM_069612), it remained possible that this larger band represented a stage-specific splice variant that utilized a larger exon 4. However, sequencing of this co-amplified product corresponded exactly to the human polycomb group ring finger 1/ring finger protein 3 gene (100% match over 307 bp to PCGF1/RNF3 represented in sequences NM_032673 [GenBank] and AK125742 [GenBank] , respectively). An expanded series of seven additional MII oocytes were tested with the NOBOX 4F/7R primers (data not shown). Co-amplification of the PCGF1/RNF3 was observed in five of seven oocytes, six of which expressed the expected NOBOX product. We conclude that the larger band represents an unintended co-amplification product.
NOBOX expression in adult tissues
NOBOX expression was assessed using a nested PCR protocol across a range of normalized cDNAs derived from human tissues in comparison with the GAPDH gene as a control. The expression was observed in the ovary, testis and the pancreas (Figure 4). The nested PCR approach yielded three distinct bands. All products were sequenced, and BLAST searches confirmed these bands as NOBOX amplicons, corresponding to the first-round, hemi-nested, and second-round products. All tissues expressing NOBOX (ovary, testis and pancreas) utilized a shortened exon 4 (XM_069612), as opposed to the longer, predicted exon 4 sequence.
|
Degenerate PCR amplification of homeobox genes in the human female germline
The expression of additional homeobox genes that are expressed in the female germline was assessed using degenerate primers for the Antennapedia homeodomain (Murtha et al., 1991
). Heterogenous Antennapedia homeodomain-containing PCR products (166 bp product; Figure 5a) obtained from cDNA samples derived from the primordial follicle through to the MII oocytes, blastocysts and granulosa cells were cloned. Colonies were sequenced and identified by BLAST search. A summary of expression results of the sequences identified is given in Figure 5b. Fourteen distinct homeobox genes were identified in this study. Sequencing of homeobox genes expressed in human blastocysts was included for a comparison of embryonic versus oocyte-derived homeobox gene-expression profiles. Similarly, granulosa cells were included to establish which homeobox genes are likely to be derived exclusively from the oocyte, especially in the mixed oocyte and granulosa cell cDNAs present in the ovarian follicle samples.
|
| Discussion |
|---|
|
|
|---|
We have isolated and sequenced cDNA clones of the human NOBOX gene and analysed the expression of this gene in the female germline. The expression of 14 additional homeobox gene transcripts has been revealed during human oogenesis and early development by a degenerate PCR priming method.
NOBOX transcripts were detected in the ovary, testis and pancreas and within all stages of the adult human female germline tested here, from primordial follicles through to MII oocytes. Transcripts were detected in preimplantation embryos but only at higher cycle numbers (40 cycles). The expression was not observed in granulosa cells. It is probable that the transcripts detected in preimplantation embryos at 40 cycles are residual, maternally derived transcripts. Whilst detection of NOBOX expression in the pancreas was unexpected, the otherwise restricted expression profile of NOBOX in the testis and oocytes within the ovary is similar to that observed for Figla/FIGLA in mouse and human tissues (Liang et al., 1997
; Huntriss et al., 2002
). Transcripts of both NOBOX and FIGLA are expressed from the primordial follicle through to MII-oocyte stages, indicating that the roles of these factors are likely to penetrate throughout the process of oogenesis. Analysis of NOBOX expression in human fetal ovary would be beneficial for a better understanding of NOBOX expression during development; however, tissue was unavailable for testing. Transcripts of the DNMT1o gene (an oocyte-specific gene transcript that, in the mouse, is regulated by Nobox; Rajkovic et al., 2004
) were detected from early primary follicle stage, earlier than previously described (Hayward et al., 2003
). The detection of CYP19A1 transcripts in the stripped GV oocytes was unexpected. Whilst this result suggests that some granulosa cells may not have been removed during the stripping procedure, controlled tests for other transcripts appear to indicate that the GV-oocyte cDNA samples were not in fact contaminated (Huntriss et al., 2004
; data not shown).
Sequencing of overlapping NOBOX cDNA clones isolated from the human female germline identified five exons in agreement with earlier reports (Suzumori et al., 2002
; Zhao et al., 2005
) and the Ensembl prediction represented by ENST00000223140. However, it was not possible in our experiments to positively control the primers designed within predicted exons 1 and 2 (primers 1Fa, 1Fb, 1Fc, 2Fa and 2Fc predicted in XM_069612), for example, using a genomic DNA control (because of the large predicted size of intron 1). Further experiments are required to clarify the final exon arrangement. However, the exons identified in the present study have been previously referred to as the entire coding region for NOBOX (Zhao et al., 2005
), and, furthermore, the matches with predicted protein sequences AAC12957
[GenBank]
and 060393_HUMAN are supportive in the notion that we have cloned the majority of the coding region. Significantly, we describe a sequence at variance with the predicted human NOBOX sequences, namely within exon 3 of XM_069612/exon 4 of the Ensembl prediction. These predicted sequences would introduce an additional 32 amino acids in the region of the last
-helix of the homeodomain, as exemplified by BLAST (blastp) searching of predicted human NOBOX protein sequences (XP_069612 and XP-380069) and in comparison with the murine Nobox protein. Such an insertion is unlikely, given the essential role of the homeodomain in Nobox function identified in the mouse (Rajkovic et al., 2004
). Our experimental data discredit the presence of this insertion and reveal that this exon is shorter at 107 bp. Translated BLAST searches (blastx) with the experimentally defined NOBOX sequence reveal close homology to the mouse protein, especially within the entire homeodomain. The sequence of the human NOBOX homeodomain was correctly predicted in earlier studies (Suzumori et al., 2002
).
Disruption of the major regulators of human oogenesis such as NOBOX and FIGLA is likely to lead to disease and infertility. Given that the disruption of the murine Nobox gene affects the primordial to primary follicle transition, and furthermore the regulation of oocyte-specific genes (Rajkovic et al., 2004
), it is probable that any major disruption of the human NOBOX gene would be equally catastrophic. Information from reproductive genetic studies of the factors regulating oogenesis, taken together with the expression data for these gene transcripts, will enhance our knowledge of the probable effects on female infertility. A recent study however failed to find any mutations or deletions of the human NOBOX gene in females exhibiting premature ovarian failure (Zhao et al., 2005
).
In addition to NOBOX, many additional homeobox genes have been described with expression patterns that imply specific roles during mammalian oogenesis (Cinquanta et al., 2000
; Takasaki et al., 2000
; Rajkovic et al., 2002
; Yeh et al., 2002
). The expression of homeobox genes during human oogenesis has been investigated in the present study using degenerate PCR primers targeting the Antennapedia-class homeodomain sequences. Such primers have been used previously to assess HOX gene expression in mouse ovaries (Villaescusa et al., 2004
), bovine oocytes and preimplantation embryos (Ponsuksili et al., 2001
) and unfertilized (MII) human oocytes (Adjaye and Monk, 2000
). Single gene analysis of specific HOX genes has also been performed in human oocytes and preimplantation embryos (Kuliev et al., 1996
). Data presented in the current report represent the first detailed study of homeobox gene expression in the human female germline across multiple stages.
Our results suggest dynamic modulation of HOX gene expression throughout human folliculogenesis/oogenesis. The expression of HOXA10 was restricted to primordial/early primary follicles (25% of clones), and HOXB7 was also prevalent in this sample (31% of clones). The expression of HOXC9 in primordial/early primary follicles (41% of clones), secondary follicles (87% of clones) and granulosa cells (71% of clones), but the exclusion of this transcript in stripped GV- and MII-stage oocytes, indicates that HOXC9 is expressed exclusively by granulosa cells within ovarian follicles and cumulusoocyte complexes, and this transcript is unlikely therefore to originate from the germ cell. The most frequent isolate from secondary follicles was clearly HOXC9. This observation is most likely due to the larger contribution of granulosa cell-derived mRNA in these follicles which are characterized by two or more surrounding layers of granulosa cells. HOXD8 expression was unique to secondary follicles (approximately 7% of clones).
Of particular interest was the identification of a transcript exclusive to the GV oocyte, gastrulation brain homeobox 1 [GBX1 (8.5% of clones)], which represents the human homologue of the murine Gbx1 gene. The expression of Gbx1/GBX1 has been previously described in mouse embryonic brain and human haematopoietic cells (Matsui et al., 1993
; Waters et al., 2003
; Rhinn et al., 2004
) but not oocytes. Within our series of samples, HOXA1 was expressed exclusively by GV and MII oocytes (3 and 54% of clones, respectively). HOXA7 was also prevalent in these samples (80 and 29% of clones, respectively). In an earlier study using identical methodology, HOXA7 was the most frequently isolated transcript in MII oocytes (Adjaye and Monk, 2000
). HOXA7 expression in human oocytes and cleavage stage embryos has also been reported using gene-specific PCR (Verlinsky et al., 1995; Kuliev et al., 1996
). Within our series, transcripts of the HEX gene were isolated exclusively in MII oocytes (17% of clones). In agreement, HEX expression has been previously reported in MII oocytes using the same methodology (Adjaye and Monk, 2000
). HEX is therefore clearly a homeobox marker of oocyte maturity. HOXA1 is similar in this respect. The detection of HOXB7 in primordial/early primary follicles, secondary follicles and stripped GV oocytes but not granulosa cells suggests that this transcript is likely to be derived from the oocyte. The expression of HoxA5, HoxB7, HoxC6 and HoxC8 has been described in mouse ovary using the same priming method (Villaescusa et al., 2004
). Further work is clearly required to deduce whether the stage- and cell-type-specific gene-expression patterns described in our study reflect a functional requirement for each particular homeobox gene during human oogenesis. It would also be desirable to study the expression of HOX genes by in situ hybridization to confirm these observations of stage- and tissue/cell-specific expression, especially if surrounding ovarian cells may have inadvertently contaminated follicle preparations.
None of the recently reported oocyte-specific homeobox genes (Nobox, Ohx, Sebox, Gpbox and the Obox family) were detected in our degenerate priming study. These novel oocyte-specific sequences may be sufficiently divergent from the Antennapedia homeodomain or expressed at lower levels so as not to be amenable to amplification in this particular assay.
Homeobox gene transcripts identified in the human blastocyst include HOX C9, HOX B4 and CDX2. CDX2 is essential for cell fate specification and differentiation of the trophectoderm in mouse blastocysts (Strumpf et al., 2005
) and has been recently confirmed as a trophectodermal marker transcript in the human blastocyst (Adjaye et al., 2005
). Since these three transcripts were not detected in either GV or MII oocytes, we conclude that HOX C9, HOX B4 and CDX2 are homeobox transcripts of embryonic origin (post-zygotic gene activation). Cdx2 and Hoxc9 expression has been described in bovine blastocysts using the same priming method (Ponsuksili et al., 2001
).
In summary, our study has isolated, characterized and monitored the expression of a key homeobox regulator of oogenesis (NOBOX) and has demonstrated that a portfolio of homeobox genes are expressed differentially in the human female germline.
| References |
|---|
|
|
|---|
Adjaye J and Monk M (2000) Transcription of homeobox-containing genes detected in cDNA libraries derived from human unfertilized oocytes and preimplantation embryos. Mol Hum Reprod 6,707711.
Adjaye J, Huntriss J, Herwig R, Benkahla A, Brink T, Wierling C, Hultschig C, Groth D, Yaspo ML, Picton H et al. (2005) Primary differentiation in the human blastocyst: Comparative molecular portraits of inner cell mass and trophectoderm cells. Stem Cells 23,15141525.[CrossRef][Web of Science][Medline]
Cinquanta M, Rovescalli AC, Kozak CA and Nirenberg M (2000) Mouse Sebox homeobox gene expression in skin, brain, oocytes, and two-cell embryos. Proc Natl Acad Sci USA 97,89048909.
Hayward BE, De Vos M, Judson H, Hodge D, Huntriss J, Picton HM, Sheridan E and Bonthron DT (2003) Lack of involvement of known DNA methyltransferases in familial hydatidiform mole implies the involvement of other factors in establishment of imprinting in the human female germline. BMC Genet 4,2.
Huntriss J, Gosden R, Hinkins M, Oliver B, Miller D, Rutherford AJ and Picton HM (2002) Isolation, characterization and expression of the human Factor in the Germline alpha (FIGLA) gene in ovarian follicles and oocytes. Mol Hum Reprod 8,10871095.
Huntriss J, Hinkins M, Oliver B, Harris SE, Beazley JC, Rutherford AJ, Gosden RG, Lanzendorf SE and Picton HM (2004) Expression of mRNAs for DNA methyltransferases and methyl-CpG-binding proteins in the human female germ line, preimplantation embryos, and embryonic stem cells. Mol Reprod Dev 67,323336.[CrossRef][Web of Science][Medline]
Kuliev A, Kukharenko V, Morozov G, Freidine M, Rechitsky S, Verlinsky O, Ivakhnenko V, Gindilis V, Strom C and Verlinsky Y (1996) Expression of homeobox-containing genes in human preimplantation development and in embryos with chromosomal aneuploidies. J Assist Reprod Genet 13, 177181.[CrossRef][Web of Science][Medline]
Liang L, Soyal SM and Dean J (1997) FIGalpha, a germ cell specific transcription factor involved in the coordinate expression of the zona pellucida genes. Development 124,49394947.[Abstract]
Matsui T, Hirai M, Wakita M, Hirano M and Kurosawa Y (1993) Expression of a novel human homeobox-containing gene that maps to chromosome 7q36.1 in hematopoietic cells. FEBS Lett 322,181185.[Medline]
Murtha MT, Leckman JF and Ruddle FH (1991) Detection of homeobox genes in development and evolution. Proc Natl Acad Sci USA 88,1071110715.
Ponsuksili S, Wimmers K, Adjaye J and Schellander K (2001) Expression of homeobox-containing genes in cDNA libraries derived from cattle oocytes and preimplantation stage embryo. Mol Reprod Dev 60,297301.[CrossRef][Web of Science][Medline]
Rajkovic A, Yan C, Yan W, Klysik M and Matzuk MM (2002) Obox, a family of homeobox genes preferentially expressed in germ cells. Genomics 79, 711717.[CrossRef][Web of Science][Medline]
Rajkovic A, Pangas SA, Ballow D, Suzumori N and Matzuk MM (2004) NOBOX deficiency disrupts early folliculogenesis and oocyte-specific gene expression. Science 305,11571159.
Rhinn M, Lun K, Werner M, Simeone A and Brand M (2004) Isolation and expression of the homeobox gene Gbx1 during mouse development. Dev Dyn 229,334339.[CrossRef][Web of Science][Medline]
Rovescalli AC, Asoh S and Nirenberg M (1996) Cloning and characterization of four murine homeobox genes. Proc Natl Acad Sci USA 93,1069110696.
Soyal SM, Amleh A and Dean J (2000) FIGalpha, a germ cell-specific transcription factor required for ovarian follicle formation. Development 127, 46454654.[Abstract]
Strumpf D, Mao CA, Yamanaka Y, Ralston A, Chawengsaksophak K, Beck F and Rossant J (2005) Cdx2 is required for correct cell fate specification and differentiation of trophectoderm in the mouse blastocyst. Development 132, 20932102.
Suzumori N, Yan C, Matzuk MM and Rajkovic A (2002) Nobox is a homeobox-encoding gene preferentially expressed in primordial and growing oocytes. Mech Dev 111,137141.[CrossRef][Web of Science][Medline]
Takasaki N, McIsaac R and Dean J (2000) Gpbox (Psx2), a homeobox gene preferentially expressed in female germ cells at the onset of sexual dimorphism in mice. Dev Biol 223,181193.[CrossRef][Web of Science][Medline]
Verlinsky Y, Morozov G, Gindilis V, Strom CM, Freidin M, Rechitsky S, Verlinsky O, Ivakhnenko V, Zdanovsky V and Kuliev A (1995) Mol Reprod Dev 41,12732.[CrossRef][Web of Science][Medline]
Villaescusa JC, Verrotti AC, Ferretti E, Farookhi R and Blasi F (2004) Expression of Hox cofactor genes during mouse ovarian follicular development and oocyte maturation. Gene 330,17.[CrossRef][Web of Science][Medline]
Waters ST, Wilson CP and Lewandoski M (2003) Cloning and embryonic expression analysis of the mouse Gbx1 gene. Gene Expr Patterns 3, 313317.[CrossRef][Medline]
Weisenberger DJ, Velicescu M, Preciado-Lopez MA, Gonzales FA, Tsai YC, Liang G and Jones PA (2002) Identification and characterization of alternatively spliced variants of DNA methyltransferase 3a in mammalian cells. Gene 298,9199.[CrossRef][Web of Science][Medline]
Wynn P, Picton HM, Krapez JA, Rutherford AJ, Balen AH and Gosden RG (1998) Pretreatment with follicle stimulating hormone promotes the numbers of human oocytes reaching metaphase II by in-vitro maturation. Hum Reprod 13,31323138.
Yeh YJ, Choo KB, Cheng WT and Li H (2002) Ohx is a homeobox-encoding gene preferentially expressed in mature oocytes. Mech Dev 117,259263.[CrossRef][Web of Science][Medline]
Zhao XX, Suzumori N, Yamaguchi M and Suzumori K (2005) Mutational analysis of the homeobox region of the human NOBOX gene in Japanese women who exhibit premature ovarian failure. Fertil Steril 83,18431844.[CrossRef][Web of Science][Medline]
Submitted on December 22, 2005; resubmitted on February 22, 2006; accepted on March 6, 2006.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
D. E. Mold, A. E. Dinitz, and D. R. Sambandan Regulation of Zebrafish Zona Pellucida Gene Activity in Developing Oocytes Biol Reprod, July 1, 2009; 81(1): 101 - 110. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Tilly, Y. Niikura, and B. R. Rueda The Current Status of Evidence for and Against Postnatal Oogenesis in Mammals: A Case of Ovarian Optimism Versus Pessimism? Biol Reprod, January 1, 2009; 80(1): 2 - 12. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. S. Lee, K. E. Latham, and C. A. VandeVoort Effects of in vitro maturation on gene expression in rhesus monkey oocytes Physiol Genomics, October 8, 2008; 35(2): 145 - 158. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








