Mol. Hum. Reprod. Advance Access originally published online on August 1, 2006
Molecular Human Reproduction 2006 12(9):543-549; doi:10.1093/molehr/gal065
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression of endometrial glycogen synthase kinase-3ß protein throughout the menstrual cycle and its regulation by progesterone
1Department of Internal Medicine, 2Department of Obstetrics and Gynecology and 3Department of Pathology, Harbor-UCLA Medical Center, Torrance, CA, USA
4 Present address: Quest Diagnostics, San Juan Capistrano, CA, USA
5 To whom correspondence should be addressed at: Department of Obstetrics and Gynecology, Harbor-UCLA Medical Center, 1000 West Carson Street, Box 489, Torrance, CA, USA. E-mail: okhorram{at}obgyn.humc.edu
| Abstract |
|---|
|
|
|---|
Glycogen synthase kinase-3ß (GSK-3ß) is a serine/threonine kinase that plays a role in glycogen synthesis by inhibiting glycogen synthase (GS) through phosphorylation. We hypothesized that GSK-3ß by virtue of its role in glycogen synthesis through the inhibition of GS will play a role in the preparation of the endometrium for blastocyst implantation. Immunohistochemical (IHC) analysis and Western blot analysis (WBA) detected GSK-3ß in the endometrium, myometrium, Fallopian tube and ovary. WBA showed more than 5-fold higher endometrial expression of the phosphorylated GSK-3ß (pGSK-3ß) isoform (inactive) in the secretory phase as compared with the proliferative phase (P < 0.001), whereas no differences in total GSK-3ß expression were detected. IHC analysis confirmed the WBA and showed marked expression of pGSK-3ß predominantly in glandular epithelial cells in early and mid secretory endometrium with scant expression during the proliferative phase. In in vitro experiments using human endometrial-derived epithelial cell line (HES), progesterone did not alter total GSK mRNA or protein expression. However, progesterone induced a dose-dependent increase in the expression of pGSK-3ß, which could be blocked by RU486. Cyclic expression of GSK-3ßs active and inactive forms in the endometrium suggests that sex hormones regulate the expression of this enzyme. In vitro experiments demonstrate that progesterone through receptor-mediated mechanisms induces phosphorylation of endometrial GSK-3ß.
Key words: endometrium/glycogen synthase kinase-3ß/menstrual cycle/progesterone/RU486
| Introduction |
|---|
|
|
|---|
The process of implantation requires a hospitable uterine environment. One of the key metabolic changes that occurs during the peri-implantation period and throughout pregnancy in discrete cell populations in the placenta is the rise in endometrial glycogen content (Milwidsky et al., 1980
and ß) (Embi et al., 1980
The activity of GSK-3ß is controlled through two alternative canonical pathways, the first of which reviewed elsewhere (Moon et al., 1997
; Cohen and Frame, 2001
; Dominguez and Green, 2001
; Frame and Cohen, 2001
; Woodgett, 2001
) is through Wnt signalling and leads to a non-phosphorylative inactivation of GSK-3ß, stabilization of ß-catenin and transcriptional activation of TCF/LEF-responsive genes. An alternative mechanism regulating predominantly the metabolic and cell survival functions of GSK-3ß is through an inactivating phosphorylation at serine 9 position for GSK-3ß and serine 21 for GSK-3
(Cohen and Frame, 2001
; Dominguez and Green, 2001
; Woodgett, 2001
). Several kinases may mediate this phosphorylation including PKA, PKC and AKT (PKB). The role of insulin in the inactivation of GSK-3
and GSK-3ß and the subsequent increase in GS activity occurs through AKT (Cohen and Frame, 2001
; Woodgett, 2001
). Although most of the literature has concerned itself with the study of GSK-3ß, many but not all of the roles of GSK-3ß are shared with GSK-3
.
GSK-3ß is a highly conserved enzyme with key roles in numerous biological processes reviewed elsewhere (Cohen and Frame, 2001
; Woodgett, 2001
). Some of the most studied are its roles in glucose and energy homeostasis, cell fate decisions such as body patterning of the Drosophila embryo (Siegfried et al., 1992
; Siegfried and Perrimon, 1994
), formation of the ventraldorsal axis in the Xenopus embryo (Woodgett, 1994
; Klein and Melton, 1996
; Stambolic et al., 1996
; Moon et al., 1997
) and regulation of meiotic entry in yeast and possibly rodents (Bowdish and Mitchell, 1993
; Bowdish et al., 1994
; Malathi et al., 1997
, 1999
; Guo et al., 2003
). Interestingly, GSK-3ß inactivation is required and is rate limiting for progesterone-mediated Xenopus oocyte maturation (Fisher et al., 1999
; Nebreda and Ferby, 2000
). During oocyte maturation, both insulin and progesterone through non-genomic mechanisms induce serine phosphorylation and inactivation of GSK-3ß (Sarkissian et al., 2004
). At the level of the endometrium, the actions of GSK-3ß are complex. Components of the Wnt-signalling pathway, with the exception of GSK-3ß, are regulated transcriptionally in the various phases of the menstrual cycle suggesting a role in peri-implantation events (Tulac et al., 2003
). Aside from a role in uterine development, canonical Wnt signalling with inhibition of GSK-3ß and nuclear translocation of ß-catenin is essential for the estrogen receptor (ER)-independent estrogen-regulated growth of epithelial cells of the endometrium (Hou et al., 2004
). Other evidence suggests opposing effects of estradiol (E2) and progesterone through the PI3-kinase-AKT-Ser-9 inactivation of GSK-3ß on the proliferation of endometrial epithelial cells (Chen et al., 2005
). Additionally, progesterone up-regulates Dickkopf-1 (DKK-1), a potent inhibitor of Wnt signalling in the stromal cells of the secretory phase human endometrium (Tulac et al., 2006
).
The purpose of this study was to extend our knowledge of the role of these pathways in decidualization of the human endometrium and to test the hypothesis schematically depicted in Figure 1). On the basis of this hypothesis, progesterone regulates the activity of GSK-3ß through phosphorylation, such that during the secretory phase when expected implantation occurs and endometrial glycogen stores are high, a greater proportion of GSK-3ß is in the inactive (phosphorylated) form. This would result in a greater proportion of GS to be in the non-phosphorylated (active) state and hence would lead to increased glycogenesis. To test this hypothesis, we determined the endometrial expression of the inactive and total (predominantly active) forms of GSK-3ß throughout the menstrual cycle and examined the influence of progesterone and its antagonist RU486 on in vitro expression of both forms of the enzyme in cultured endometrial [human endometrial-derived epithelial cell line (HES)] cell line. Our data confirm our hypothesis that progesterone through its receptor facilitates glycogen synthesis in the secretory phase human endometrium through the phosphorylative inhibition of GSK-3ß.
|
| Materials and methods |
|---|
|
|
|---|
Specimens
Tissues used for this study were collected at two institutions including the University of Wisconsin, Madison, and Harbor-UCLA Medical Center Torrance. Institutional Review Board (IRB) approval at both institutions was obtained. In the case of tissues for WBA, samples were obtained from premenopausal women undergoing hysterectomy for benign gynaecologic indications, including pelvic organ prolapse, symptomatic myoma and dysmenorrhoea. The mean ages of these women were 36 and 39 years for proliferative and secretory phase, respectively. Tissues used in the immunohistochemical studies were provided by the department of Pathology at Harbor-UCLA Medical Center and were derived from women undergoing surgery for benign gynaecologic indications. Histological dating of tissues was done according to the criteria of Noyes et al. (1950)
Real-time RTPCR
For real-time PCR, cDNA was generated with 0.5 µg of total RNA using Omniscript Reverse Transcription (RT) reagent (QIAGEN). The RNA was incubated in 20 µl of a RT reaction mixture [x1 RT buffer, 0.5 mM dNTP, 1 µM random hexamers, 10 U Rnasin (RNase inhibitor) and 4 U Omniscript reverse transcriptase] at 37°C for 1 h. The reverse transcriptase was inactivated by heating at 95°C for 5 min. PCR was performed in 96-well optical reaction plates (Applied Biosystems) on cDNA equivalent to 25 ng RNA in a volume of 25 µl, containing x1 reaction buffer (EUROGENTEC); forward and reverse appropriate primers were selected from Assay on Demand (Applied Biosystems). Real-time PCR was performed for GSK and glyceraldehyde-3-phosphatedehydrogenase (GAPDH) gene, using the ABI-Prism 7700 Sequence System (Applied Biosystems) using the following conditions: 10 min at 95°C for one cycle and 15 s at 95°C, 1 min at 60°C for 40 cycles. Primer sequences for GSK were as follows: GSK sense: 5'ATTACGGGACCCAAATGTCA3'; GSK antisense: 5'ATTGGTCTGTCCACGGTCTC3'; GAPDH sense: 5'ATC ACTGCCACCCAGAAGACT3'; GAPDH antisense: 5'CATGCCACTGAG CTTCCCGTT3'.
Control PCR was done with water replacing cDNA. All the controls gave a threshold cycle (CT) value of 40, indicating no detectable PCR product under these cycle conditions. ABI Sequence Detection System 1.6 software (Applied Biosystems) was used to determine the cycle number at which fluorescence emission crossed the automatically determined threshold level (CT). All samples were run in triplicate.
The cycle at which each reaction reached threshold fluorescence was defined as the CT for that reaction. The results were analysed using comparative method and the values were normalized to GAPDH RNA expression by subtracting mean CT of GAPDH from mean target CT for each sample, to obtain the mean
CT. The mean
CT values were then converted into fold change based on a doubling of PCR product in each PCR cycle, according to the manufacturers guidelines.
WBA
Cells and tissue were sonicated in protein lysis buffer and protein concentrations determined by the BCA Protein Assay kit (Pierce, Rockford, IL, USA). For each sample, 35 µg of protein was separated on a 7.5% polyacrylamide gel. The separated proteins were transferred electrophoretically to Immobilon-P membranes (Millipore Corp., New Bedford, MA, USA). Membranes were blocked for 2 h in a 5% milk buffer before overnight incubation with GSK-3ß and phospho-GSK-3ß antibodies at primary dilution of 1 : 1000 (Cell Signaling Technology, Inc., Beverly, MA). The blots were subjected to enhanced chemiluminescence (ECL Western Blotting Detection System, Amersham Corp., Arlington Heights, IL, USA), with enzyme conjugate anti-mouse IgG horseradish peroxidase as a secondary antibody. Blots were then exposed to autoradiography film. The resulting bands corresponding to
48 kDa were compared by scanning densitometry. To ensure equal loading, we stripped protein blots and reprobed them for GAPDH.
Immunohistochemistry
Tissues were fixed in formalin and embedded in paraffin, and 5 µm sections were cut and mounted onto slides. Sections were then de-paraffinized, rehydrated and pre-incubated with 3% horse serum in phosphate-buffered saline (PBS) for 20 min, followed by 4 h of incubation at room temperature with affinity-purified polyclonal antibodies (Cell Signaling Technology, Inc., Beverly, MA, USA) to total GSK-3ß (1 : 50 dilution) and phosphorylated GSK-3ß (pGSK)-3ß (1 : 25 dilution). The IgG concentration for GSK-3ß was 140 µg/ml and for pGSK-3ß was 53 µg/ml. The antibodies used are specific to the two ß isoforms of the protein and do not cross-react with GSK-3
but do cross-react with the human, rodent and rabbit GSK-3ß protein. For signal detection, we used the avidinbiotinperoxidase (ABC) technique with diaminobenzidine as the substrate. Sections were counterstained with haematoxylin. Negative control experiments were performed in all IHC studies by omitting the primary antibody and substituting it with normal rabbit serum. Positive control studies were performed with samples of adult rodent testes, shown previously to express GSK-3ß in both the early meiotic prophase (preleptotenes, leptotenes) and Sertoli cells of the seminiferous tubules (Guo et al., 2003
).
Cell culture
HES cells provided by Dr Douglas A. Kniss (The Ohio State University, Columbus, OH, USA) were cultured in Medium 199 (M199, GIBCO) supplemented with 10% fetal bovine serum, 10 mM L-glutamine and 0.5 mM L-Arg in a 5% CO2-humidified atmosphere. Cells were used after three passages. At the time of experiments, cells were detached by trypsinization. About 1 x 105 cells/well were plated into a six-well tissue culture plate and cultured in growth medium for 24 h. Experiments were carried out using at least 70% confluent cells in M199. After 24 h of serum starving, medium was replaced with experimental medium consisting of M199 with 2% charcoal-treated fetal bovine serum supplemented with 10 mM L-glutamine and 0.5 mM L-Arg. To determine the effects of progesterone and RU486 on GSK-3ß expression, cells were treated with vehicle or progesterone (10-8106 M) and harvested at 24 h. The progesterone antagonist RU486 (105 M) was added 2 h before the addition of progesterone. Control wells contained the vehicle diluent.
Statistical analysis
The WBA data comparing proliferative and secretory GSK-3ß levels were analysed by Students t-test. The culture data for either mRNA or protein were analysed by one-factor ANOVA followed by the StudentNewmanKeuls test for in between group comparisons. P values <0.05 were considered significant.
| Results |
|---|
|
|
|---|
Expression and distribution of total GSK-3ß in human female reproductive tissues
WBA (Figure 2A) showed the highest total GSK-3ß expression in the endometrium, followed by myometrium, ovary and Fallopian tubes. IHC analysis of the reproductive tract for GSK-3ß demonstrated expression in the endometrium (Figure 2D), ovary (Figure 2E) and Fallopian tubes (Figure 2F). Endometrial tissue showed staining predominantly in the glandular epithelial cells of the endometrium (Figure 2D). Staining was also observed in luteinized stromal cells of the ovary (Figure 2E ), epithelial cells and smooth muscle cells of the Fallopian tubes (Figure 2F). In the myometrium (data not shown), diffuse staining was noted in smooth muscle cells. The negative control showed no staining (Figure 2B), whereas the positive control (Figure 2C) showed the expected previously described GSK-3ß staining in seminiferous tubules and Sertoli cells (Guo et al., 2003
|
Comparative quantitative total and Ser9 GSK-3ß expression in human endometrium in various stages of the menstrual cycle
WBA for total and pGSK-3ß in endometria obtained from proliferative phase (n = 4) and secretory phase (n = 5) is shown in Figure 3A and B, respectively. The expression of total GSK-3ß protein did not vary throughout the menstrual cycle. However, expression of pGSK-3ß varied with more than a 5-fold increase in its expression in secretory phase samples as compared with the proliferative phase (Figure 3B) (P < 0.001). IHC analysis for GSK-3ß and pGSK-3ß was performed in endometria from various stages of the menstrual cycle. IHC analysis for total GSK-3ß demonstrated uniform staining of epithelial cells throughout the menstrual cycle (data not shown). Expression of pGSK-3ß was not uniformly detectable in controls irrespective of stage of the menstrual cycle (Figure 4 , panels B, C, F and J). Consistent with total GSK-3ß results, pGSK-3ß is restricted in its expression by IHC analysis to the epithelial compartment (Figure 4, panels GL), and consistent with western blotting, its expression in the proliferative phase epithelial cells is marginal (panels B and C) but peaks shortly after ovulation on day 17 secretory endometrium (panels H and M). Elevation is sustained but less pronounced in the late secretory phase (Figure 4, panels K, L and N).
|
|
In vitro studies: progesterone regulates GSK-3ß phosphorylation in HES cells
In cell culture experiments using HES cells, progesterone at doses of 106 and 108 M did not alter total GSK-3ß mRNA as determined by real-time RT-PCR (Figure 5A). Progesterone also did not alter total GSK-3
protein levels (data not shown) but stimulated pGSK-3ß protein expression (Figure 5B). This effect of progesterone could be blocked by the anti-progestin RU486 suggesting that inactivation of GSK-3ß through phosphorylation is mediated through progesterone and its receptor (Figure 5B). This experiment also indicates under basal conditions phosphorylation of a portion of GSK-3ß occurs and this can be further stimulated by progesterone.
|
| Discussion |
|---|
|
|
|---|
The hormonal control of endometrial receptivity is a complex process leading to changes in both the epithelial and the stromal compartments of the post-ovulatory endometrium. Some of these changes include the development of the post-ovulatory triad which includes the presence of giant mitochondria, subnuclear glycogen and a nuclear channel system (Noyes et al., 1950
GSK-3ß is expressed in reproductive tissues such as the Fallopian tube and ovary raising questions regarding its physiological role in these sites. Its homology to yeast meiotic regulators, its expression profile in the male testes at initiation of meiosis and its inhibition in vitro of S phase meiosis I implicate it in the initiation of meiosis in rodents (Guo et al., 2003
). Its expression profile in the female genital ridge (unpublished observation) could potentially implicate it in a similar role in the initiation of meiosis in female oocytes in utero. Others have reported that GSK-3ß inhibits progesterone-mediated Xenopus oocyte maturation (Fisher et al., 1999
; Nebreda and Ferby, 2000
) and that progesterone inactivates GSK-3ß in immature, G2-arrested Xenopus oocytes leading to their maturation and resumption of G2 to M transition of meiosis I. In this model, GSK-3ß is critical for the progesterone-mediated resumption of meiosis in arrested oocytes. These studies, along with our own, demonstrate the multifunctional role of GSK-3ß in a variety of reproductive tissues.
In summary, Wnt signalling and GSK-3ß are widely expressed in the female reproductive tract. Both Wnt and PI3-kinase/AKT signalling are regulated by E2 and progesterone and play important roles in the cyclical changes in the human endometrial epithelium. Here, we add to this body of knowledge showing that the GSK-3ß phosphorylated form shows cyclic variation in the endometrium and phosphorylation of GSK-3ß in the endometrium is regulated by progesterone and that this inhibtion of GSK-3ß is temporaly and cellularly coinicident with the increased glycogen synthesis in the luteal phase epithelium. Additional studies in patients with various causes of implantation failure should help define the physiological role of this enzyme in endometrial physiology and pathology.
| Acknowledgements |
|---|
This work was supported in part by NIH RO3HD41409-01 to O.K.
| References |
|---|
|
|
|---|
Bowdish KS and Mitchell AP (1993) Bipartite structure of an early meiotic upstream activation sequence from Saccharomyces cerevisiae. Mol Cell Biol 13,21722181.
Bowdish KS, Yuan HE and Mitchell AP (1994) Analysis of RIM11, a yeast protein kinase that phosphorylates the meiotic activator IME1. Mol Cell Biol 14,79097919.
Chen B, Pan H, Zhu L, Deng Y and Pollard JW (2005) Progesterone inhibits the estrogen-induced phospoinositide 3-kinase
AKT GSK-3beta CyclinD1
pRB pathway to block uterine epithelial cell proliferation. Mol Endocrinol 19,19781990.
Cohen P and Frame S (2001) The renaissance of GSK-3. Nat Rev Mol Cell Biol 2,769776.[CrossRef][Web of Science][Medline]
Cohen P and Goedert M (2004) GSK-3 inhibitors: development and therapeutic potential. Nat Rev Drug Discov 3,479487.[CrossRef][Web of Science][Medline]
Demir R, Kayisli UA, Celik-Ozenci C, Korgun ET, Demir-Weusten AY and Arici A (2002) Structural differentiation of human uterine luminal and glandular epithelium during early pregnancy: an ultrastructural and immunohistochemical study. Placenta 23,672684.[CrossRef][Web of Science][Medline]
Dockery P, Li TC and Rogers AW (1988) The ultrastructure of the glandular epithelium in the timed endometrial biopsy. Hum Reprod 3,826834.
Dominguez I and Green JB (2001) Missing links in GSK-3 regulation. Dev Biol 235,303313.[CrossRef][Web of Science][Medline]
Eldar-Finkelman H, Schreyer SA, Shinohara MM, LeBoeuf RC and Krebs EG (1999) Increased glycogen synthase kinase-3 activity in diabetes- and obesity-prone C57BL/6J mice. Diabetes 48,16621666.[Abstract]
Embi N, Rylatt DB and Cohen P (1980) Glycogen synthase kinase-3 from rabbit skeletal muscle. Separation from cyclic-AMP-dependent protein kinase and phosphorylase kinase. Eur J Biochem 107,519527.[Web of Science][Medline]
Ferrer JC, Favre C and Gomis RR (2003) Control of glycogen deposition. FEBS Lett 546,127132.[CrossRef][Web of Science][Medline]
Fisher DL, Morin N and Doree M (1999) A novel role for glycogen synthase kinase-3 in Xenopus development: maintenance of oocyte cell cycle arrest by a beta-catenin-independent mechanism. Development 126,567576.[Abstract]
Frame S and Cohen P (2001) GSK-3 takes centre stage more than 20 years after its discovery. Biochem J 359,116.[CrossRef][Web of Science][Medline]
Glueck CJ, Streicher P and Wang P (2002) Treatment of polycystic ovary syndrome with insulin-lowering agents. Expert Opin Pharmacother 3,11771189.[CrossRef][Medline]
Guo TB, Chan KC, Hakovirta H, Xiao Y, Toppari J, Mitchell AP and Salameh WA (2003) Evidence for a role of glycogen synthase kinase-3 beta in rodent spermatogenesis. J Androl 24,332342.
Hemmings BA, Yellowlees D, Kernohan JC and Cohen P (1981) Purification of glycogen synthase kinase 3 from rabbit skeletal muscle. Copurification with the activating factor (FA) of the (Mg-ATP) dependent protein phosphatase. Eur J Biochem 119,443451.[Web of Science][Medline]
Hou X, Tan Y, Li M, Dey SK and Das SK (2004) Canonical Wnt signaling is critical to estrogen mediated uterine growth. Mol Endocrinol 18,30353049.
Kim YB, Peroni OD, Aschenbach WG, Minokoshi Y, Kotani K, Zisman A, Kahn CR, Goodyear LJ and Kahn BB (2005) Muscle-specific deletion of the Glut4 glucose transporter alters multiple regulatory steps in glycogen metabolism. Mol Cell Biol 25,97139723.
Klein PS and Melton DA (1996) A molecular mechanism for the effect of lithium on development. Proc Natl Acad Sci USA 93,84558459.
Maeyama M, Sudo I, Saito K, Matsuo I and Nakahara K (1977) Glycogen estimation by a rapid enzymic method in very small samples of human endometrium: glycogen content in the endometrium of infertile patients during the menstrual cycle. Fertil Steril 28,159162.[Web of Science][Medline]
Malathi K, Xiao Y and Mitchell AP (1997) Interaction of yeast repressor-activator protein Ume6p with glycogen synthase kinase 3 homolog Rim11p. Mol Cell Biol 17,72307236.[Abstract]
Malathi K, Xiao Y and Mitchell AP (1999) Catalytic roles of yeast GSK-3beta/shaggy homolog Rim11p in meiotic activation. Genetics 153,11451152.
Milwidsky A, Palti Z and Gutman A (1980) Glycogen metabolism of the human endometrium. J Clin Endocrinol Metab 51,765770.
Moon RT, Brown JD and Torres M (1997) WNTs modulate cell fate and behavior during vertebrate development. Trends Genet 13,157162.[CrossRef][Web of Science][Medline]
Nebreda AR and Ferby I (2000) Regulation of the meiotic cell cycle in oocytes. Curr Opin Cell Biol 12,666675.[CrossRef][Web of Science][Medline]
Noyes RW, Hertig AT and Rock J (1950) Dating the endometrial biopsy. Fertil Steril 1,325.[Medline]
Robertson SA, Roberts CT, Farr KL, Dunn AR and Seamark RF (1999) Fertility impairment in granulocyte-macrophage colony-stimulating factor-deficient mice. Biol Reprod 60,251261.
Sarkissian M, Mendez R and Richter JD (2004) Progesterone and insulin stimulation of CPEB-dependent polyadenylation is regulated by Aurora A mediated uterine growth and glycogen synthase kinase-3. Genes Dev 18,4861.
Secchi J, Lecaque D, Tournemine C and Philibert D (1987) Early glycogenesis in the uterine glandular cells of the rabbit induced by progestins: a quantitative investigation. Cell Tissue Res 248,359364.[Web of Science][Medline]
Shapiro SS, Dyer SD and Colas AE (1980) Progesterone-induced glycogen accumulation in human endometrium during organ culture. Am J Obstet Gynecol 136,419425.[Web of Science][Medline]
Siegfried E and Perrimon N (1994) Drosophila wingless: a paradigm for the function and mechanism of Wnt signaling. Bioessays 16,395404.[CrossRef][Web of Science][Medline]
Siegfried E, Chou TB and Perrimon N (1992) Wingless signaling acts through zeste-white 3, the Drosophila homolog of glycogen synthase kinase-3, to regulate engrailed and establish cell fate. Cell 71,11671179.[CrossRef][Web of Science][Medline]
Souda Y, Fukuma K, Kawano T, Tanaka T, Matsuo I and Maeyama M (1985) Activities of glycogen synthetase and glycogen phosphorylase in the human endometrium: relative distribution in isolated glands and stroma. Am J Obstet Gynecol 153,100105.[Web of Science][Medline]
Stambolic V, Ruel L and Woodgett JR (1996) Lithium inhibits glycogen synthase kinase-3 activity and mimics wingless signalling in intact cells. Curr Biol 6,16641668.[CrossRef][Web of Science][Medline]
Su X, Schuler L and Shapiro S (1996) Cloning and characterization of a glycogen synthase cDNA from human endometrium. J Steroid Biochem Mol Biol 59,459465.[CrossRef][Web of Science][Medline]
Tulac S, Nayak NR, Kao LC, Van Waes M, Huang J, Lobo S, Germeyer A, Lessey BA, Taylor RN, Suchanek E et al. (2003) Identification, characterization, and regulation of the canonical Wnt signaling pathway in human endometrium. J Clin Endocrinol Metab 88,38603866.
Tulac S, Overgaard MT, Hamilton AE, Jumble NL, Suchanek E and Giudice LC (2006) Dickkopt-1, an inhibitor of Wnt signaling is regulated by progesterone in human endometrial stromal cells. J Clin Endocrinol Metab 91,14531461.
Woodgett JR (1990) Molecular cloning and expression of glycogen synthase kinase-3/factor A. EMBO J 9,24312438.[Web of Science][Medline]
Woodgett JR (1994) Regulation and functions of the glycogen synthase kinase-3 subfamily. Semin Cancer Biol 5,269275.[Web of Science][Medline]
Woodgett JR (2001) Judging a protein by more than its name: GSK-3. Sci STKE 2001,RE12.
Yang ZZ, Tschopp O, Hemmings-Mieszczak M, Feng J, Brodbeck D, Perentes E and Hemmings BA (2003) Protein kinase B alpha/Akt1 regulates placental development and fetal growth. J Biol Chem 278,3212432131.
Submitted on May 17, 2006; resubmitted on June 6, 2006; accepted on June 21, 2006.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S. Uzbekova, M. Salhab, C. Perreau, P. Mermillod, and J. Dupont Glycogen synthase kinase 3B in bovine oocytes and granulosa cells: possible involvement in meiosis during in vitro maturation Reproduction, August 1, 2009; 138(2): 235 - 246. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





