Mol. Hum. Reprod. Advance Access originally published online on May 4, 2006
Molecular Human Reproduction 2006 12(6):389-399; doi:10.1093/molehr/gal044
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Decreased expression of the angiogenic regulators CYR61 (CCN1) and NOV (CCN3) in human placenta is associatedwith pre-eclampsia
1Institute of Anatomy and 2Department of Gynecology and Obstetrics, University Hospital Essen, Essen, Germany and 3Department of Obstetrics and Gynecology, Samuel Lunenfeld Research Institute, Mount Sinai Hospital, Toronto, Canada
4 To whom correspondence should be addressed at: Institute of Anatomy, University Hospital Essen, Hufelandstr. 55, 45122 Essen, Germany. E-mail: e.winterhager{at}uni-essen.de
| Abstract |
|---|
|
|
|---|
The pregnancy disorder pre-eclampsia (PE) is thought to be caused in part by shallow invasion of the extravillous trophoblast (EVT) leading to uteroplacental insufficiency and hypoxia. Here, we focused on the expressions of cysteine-rich 61 (CYR61, CCN1) and nephroblastoma overexpressed (NOV, CCN3), members of the CCN family of angiogenic regulators, in human placenta during normal pregnancy compared with pre-eclamptic and HELLP placentae using quantitative RTPCR, western blotting and immunocytochemistry. During normal pregnancy, both proteins showed increasing expression levels and were strongly coexpressed in endothelial cells of vessels, stromal cells and interstitial EVT giant cells. However, NOV showed an earlier onset of expression in villous endothelial cells during gestation compared with CYR61, which may signify distinct roles of these proteins in placental angiogenesis. In early-onset pre-eclamptic placentae, both CYR61 and NOV were expressed at a significantly lower level compared with normal matched controls. This decrease of CYR61 and NOV in pre-eclamptic placentae is not associated with a decrease of the endothelial marker CD34 or vimentin. No obvious changes in the localization of CYR61 and NOV in pre-eclamptic placentae were detected but a change in the intracellular distribution in trophoblast giant cells. Our data point to a potential role of both molecules in the pathogenesis of early-onset PE.
Key words: angiogenesis/CCN/CYR61/NOV/placenta/pre-eclampsia
| Introduction |
|---|
|
|
|---|
Pre-eclampsia (PE), a multisystemic disorder affecting about 510% of pregnancies towards the end of the second trimester of gestation, is one of the leading causes of pregnancy-related maternal and fetal morbidity and mortality (Redman and Sargent, 2005
Clinically, this disease is characterized by hypertension and proteinuria (Pridjian and Puschett, 2002
). Currently, it is discussed whether the HELLP syndrome, an acronym for hemolysis, elevated liver enzymes and low platelets, represents a severe variant of PE or another type of disease (Sibai, 2004
). At present, women at risk of this disease are identified on the basis of epidemiological and clinical risk factors, but the diagnostic criteria remain unclear. To date, the only effective treatment of PE is the delivery of the fetus and placenta.
Although the pathophysiology of PE is still unknown, the placenta is considered to play a key role in this disease (Myatt, 2002
). This is mostly due to the finding that PE occurs even in the absence of a fetus as in molar pregnancy. The haemochorial placentation in humans involves a complex interaction of the trophoblast and the uterus. Extravillous trophoblast (EVT) cells migrate through the uterine stroma and erode local spiral arteries to gain access to the maternal blood supply. Normally, the invasive trophoblast remodels the maternal vessels by replacing the vascular smooth muscle and endothelial cells and converting them to vessels with low resistance and therefore high blood flow capacity (Fisher, 2004
).
One of the most favoured hypotheses is that PE is generated by shallow invasion of the EVT followed by an incomplete remodelling of the maternal vascular structures which leads to uteroplacental insufficiency and fetal growth retardation which in turn can influence placental angiogenesis and development (Zhou et al., 1993
; Fisher, 2004
). The nature of the limited invasion is presently unknown, although it could result from defective EVT differentiation.
Several molecular mechanisms are known to affect trophoblast differentiation, such as specific transcriptional regulators, genes involved in the invasion process as well as adhesion molecules and integrins which play a key role in cell migration (Cross, 2000
; Chakraborty et al., 2002
). Defects in any of these processes could result in shallow invasion and immature remodelling of the uterine vessels observed in pre-eclamptic placenta. However, the abundance of genes that have been implicated in the pathogenesis of PE indicates that this disease may not be explained by a simple single mechanism.
Recent lines of evidence suggest that failed trophoblast invasion is linked to the maternal vascular pathology through the abnormal placental production of vasculogenic/angiogenic factors such as vascular endothelial growth factor (VEGF) (Fisher, 2004
; Mayhew et al., 2004a
). Zhou et al. demonstrated that the expressions of VEGF-A and VEGF receptor-1 are down-regulated in cytotrophoblasts of pre-eclamptic placenta tissues and that the release of the soluble VEGF receptor-1 (sFlt-1), an antagonist of VEGF and placental growth factor (PlGF), is increased (Zhou et al., 2002
). However, there are some discrepancies about the regulation of VEGF in the literature (Mayhew et al., 2004a
; Sgambati et al., 2004
). Several investigations have demonstrated that other growth factors and their receptors such as PlGF and insulin-like growth factor I (IGF-I) are also dysregulated in serum or placental tissues of women with PE (Sane et al., 2004
; Lam et al., 2005
). It is speculated that an imbalance in the production of angiogenic/growth factors at the maternalfetal interface and their release into the maternal circulation could lead to the clinical signs of this pregnancy disorder such as hypertension and proteinuria.
Because angiogenesis and/or migration of trophoblast are affected in this disorder, we have focused on molecules that are discussed as key players in these processes. We have evaluated the expressions of cysteine-rich 61 (CYR61, CCN1) and nephroblastoma overexpressed (NOV, CCN3), members of the CCN family, in the human placenta during normal pregnancy and in the placentae of pathological pregnancies. The CCN family of proteins consists of six members, CYR61 (CCN1), connective tissue growth factor (CTGF, CCN2), NOV (CCN3) and Wnt-induced secreted proteins (WISP13, CCN46), which are matricellular proteins involved in the regulation of various cellular processes such as adhesion, migration, proliferation and differentiation (Perbal, 2001
, 2004
; Bleau et al., 2005
; Rachal and Brigstock, 2005
). CYR61 and NOV have been shown to promote proangiogenic activities in endothelial cells in vivo through integrin receptors and are highly expressed in vascular structures during embryogenesis (Babic et al., 1998
; Ellis et al., 2000
, 2003
; Leu et al., 2002
; Lin et al., 2003
; Chen et al., 2004
). Moreover, these proteins are found to be expressed in the human placenta (Kolesnikova and Lau, 1998
). The significance of CYR61 for developmental processes is strengthened by the observation that targeted disruption of the CYR61 gene in mice results in embryonic lethality because of impaired allantoic vessel bifurcation in the placenta and compromised vessel integrity in embryonic arteries (Mo et al., 2002
).
In the light of the results from mice lacking CYR61, the aim of this study was to investigate the expressions of CYR61 and NOV in the human placenta during normal pregnancy and in the placentae complicated by early and late PE (ePE and lPE) and HELLP syndrome to address the question whether these molecules are dysregulated in these pregnancy-associated diseases. Here, we demonstrate that CYR61 and NOV show increasing levels in human placenta during pregnancy with strong expression in endothelial cells of vessels, in stromal cells and in interstitial EVT giant cells. Furthermore, we found a decreased level of these angiogenic regulators in early pre-eclamptic placental tissues compared with gestationally matched normal placentae. Our data suggest that the angiogenic factors CYR61 and NOV may be involved in the pathogenesis of PE through their potential effect on placental development and function.
| Materials and methods |
|---|
|
|
|---|
Patients and placental collection
Placental tissue was obtained from the Department of Gynecology and Obstetrics of the University Hospital Essen, the Department of Obstetrics and Gynecology, Samuel Lunenfeld Research Institute, Mount Sinai Hospital, Toronto, and the Morgentaler Clinic, Toronto. Written consent was received from women before surgery. The respective ethics committee approved consent forms and protocols to use the tissue. Placental tissue was obtained at the time of vaginal delivery, Caesarean section or as abortion material (618 weeks placenta tissues). Thirty-three pregnant women were recruited for the study of gene expression during normal pregnancy classified into the following four groups: first trimester (613 weeks, n = 7), second trimester (1426 weeks, n = 6), preterm (2736 weeks, n = 11) and term (3741 weeks, n = 9). For the study of pre-eclamptic and HELLP placental tissues versus matched control normotensive pregnancies without any signs of PE or HELLP, the following groups were analysed: pregnancies complicated by early-onset PE and delivered before 34 weeks (2533 weeks, n = 11), lPE and delivered after 34 weeks (3439 weeks, n = 8) (ePE and lPE groups are defined according to Zhong et al., 2005
|
|
PE was diagnosed according to international criteria (Roberts and Redman, 1993
; Sibai et al., 2005
). Generally, PE was defined as a blood pressure of at least 140/90 mmHg on two occasions at least 6 h apart occurring after 20 weeks of gestation in women known to be normotensive beforehand and detectable urinary protein (proteinuria) [
1+ (
30 mg/dl) by dipstick]. The HELLP group was further characterized by the same characteristics as for ePE along with abnormal liver function with enhanced liver enzyme concentrations glutamate oxalacetate transaminase (GOT) and glutamate pyruvate transaminase (GPT) and thrombocytopaenia.
Early pre-eclamptic and HELLP groups were further discriminated from the normal controls by the following findings: lower mean birth (only HELLP group) and placental weight, significantly higher mean maximal pressure (systolic and diastolic) and proteinuria (also applied to lPE, see Table II). Early pre-eclamptic patients exhibited a significantly higher diastolic blood pressure compared with late pre-eclamptic patients. The women with HELLP syndrome were characterized by a significantly higher level of the liver enzyme GPT and a significantly lower quantity of thrombocytes with respect to the controls.
For RNA and protein isolation, only chorionic tissue from the central part of the placenta was collected, and contamination with maternal decidua and amniotic membranes was excluded by morphological observation. Tissue processing was equally performed in the participating clinical centres involved in this study. Tissues were frozen in liquid nitrogen and stored at 80°C until extraction of matched RNA and protein samples. For immunohistochemistry and histology, we removed the chorionic villi tissue together with parts of the decidual basal plate. The samples were embedded in OCT cryo-medium (Tissue-Tek, Sakura, Zoeterwoude, the Netherlands), frozen in liquid nitrogen and stored at 80°C.
Standard RTPCR
Two micrograms of total placental RNA samples was digested with DNase I (Invitrogen, Karlsruhe, Germany). The reverse transcription and the following PCR reaction were performed as described previously (Gellhaus et al., 2004
). The PCR was generated using primers specific for CYR61, NOV, CD34 and vimentin designed based on the published sequence generated by MWG Biotech (Ebersberg, Germany). The following primer sequences were used: CYR61 (AF307860
[GenBank]
) 5'-primer, GTGACGAGGATAGTATCAAGGACC, 3'-primer, ATTTCTGGCCTTGTAAAGGGTTG; NOV (NM_002514
[GenBank]
) 5'-primer, CACGGCGGTAGAGGGAGATA, 3'-primer, GGGTAAGGCCTCCCAGT GAA; CD34 (NM_001773
[GenBank]
) 5'-primer, CACCCTGTGTCTCAACATGG, 3'-primer, GGCTTCAAGGTTGTCTCTGG and vimentin (NM_003380
[GenBank]
) 5'-primer, GAGAACTTTGCCGTTGAAGC, 3'-primer, TCCAGCAGCTTCCT GTAGGT. The PCR was performed for 34 cycles of 1 min denaturation at 94°C, 1 min annealing at 59°C and 1.5 min elongation at 72°C. The PCR amplification was followed by a 10 min final extension at 72°C. The PCR amplification products (CYR61: 196 bp, NOV: 251 bp, CD34: 191 bp, vimentin: 170 bp) were purified from the agarose gel using the gel extraction kit (Qiagen, Hilden, Germany). The specificity of the PCR products was analysed by sequencing (MWG Biotech). The purified PCR products of CYR61, NOV, CD34 and vimentin were used as standards for real-time RTPCR.
Quantitative real-time RTPCR
Two to four micrograms of total placental RNA samples was DNase-digested and reverse transcribed as described previously (Gellhaus et al., 2004
). Gene expression of CYR61, NOV, CD34 and vimentin was quantitated using the qPCR Master Mix for SYBR green (Eurogentec, Seraing, Belgium) and the GeneAmp 5700 sequence Detection system (Applied Biosystems, Darmstadt, Germany). For a quantitative measurement, ß-actin (NM_001101
[GenBank]
) was used as an internal control: 5'-primer, ACCAACTGGGACGACATGGAGAAAA and 3'-primer, TACGGCCAGAGGCGTACAGGGA TAG (213 bp PCR product). The PCR reactions were carried out in triplicate in a final volume of 25 µl with 2 µl (80 ng) cDNA, 1x reaction buffer containing SYBR green, 10 pmol sense and antisense primers CYR61, NOV, CD34, vimentin and ß-actin (for primer sequences, see above). The specificity of the amplification products was confirmed by melting curve analysis and by agarose gel electrophoresis. The PCR fragments were visualized on 2% ethidium bromide-stained agarose gels. Ten-fold dilution of purified PCR products starting at 1 pg to 0.1 fg were used as standards, providing a relative quantification of the unknown samples. The PCR was performed for 10 min at 95°C followed by 45 cycles of 10 seconds denaturation at 95°C and 1 min annealing at 60°C. The quantity of cDNA in each sample was normalized to the ß-actin cDNA.
Immunofluorescence and microscopy
Indirect immunohistochemistry of 7 µm placental cryostat sections was performed as described previously (Winterhager et al., 1991
). The following primary antibodies were used: rabbit polyclonal antibody against CYR61 (1 : 75, Aviva antibody, San Diego, CA, USA), rabbit polyclonal antibody against NOV (1 : 150) (Chevalier et al., 1998
), monoclonal mouse anti-Ki67 (1 : 100, Novocastra, Newcastle, UK), monoclonal mouse anti-human CD31 [platelet endothelial cell adhesion molecule-l (PECAM-1), 1 : 150, Dako, Hamburg, Germany] and monoclonal mouse anti-human cytokeratin 7 (1 : 150, Dako).
The following appropriate secondary antibodies were used: donkey anti-mouse Alexa Fluor® 488 (1 : 300, MoBiTech, Goettingen, Germany) and Cy3-conjugated goat anti-rabbit IgG (1 : 300, Dianova, Munich, Germany).
After immunolabelling, the DNA-specific dye 4',6'-diamidino-2-phenylindole (DAPI) hydrochloride (0.1 µg/ml; 15 min, 37°C) was used to counterstain the nuclei.
The sections were mounted with Mowiol (Sigma, Munich, Germany) and were studied using a confocal laser-scanning microscope (LSM 510, Zeiss, Oberkochen, Germany).
Western blot analysis
Protein extracts were prepared from placental tissues by homogenization with modified RIPA lysis buffer (50 mM TrisHCl, 150 mM NaCl, 1% NP-40, 0.25% Na-deoxycholate, 1 mM EDTA, 0.1% SDS) supplemented with EDTA-free Complete protease inhibitors (Roche, Penzberg, Germany). Protein content was determined using the BCA protein assay (Perbio Science, Bonn, Germany). Protein samples (30 µg) were separated on a 12% polyacrylamide gel for the analysis of CYR61 and NOV expressions and on a 10% polyacrylamide gel for analysing CD34 expression and electrophoretically transferred to polyvinylidene difluoride membrane (Amersham Biosciences, Piscataway, NJ, USA). Membranes were blocked with 5% non-fat dried milk in Tris-buffered saline (TBS) with 0.15% Tween-20 and incubated with the primary antibody. The following primary antibodies were used: rabbit polyclonal CYR61 antibody (1 : 25000; kindly provided by N. Schuetze, Wuerzburg, Germany; Schutze et al., 2005
), goat anti-human NOV (1 : 1000; R&D Systems, Wiesbaden, Germany), mouse anti-human CD34 (1 : 150, Santa Cruz Biotechnology, Heidelberg, Germany) and mouse anti-human GAPDH antibody (1 : 1000, Chemicon, Hampshire, UK) for normalization of protein expression. Primary antibody binding was detected using the following secondary antibodies: anti-rabbit IgG, anti-goat IgG and anti-mouse IgG antibody conjugated to horseradish peroxidase (1 : 10000; Santa Cruz Biotechnologies). Detection was achieved with the ECL chemiluminescence kit (Amersham Biosciences) according to the protocol using X-ray films (Kodak, Stuttgart, Germany).
Statistical analysis
The gene expression data of the quantitative RTPCR experiments and the western blot analysis as well as the clinical data of pregnant women were analysed for statistical significance by the MannWhitney test for non-parametric independent two-group comparisons with the program SPSS 10 for Windows (SPSS Inc, Chicago, IL, USA). Differences with a P value
0.05 were regarded as statistically significant.
| Results |
|---|
|
|
|---|
CYR61 and NOV expressions in human placenta during normal pregnancy
A total of 33 normal placentae from women were included into this analysis (Table I). The transcript levels of the angiogenic regulator genes CYR61 and NOV were analysed in the chorionic villi tissue of placenta from normal pregnancies in the four gestational groups: first trimester, second trimester, preterm and term by quantitative RTPCR (Figure 1). Both genes revealed a significantly increasing expression level (P
0.05) in placenta tissues during pregnancy using ß-actin as the normalizing housekeeping gene. Although the tendency in the temporal expression pattern of both molecules during pregnancy was similar, there were some differences (Figure 1). In detail, NOV mRNA levels increased between the first and second trimesters and remained constant throughout the early third trimester, but a significant increase was seen at term as compared with first trimester levels. CYR61 expression revealed two peaks with enhanced expression, one in the second trimester (1426 weeks) and one at the end of pregnancy (3741 weeks). During the course of pregnancy, NOV showed a lower up-regulation (four-fold) of mRNA expression compared with CYR61 (eight-fold). Highest increase of CYR61 mRNA (six-fold) in the placenta was observed between first and second trimesters of pregnancy, whereas NOV was only two-fold up-regulated. Interestingly, after 26 weeks of pregnancy, the CYR61 transcript level was significantly down-regulated compared with the NOV mRNA expression. The results were independent from the chosen housekeeping gene (GAPDH and Ubiquitin B) (data not shown).
|
To confirm the results of CYR61 and NOV transcript expressions in placental tissue throughout normal pregnancy on protein level, we performed western blot analysis of placentae for each gestational group (Fig. 2). We could verify the increase of CYR61 and NOV protein expressions during the course of gestation. The protein expression pattern of both genes in the four gestational groups correlated to their transcript levels (compare Figures 1 and 2).
|
Localization of CYR61 and NOV proteins in human placenta during normal pregnancy
Immunocytochemical localization of CYR61 and NOV expressions in the human placenta in different gestational stages was performed in combination with various marker molecules (Figure 3). Because it is well known that CYR61 and NOV expressions are often associated with proliferative activity (Babic et al., 1998
; Lin et al., 2003
; Perbal, 2004
), Ki67 was used as a marker to test the association of CYR61 and NOV expressions between the proliferating extravillous cytotrophoblast cells of the cell column and the non-proliferating interstitial EVT giant cells. In first trimester human placentae, double immunostaining of CYR61 or NOV with Ki67 revealed that neither protein was detectable in proliferating cytotrophoblast cells of a cell column in early stages of placental development (Figure 3A and C). However, both proteins showed an intense punctuated cytoplasmic and weak nuclear expression in clusters of the non-proliferating EVT giant cells localized in the decidua (Figure 6E and G). CYR61 and NOV were not expressed in cytotrophoblast and syncytiotrophoblast cells in all stages of pregnancy (Figure 3AD). Thus, the expression of CYR61 and NOV was restricted to non-proliferating EVT giant cells with an absence in cytotrophoblast and syncytiotrophoblast cells. However, intense immunostaining for CYR61 as well as NOV was found in mesenchymal and stromal cells of the placental villi during all stages of pregnancy (Figure 3AD).
|
Moreover, both proteins were highly coexpressed by endothelial cells of vessels within the vascularized villi of second trimester placenta tissues and showed a further increase near term (Figure 3B and D). We confirmed the localization of CYR61 and NOV in endothelial cells using CD31 as an endothelial marker (Figure 3EH). Interestingly, we found a different onset of expression between CYR61 and NOV in endothelial cells of placental vessels during gestation. Whereas NOV showed an expression in endothelial cells of vessels in sections of first trimester placentae (13 weeks) (Figure 3G, arrow), CYR61 was not detected in endothelial cells of early placentae (Figure 3E, arrow) but in stromal cells. With ongoing pregnancy, coexpression of both CCN proteins could be demonstrated in endothelial cells of all vessels in the chorionic villi from the second trimester onwards (Figure 3F and H; 40 weeks).
Although we could demonstrate that there was an increasing transcript level of CYR61 and NOV in human placenta from early to late pregnancy (see Figure 1), there was no obvious relation to an enhanced immunolabelling of both proteins in all compartments such as endothelial cells, stromal cells and EVT giant cells.
CYR61 and NOV expressions in pre-eclamptic and HELLP placentae
We investigated 25 pathological placentae for the expression levels of both genes, (i) 11 placentae from women with early-onset PE (2533 weeks, ePE), (ii) 8 placentae from women with PE in late pregnancy (3439 weeks, lPE) and (iii) 6 placentae from women with HELLP syndrome (2330 weeks). The expression data of the pathological placentae were compared with control placentae of the corresponding gestational stages of women with normotensive pregnancies: Control 1 (2333 weeks, Co 1, n = 12) for ePE and HELLP, and Control 2 (3439 weeks, Co 2, n = 9) for lPE. For clinical parameters of the women with PE and HELLP, see Table II.
The transcript levels of CYR61 and NOV were significantly (CYR61: P = 0.0001; NOV: P = 0.004) lower in early pre-eclamptic placentae compared with the respective control group analysed by quantitative RTPCR (Figure 4). Although variation of the expression levels of both genes was high among individual placenta tissues as illustrated in Figure 4A, the decreased expressions of CYR61 and NOV mRNA in early pre-eclamptic placentae compared with controls were statistically significant. There was a 52% significant lower level of CYR61 transcript and a 75% significant lower level of NOV mRNA in early pre-eclamptic placentae (Figure 4B). Remarkably, there was only a slight, but not significant, down-regulation in the expression of either gene in placentae from women suffering from lPE compared with the respective control group. Also, in HELLP placental tissues, no definite change in the expression of both transcripts was detected.
|
To assess whether the decreased level of the CCN molecules in early pre-eclamptic placentae was because of a lower proportion of endothelial cells in the chorionic villi tissuethe cell type where CYR61 and NOV were strongly coexpressedwe evaluated the mRNA expression level of the vascular endothelial cell marker CD34. The transmembrane protein CD34 is a reliable and well-accepted marker for the endothelium which is, in the placenta, only expressed in fetal and maternal vessels but not in the trophoblast (Dye et al., 2001
; Huppertz, 2006
), whereas the endothelial marker CD31 was also found to be expressed in subpopulations of trophoblast cells as well as on platelets, monocytes and lymphocytes and thus not suitable for western blot analysis (Coukos et al., 1998
; Dye et al., 2001
). Real-time PCR analysis revealed a significant up-regulation of CD34 in early pre-eclamptic placentae compared with normal matched controls, suggesting that either the amount of endothelial cells or the CD34 expression level per cell was elevated (Figure 4C). The analysis of CD34 transcript expression in HELLP placentae revealed no significant changes.
To associate the expression of both CCN molecules with the amount of villous stromal cellsthe second cell population where CYR61 and NOV were expressedwe used vimentin, which is present in all cells of mesenchymal origin such as villous stromal cells but also in endothelial cells. However, even this marker for both mesenchymal and endothelial cells does not indicate any change in expression levels in pre-eclamptic and HELLP placentae compared with normal controls (Fig. 4D).
The significant down-regulation of CYR61 and NOV in placentae from women with early-onset PE was confirmed in early pre-eclamptic placental tissues using western blot analysis (Figure 5A and B). Neither the HELLP placentae nor the late pre-eclamptic placentae revealed a significant change in the CCN protein levels. Again CD34 showed a significant up-regulation in early pre-eclamptic and also in HELLP placentae compared with controls (Figure 5C). These results confirmed that the decreased level of CYR61 and NOV expressions in early pre-eclamptic placentae could not be associated with a decrease in marker gene expression of endothelial cells.
|
Localization of CYR61 and NOV proteins in pre-eclamptic and HELLP placentae
Although the transcript levels of CYR61 and NOV were reduced in early pre-eclamptic placentae, no obvious difference in staining intensity and expression pattern of both proteins compared with normal control placentae of matched stages could be observed (Fig. 6). As in healthy placentae, expression of both proteins was absent in cytotrophoblast cells and in the syncytiotrophoblast analysed by double immunolabelling with cytokeratin 7 (data not shown). In the pathological placenta tissues, CYR61 and NOV were strongly coexpressed in endothelial cells of vessels and in stromal cells of the chorionic villi as in normal placentae (Figure 6B and D).
|
However, a difference in the localization and distribution of both proteins in interstitial EVT giant cells of early pre-eclamptic and HELLP placentae was found (Figure 6EH). Whereas the control placentae showed a strong punctuated cytoplasmic and very weak nuclear expression of CYR61 and NOV in clusters of giant cells (Figure 6E and G, arrows), the giant cells of pre-eclamptic and HELLP placentae demonstrated a diffuse staining of both CCN proteins in the cytoplasm as well as in the nucleus (shown for early PE placentae, Figure 6F and H, arrows).
| Discussion |
|---|
|
|
|---|
This study shows that CYR61 and NOV, which represent multifunctional proteins of the CCN family (Perbal, 2004
The increasing expression levels of CYR61 and NOV mRNA and protein during normal pregnancy may be explained by the increased density of villi during the development of the human placenta accompanied by an increasing amount of fetal capillaries and stromal cells (Castellucci et al., 1990
; Benirschke and Kaufmann, 2000
). The increase in expression in gestational human placenta is paralleled by investigation of the CYR61 expression in mouse placenta where CYR61 transcripts increased from mid (11.5 days post coitum) to late gestation (18.5 days post coitum) (OBrien and Lau, 1992
; Kireeva et al., 1997
; Latinkic et al., 2001
).
Interestingly, we found a different onset of expression between CYR61 and NOV in endothelial cells of placental vessels during gestation. In early first trimester placenta, only NOV was detected in the developing chorionic vasculature. As it is known that NOV is expressed in endothelial cells, promotes cell adhesion in vascular endothelial cells and induces neovascularization in vivo (Ellis et al., 2000
; Lin et al., 2003
), we assume that NOV may play a role in placental vasculogenesis which is known to occur in the first trimester placenta (Kaufmann et al., 2004
). In contrast to NOV, CYR61 was not found in endothelial cells of early first trimester placenta tissues but was found from the second trimester onwards. Analysis of the CYR61 knockout mouse, which suffered from embryonic death because of vascular defects in the placenta and embryo, demonstrated that CYR61 is not required for vasculogenesis but is essential for vessel bifurcation in ongoing vascular development (Mo et al., 2002
). Kaufmann et al. reported that the strongest growth spurt in the villous tree development is observed between the first and second trimester with a tremendous increase in villous mass and branching-angiogenesis followed by a stage of villi differentiation post 26 weeks gestation characterized by non-branching angiogenesis (Kaufmann et al., 2004
). This may account for our observed lack of CYR61 during the period of vasculogenesis in the first trimester placentae. The expression of CYR61 in the endothelial cells of placental vessels during later gestation seems to be required for the precise regulation and development of a branching capillary network that occurs in the second trimester. This proposed function of CYR61 in placental angiogenesis is in accordance with our results showing a peak in expression in the second trimester and a strong down-regulation at preterm. Thus, the increased expression of both CCN molecules is associated with the enhanced angiogenesis during normal placental development.
This study demonstrated a significant decrease in expression levels of CYR61 and NOV mRNAs and proteins in placentae of women suffering from early-onset PE, but not from lPE, compared with normotensive gestational-matched controls. Using CD34 and vimentin as endothelial and stromal markers, we could not attribute the down-regulation of CYR61 and NOV in early pre-eclamptic placentae to a decreased proportion of endothelial and stromal cells in the villous tissue. Our results showed that the transcript and protein levels of the vascular endothelial marker CD34 revealed no down-regulation but rather an increase in early pre-eclamptic placentae compared with normal controls, suggesting no decline in fetal endothelial cell proliferation in placental villi during angiogenesis in the pre-eclamptic placenta samples. Our results are further confirmed by data of other groups investigating placental villous morphometry in PE, who showed that this syndrome is not associated with impoverished growth of villi and fetal vasculature (Mayhew et al., 2004b
; Egbor et al., 2005
). Furthermore, Lyall et al. revealed no difference in the expression of the endothelial marker CD31 between pre-eclamptic and normotensive controls (Lyall et al., 1995
). One can speculate that the elevated levels of CD34 in early pre-eclamptic placentae could be a compensatory mechanism resulting from increased pro-inflammatory endothelial cell activation (Lam et al., 2005
; Redman and Sargent, 2005
), a higher proportion of endothelial cells or an enhanced expression of CD34 per cell.
In contrast to the observed decrease in CYR61 and NOV protein levels by western blot analysis, our immunohistochemical analysis showed no clear difference in staining intensity between the endothelium and stromal tissues of normal and pre-eclamptic placenta, but we suggest that the quantitative real-time PCR and western blot techniques are the more appropriate analyses to investigate gene and protein expression levels. Our immunohistochemical findings are in line with the observation of Anteby et al., who reported a similar quantification problem because of variable immunostaining intensities, analysing the expression of growth factor receptor-protein bound 2 (GRB2) in pre-eclamptic placentae (Anteby et al., 2005
).
As CYR61 and NOV are coexpressed in endothelial cells of pre-eclamptic placenta tissues and it is well known that they exhibit proangiogenic functions and mediate endothelial cell growth, migration, adhesion and survival, it is likely that these molecules act in an autocrine manner on the endothelium. However, because the amount of endothelial cells, and thereby vessels, are not decreased in the pre-eclamptic placentae, it remains speculative what the consequences of the reduction in CCN proteins are in relation to angiogenesis. It is also possible that endothelial and stromal derived CYR61 and NOV act in a paracrine manner on trophoblast cells. It is known that the CCN molecules regulate the production and/or activity of other angiogenic molecules, e.g. basic fibroblast growth factor (bFGF) and VEGF (Rachal and Brigstock, 2005
), that in turn act on both trophoblast and endothelial cells during placental development (Dunk and Ahmed, 2001
; Anteby et al., 2004
). Therefore, it is possible that the decrease in CYR61 and NOV in PE may contribute to the reported decreases in growth factors such as VEGF, PIGF and IGF (Zhou et al., 2002
; Sane et al., 2004
; Lam et al., 2005
) and thereby influences trophoblast differentiation. However, it remains unclear if the decrease of CYR61 and NOV is a cause or a consequence of PE.
Further evidence for a possible involvement of CYR61 and NOV in placental function was the finding of strong expression levels in the non-proliferating interstitial EVT giant cells. This expression is associated with findings in the mouse placenta, where CYR61 is localized in trophoblast giant cells (Mo et al., 2002
). We suggest that the EVT giant cells may require both CCN proteins as they differentiate along the invasive pathway after escaping from the cell cycle. It is reported that NOV and CYR61 stimulate migration and invasion properties in Ewings sarcoma cells (Benini et al., 2005
; Bleau et al., 2005
). The expression of CYR61 and NOV also further supports the hypothesis of a vascular endothelial phenotype of the EVT cells suggested by the expression of vascular cell adhesion molecule-1 (VCAM-1), PECAM-1 and VE-cadherin (Zhou et al., 1997b
). In PE, the molecules representing the vascular phenotype failed to express properly (Zhou et al., 1993
, 1997a
). We did not evaluate whether the amount of CYR61 and NOV was reduced in EVT giant cells; however, we observed a difference in the localization and distribution of both proteins in interstitial EVT giant cells of pre-eclamptic placentae. Whereas the control placentae EVT giant cells showed a strong punctuated cytoplasmic and weak nuclear expression of CYR61 and NOV, the giant cells of pre-eclamptic and HELLP placentae demonstrated a diffuse staining of both CCN proteins in the cytoplasm and nucleus. We have previously demonstrated that NOV localizes predominantly in the nucleus of the malignant invasive trophoblast cell line JEG3 and shown that NOV-overexpressing JEG3 trophoblast cells revealed a reduced cell proliferation compared with parental cells (Gellhaus et al., 2004
). Furthermore, it is also known that the function of CCN proteins seems to be dependent on their subcellular localization (Perbal, 2001
, 2004
). A hypothesis is that if NOV is accumulated in the nucleus, it leads to growth stimulation, whereas if NOV is secreted or remains at the cell membrane, it inhibits proliferation. Therefore, we suggest that the aberrant localization pattern of NOV and CYR61 is likely to negatively affect trophoblast invasion and remodelling of the spiral arteries, thereby compromising blood flow to the maternalfetal interface in PE.
It is intriguing that both severe pre-eclamptic and HELLP placenta samples show aberrant giant cell expression of both proteins, yet only the pre-eclamptic group reveal decreased placental expression levels. We found no clear regulation of CYR61 and NOV in the placenta tissues from women with HELLP syndrome and late-onset of PE suggesting different aetiologies between early-onset pre-eclamptic placental disease and the later maternal pathology of PE. It is hypothesized that HELLP is a different pregnancy-associated disease compared with PE because this syndrome exhibits different pathophysiologies accompanied by other molecular mechanisms (Baxter and Weinstein, 2004
). The diagnosis criteria for early-onset PE and HELLP are often miscellaneous and not well defined. As we found no significant changed expression levels of the angiogenic molecules CYR61 and NOV in HELLP placentae, we assume that these proteins are not involved in the liver metabolism and haematopoiesis disorders that are the main characteristics of HELLP.
In conclusion, our results showed that the expression of the CCN proteins CYR61 and NOV in human placenta increased during normal pregnancy. Because both proteins have a different onset in expression in endothelial cells of placental vessels during pregnancy, they may play different roles in angiogenesis during normal placental development. Whereas CYR61 seems to be more involved in branching-angiogenesis in the placenta, NOV may play a role in early placental vasculogenesis.
Interestingly, CYR61 and NOV were significantly lower expressed in early pre-eclamptic placentae compared with normal matched controls accompanied by a change in intracellular distribution of both proteins in interstitial EVT cells which adds novel molecules to the orchestra of candidate genes that showed a dysregulated expression in PE and are associated with placental angiogenesis and EVT migration.
| Acknowledgements |
|---|
|
|
|---|
We thank Daniela Kottmann, Natalie Knipp, Georgia Rauter, Gabriele Sehn, Eva Kusch and Gisela Koestner for excellent technical assistance and Dr Ljiljana Petkovic for collecting placental tissues. We are also indebted to B. Perbal and N. Schuetze for providing us with NOV and CYR61 antibodies. This work was supported by grants from the German Research Foundation (DFG: Wi 774/212) to E.W. and from the NIH (R01 HD42558-01) to E.W. and S.J.L.
| References |
|---|
|
|
|---|
Anteby EY, Greenfield C, Natanson-Yaron S, Goldman-Wohl D, Hamani Y, Khudyak V, Ariel I and Yagel S (2004) Vascular endothelial growth factor, epidermal growth factor and fibroblast growth factor-4 and -10 stimulate trophoblast plasminogen activator system and metalloproteinase-9. Mol Hum Reprod 10,229235.
Anteby EY, Ayesh S, Shochina M, Hamani Y, Schneider T, Al-Shareef W, Hochberg A and Ariel I (2005) Growth factor receptor-protein bound 2 (GRB2) upregulation in the placenta in preeclampsia implies a possible role for ras signalling. Eur J Obstet Gynecol Reprod Biol 118,174181.[CrossRef][Web of Science][Medline]
Babic AM, Kireeva ML, Kolesnikova TV and Lau LF (1998) CYR61, a product of a growth factor-inducible immediate early gene, promotes angiogenesis and tumor growth. Proc Natl Acad Sci USA 95,63556360.
Baxter JK and Weinstein L (2004) HELLP syndrome: the state of the art. Obstet Gynecol Surv 59,838845.[CrossRef][Web of Science][Medline]
Benini S, Perbal B, Zambelli D, Colombo MP, Manara MC, Serra M, Parenza M, Martinez V, Picci P and Scotlandi K (2005) In Ewings sarcoma CCN3 (NOV) inhibits proliferation while promoting migration and invasion of the same cell type. Oncogene 24,43494361.[CrossRef][Web of Science][Medline]
Benirschke K and Kaufmann P, eds. (2000) Pathology of the Human Placenta, 4th edn. Springer-Verlag, New York.
Bleau AM, Planque N and Perbal B (2005) CCN proteins and cancer: two to tango. Front Biosci 10,9981009.[Web of Science][Medline]
Castellucci M, Scheper M, Scheffen I, Celona A and Kaufmann P (1990) The development of the human placental villous tree. Anat Embryol (Berl) 181,117128.[Medline]
Chakraborty C, Gleeson LM, McKinnon T and Lala PK (2002) Regulation of human trophoblast migration and invasiveness. Can J Physiol Pharmacol 80,116124.[CrossRef][Web of Science][Medline]
Chen N, Leu SJ, Todorovic V, Lam SC and Lau LF (2004) Identification of a novel integrin alphavbeta3 binding site in CCN1 (CYR61) critical for pro-angiogenic activities in vascular endothelial cells. J Biol Chem 279,4416644176.
Chevalier G, Yeger H, Martinerie C, Laurent M, Alami J, Schofield PN and Perbal B (1998) novH: differential expression in developing kidney and Wilms tumors. Am J Pathol 152,15631575.[Abstract]
Coukos G, Makrigiannakis A, Amin K, Albelda SM and Coutifaris C (1998) Platelet-endothelial cell adhesion molecule-1 is expressed by a subpopulation of human trophoblasts: a possible mechanism for trophoblastendothelial interaction during haemochorial placentation. Mol Hum Reprod 4,357367.
Cross JC (2000) Genetic insights into trophoblast differentiation and placental morphogenesis. Semin Cell Dev Biol 11,105113.[CrossRef][Web of Science][Medline]
Dunk C and Ahmed A (2001) Expression of VEGF-C and activation of its receptors VEGFR-2 and VEGFR-3 in trophoblast. Histol Histopathol 16,359375.[Web of Science][Medline]
Dye JF, Jablenska R, Donnelly JL, Lawrence L, Leach L, Clark P and Firth JA (2001) Phenotype of the endothelium in the human term placenta. Placenta 22,3243.[CrossRef][Web of Science][Medline]
Egbor M, Ansari T, Morris N, Green CJ and Sibbons PD (2005) Pre-eclampsia and fetal growth restriction: how morphometrically different is the placenta? Placenta [Epub ahead of print].
Ellis PD, Chen Q, Barker PJ, Metcalfe JC and Kemp PR (2000) NOV gene encodes adhesion factor for vascular smooth muscle cells and is dynamically regulated in response to vascular injury. Arterioscler Thromb Vasc Biol 20,19121919.
Ellis PD, Metcalfe JC, Hyvonen M and Kemp PR (2003) Adhesion of endothelial cells to NOV is mediated by the integrins alphavbeta3 and alpha5beta1. J Vasc Res 40,234243.[CrossRef][Web of Science][Medline]
Fisher SJ (2004) The placental problem: linking abnormal cytotrophoblast differentiation to the maternal symptoms of preeclampsia. Reprod Biol Endocrinol 2,53.[CrossRef][Medline]
Gellhaus A, Dong X, Propson S, Maass K, Klein-Hitpass L, Kibschull M, Traub O, Willecke K, Perbal B, Lye SJ et al. (2004) Connexin43 interacts with NOV: a possible mechanism for negative regulation of cell growth in choriocarcinoma cells. J Biol Chem 279,3693136942.
Huppertz B (2006) Molecular markers for human placental investigation. Methods Mol Med 121,337350.[Medline]
Kaufmann P, Mayhew TM and Charnock-Jones DS (2004) Aspects of human fetoplacental vasculogenesis and angiogenesis. II. Changes during normal pregnancy. Placenta 25,114126.[CrossRef][Web of Science][Medline]
Kireeva ML, Latinkic BV, Kolesnikova TV, Chen CC, Yang GP, Abler AS and Lau LF (1997) Cyr61 and Fisp12 are both ECM-associated signaling molecules: activities, metabolism, and localization during development. Exp Cell Res 233,6377.[CrossRef][Web of Science][Medline]
Kolesnikova TV and Lau LF (1998) Human CYR61-mediated enhancement of bFGF-induced DNA synthesis in human umbilical vein endothelial cells. Oncogene 16,747754.[CrossRef][Web of Science][Medline]
Lam C, Lim KH and Karumanchi SA (2005) Circulating angiogenic factors in the pathogenesis and prediction of preeclampsia. Hypertension 46,10771085.
Latinkic BV, Mo FE, Greenspan JA, Copeland NG, Gilbert DJ, Jenkins NA, Ross SR and Lau LF (2001) Promoter function of the angiogenic inducer Cyr61gene in transgenic mice: tissue specificity, inducibility during wound healing, and role of the serum response element. Endocrinology 142,25492557.
Leu SJ, Lam SC and Lau LF (2002) Pro-angiogenic activities of CYR61 (CCN1) mediated through integrins alphavbeta3 and alpha6beta1 in human umbilical vein endothelial cells. J Biol Chem 277,4624846255.
Lin CG, Leu SJ, Chen N, Tebeau CM, Lin SX, Yeung CY and Lau LF (2003) CCN3 (NOV) is a novel angiogenic regulator of the CCN protein family. J Biol Chem 278,2420024208.
Lyall F, Greer IA, Boswell F, Young A, Macara LM and Jeffers MD (1995) Expression of cell adhesion molecules in placentae from pregnancies complicated by pre-eclampsia and intrauterine growth retardation. Placenta 16,579587.[CrossRef][Web of Science][Medline]
Mayhew TM, Charnock-Jones DS and Kaufmann P (2004a) Aspects of human fetoplacental vasculogenesis and angiogenesis. III. Changes in complicated pregnancies. Placenta 25,127139.[CrossRef][Web of Science][Medline]
Mayhew TM, Wijesekara J, Baker PN and Ong SS (2004b) Morphometric evidence that villous development and fetoplacental angiogenesis are compromised by intrauterine growth restriction but not by pre-eclampsia. Placenta 25,829833.[CrossRef][Web of Science][Medline]
Mo FE, Muntean AG, Chen CC, Stolz DB, Watkins SC and Lau LF (2002) CYR61 (CCN1) is essential for placental development and vascular integrity. Mol Cell Biol 22,87098720.
Myatt L (2002) Role of placenta in preeclampsia. Endocrine 19,103111.[CrossRef][Web of Science][Medline]
OBrien TP and Lau LF (1992) Expression of the growth factor-inducible immediate early gene cyr61 correlates with chondrogenesis during mouse embryonic development. Cell Growth Differ 3,645654.[Abstract]
Perbal B (2001) NOV (nephroblastoma overexpressed) and the CCN family of genes: structural and functional issues. Mol Pathol 54,5779.
Perbal B (2004) CCN proteins: multifunctional signalling regulators. Lancet 363,6264.[CrossRef][Web of Science][Medline]
Pridjian G and Puschett JB (2002) Preeclampsia. Part 1: clinical and pathophysiologic considerations. Obstet Gynecol Surv 57,598618.[CrossRef][Web of Science][Medline]
Rachal AW and Brigstock DR (2005) Structural and functional properties of CCN proteins. Vitam Horm 70,69103.[CrossRef][Web of Science][Medline]
Redman CW and Sargent IL (2005) Latest advances in understanding preeclampsia. Science 308,15921594.
Roberts JM and Redman CW (1993) Pre-eclampsia: more than pregnancy-induced hypertension. Lancet 341,14471451.[CrossRef][Web of Science][Medline]
Sane DC, Anton L and Brosnihan KB (2004) Angiogenic growth factors and hypertension. Angiogenesis 7,193201.[CrossRef][Medline]
Schutze N, Kunzi-Rapp K, Wagemanns R, Noth U, Jatzke S and Jakob F (2005) Expression, purification, and functional testing of recombinant CYR61/CCN1. Protein Expr Purif 42,219225.[CrossRef][Web of Science][Medline]
Sgambati E, Marini M, Zappoli Thyrion GD, Parretti E, Mello G, Orlando C, Simi L, Tricarico C, Gheri G and Brizzi E (2004) VEGF expression in the placenta from pregnancies complicated by hypertensive disorders. BJOG 111,564570.[Web of Science][Medline]
Sibai BM (2004) Diagnosis, controversies, and management of the syndrome of hemolysis, elevated liver enzymes, and low platelet count. Obstet Gynecol 103,981991.[Web of Science][Medline]
Sibai B, Dekker G and Kupferminc M (2005) Pre-eclampsia. Lancet 365,785799.[Web of Science][Medline]
Winterhager E, Stutenkemper R, Traub O, Beyer E and Willecke K (1991) Expression of different connexin genes in rat uterus during decidualization and at term. Eur J Cell Biol 55,133142.[Web of Science][Medline]
Zhong XY, Gebhardt S, Hillermann R, Tofa KC, Holzgreve W and Hahn S (2005) Circulatory nucleosome levels are significantly increased in early and late-onset preeclampsia. Prenat Diagn 25,700703.[CrossRef][Web of Science][Medline]
Zhou Y, Damsky CH, Chiu K, Roberts JM and Fisher SJ (1993) Preeclampsia is associated with abnormal expression of adhesion molecules by invasive cytotrophoblasts. J Clin Invest 91,950960.[Web of Science][Medline]
Zhou Y, Damsky CH and Fisher SJ (1997a) Preeclampsia is associated with failure of human cytotrophoblasts to mimic a vascular adhesion phenotype. One cause of defective endovascular invasion in this syndrome? J Clin Invest 99,21522164.[Web of Science][Medline]
Zhou Y, Fisher SJ, Janatpour M, Genbacev O, Dejana E, Wheelock M and Damsky CH (1997b) Human cytotrophoblasts adopt a vascular phenotype as they differentiate. A strategy for successful endovascular invasion? J Clin Invest 99,21392151.[Web of Science][Medline]
Zhou Y, McMaster M, Woo K, Janatpour M, Perry J, Karpanen T, Alitalo K, Damsky C and Fisher SJ (2002) Vascular endothelial growth factor ligands and receptors that regulate human cytotrophoblast survival are dysregulated in severe preeclampsia and hemolysis, elevated liver enzymes, and low platelets syndrome. Am J Pathol 160,14051423.
Submitted on February 23, 2006; accepted on April 3, 2006.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
A. Gellhaus, M. Schmidt, C. Dunk, S. J. Lye, and E. Winterhager The Circulating Proangiogenic Factors CYR61 (CCN1) and NOV (CCN3) Are Significantly Decreased in Placentae and Sera of Preeclamptic Patients Reproductive Sciences, December 1, 2007; 14(8_suppl): 46 - 52. [Abstract] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






