Skip Navigation


Mol. Hum. Reprod. Advance Access originally published online on August 1, 2006
Molecular Human Reproduction 2006 12(9):543-549; doi:10.1093/molehr/gal065
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
12/9/543    most recent
gal065v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Salameh, W.
Right arrow Articles by Khorram, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Salameh, W.
Right arrow Articles by Khorram, O.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2006. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Expression of endometrial glycogen synthase kinase-3ß protein throughout the menstrual cycle and its regulation by progesterone

Wael Salameh1,4, Jason P. Helliwell2, Guang Han2, Laron McPhaul3 and Omid Khorram2,5

1Department of Internal Medicine, 2Department of Obstetrics and Gynecology and 3Department of Pathology, Harbor-UCLA Medical Center, Torrance, CA, USA

4 Present address: Quest Diagnostics, San Juan Capistrano, CA, USA

5 To whom correspondence should be addressed at: Department of Obstetrics and Gynecology, Harbor-UCLA Medical Center, 1000 West Carson Street, Box 489, Torrance, CA, USA. E-mail: okhorram{at}obgyn.humc.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Glycogen synthase kinase-3ß (GSK-3ß) is a serine/threonine kinase that plays a role in glycogen synthesis by inhibiting glycogen synthase (GS) through phosphorylation. We hypothesized that GSK-3ß by virtue of its role in glycogen synthesis through the inhibition of GS will play a role in the preparation of the endometrium for blastocyst implantation. Immunohistochemical (IHC) analysis and Western blot analysis (WBA) detected GSK-3ß in the endometrium, myometrium, Fallopian tube and ovary. WBA showed more than 5-fold higher endometrial expression of the phosphorylated GSK-3ß (pGSK-3ß) isoform (inactive) in the secretory phase as compared with the proliferative phase (P < 0.001), whereas no differences in total GSK-3ß expression were detected. IHC analysis confirmed the WBA and showed marked expression of pGSK-3ß predominantly in glandular epithelial cells in early and mid secretory endometrium with scant expression during the proliferative phase. In in vitro experiments using human endometrial-derived epithelial cell line (HES), progesterone did not alter total GSK mRNA or protein expression. However, progesterone induced a dose-dependent increase in the expression of pGSK-3ß, which could be blocked by RU486. Cyclic expression of GSK-3ß’s active and inactive forms in the endometrium suggests that sex hormones regulate the expression of this enzyme. In vitro experiments demonstrate that progesterone through receptor-mediated mechanisms induces phosphorylation of endometrial GSK-3ß.

Key words: endometrium/glycogen synthase kinase-3ß/menstrual cycle/progesterone/RU486


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The process of implantation requires a hospitable uterine environment. One of the key metabolic changes that occurs during the peri-implantation period and throughout pregnancy in discrete cell populations in the placenta is the rise in endometrial glycogen content (Milwidsky et al., 1980Go). Although during implantation this is catalysed by glycogen synthase (GS) and is regulated by progesterone (Shapiro et al., 1980Go; Secchi et al., 1987Go; Su et al., 1996Go), it is conceivable that this same regulation is operative later in the decidualized epithelium and the placenta and that glycogen plays a critical role in ensuring the development of a full-term normal weight pregnancy (Robertson et al., 1999Go; Yang et al., 2003Go). One mechanism by which the activity of GS may be regulated is through its phosphorylation by the enzyme glycogen synthase kinase-3 (GSK-3), a multifunctional serine/threonine kinase ubiquitously expressed in eukaryotic cells and existing in mammals as two isoforms ({alpha} and ß) (Embi et al., 1980Go; Hemmings et al., 1981Go; Woodgett, 1990Go). Both isoforms through the phosphorylation of GS will render it inactive. Therefore, inhibition of GSK-3 isoforms is crucial for the activation of GS and the synthesis of glycogen.

The activity of GSK-3ß is controlled through two alternative canonical pathways, the first of which reviewed elsewhere (Moon et al., 1997Go; Cohen and Frame, 2001Go; Dominguez and Green, 2001Go; Frame and Cohen, 2001Go; Woodgett, 2001Go) is through Wnt signalling and leads to a non-phosphorylative inactivation of GSK-3ß, stabilization of ß-catenin and transcriptional activation of TCF/LEF-responsive genes. An alternative mechanism regulating predominantly the metabolic and cell survival functions of GSK-3ß is through an inactivating phosphorylation at serine 9 position for GSK-3ß and serine 21 for GSK-3{alpha} (Cohen and Frame, 2001Go; Dominguez and Green, 2001Go; Woodgett, 2001Go). Several kinases may mediate this phosphorylation including PKA, PKC and AKT (PKB). The role of insulin in the inactivation of GSK-3{alpha} and GSK-3ß and the subsequent increase in GS activity occurs through AKT (Cohen and Frame, 2001Go; Woodgett, 2001Go). Although most of the literature has concerned itself with the study of GSK-3ß, many but not all of the roles of GSK-3ß are shared with GSK-3{alpha}.

GSK-3ß is a highly conserved enzyme with key roles in numerous biological processes reviewed elsewhere (Cohen and Frame, 2001Go; Woodgett, 2001Go). Some of the most studied are its roles in glucose and energy homeostasis, cell fate decisions such as body patterning of the Drosophila embryo (Siegfried et al., 1992Go; Siegfried and Perrimon, 1994Go), formation of the ventral–dorsal axis in the Xenopus embryo (Woodgett, 1994Go; Klein and Melton, 1996Go; Stambolic et al., 1996Go; Moon et al., 1997Go) and regulation of meiotic entry in yeast and possibly rodents (Bowdish and Mitchell, 1993Go; Bowdish et al., 1994Go; Malathi et al., 1997Go, 1999Go; Guo et al., 2003Go). Interestingly, GSK-3ß inactivation is required and is rate limiting for progesterone-mediated Xenopus oocyte maturation (Fisher et al., 1999Go; Nebreda and Ferby, 2000Go). During oocyte maturation, both insulin and progesterone through non-genomic mechanisms induce serine phosphorylation and inactivation of GSK-3ß (Sarkissian et al., 2004Go). At the level of the endometrium, the actions of GSK-3ß are complex. Components of the Wnt-signalling pathway, with the exception of GSK-3ß, are regulated transcriptionally in the various phases of the menstrual cycle suggesting a role in peri-implantation events (Tulac et al., 2003Go). Aside from a role in uterine development, canonical Wnt signalling with inhibition of GSK-3ß and nuclear translocation of ß-catenin is essential for the estrogen receptor (ER)-independent estrogen-regulated growth of epithelial cells of the endometrium (Hou et al., 2004Go). Other evidence suggests opposing effects of estradiol (E2) and progesterone through the PI3-kinase-AKT-Ser-9 inactivation of GSK-3ß on the proliferation of endometrial epithelial cells (Chen et al., 2005Go). Additionally, progesterone up-regulates Dickkopf-1 (DKK-1), a potent inhibitor of Wnt signalling in the stromal cells of the secretory phase human endometrium (Tulac et al., 2006Go).

The purpose of this study was to extend our knowledge of the role of these pathways in decidualization of the human endometrium and to test the hypothesis schematically depicted in Figure 1). On the basis of this hypothesis, progesterone regulates the activity of GSK-3ß through phosphorylation, such that during the secretory phase when expected implantation occurs and endometrial glycogen stores are high, a greater proportion of GSK-3ß is in the inactive (phosphorylated) form. This would result in a greater proportion of GS to be in the non-phosphorylated (active) state and hence would lead to increased glycogenesis. To test this hypothesis, we determined the endometrial expression of the inactive and total (predominantly active) forms of GSK-3ß throughout the menstrual cycle and examined the influence of progesterone and its antagonist RU486 on in vitro expression of both forms of the enzyme in cultured endometrial [human endometrial-derived epithelial cell line (HES)] cell line. Our data confirm our hypothesis that progesterone through its receptor facilitates glycogen synthesis in the secretory phase human endometrium through the phosphorylative inhibition of GSK-3ß.


Figure 1
View larger version (17K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1. Schematic depiction of the hypothesis linking progesterone regulation of glycogen synthase kinase-3ß (GSK-3ß) phosphorylation and its influence on endometrial glycogen synthesis.

 


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Specimens
Tissues used for this study were collected at two institutions including the University of Wisconsin, Madison, and Harbor-UCLA Medical Center Torrance. Institutional Review Board (IRB) approval at both institutions was obtained. In the case of tissues for WBA, samples were obtained from premenopausal women undergoing hysterectomy for benign gynaecologic indications, including pelvic organ prolapse, symptomatic myoma and dysmenorrhoea. The mean ages of these women were 36 and 39 years for proliferative and secretory phase, respectively. Tissues used in the immunohistochemical studies were provided by the department of Pathology at Harbor-UCLA Medical Center and were derived from women undergoing surgery for benign gynaecologic indications. Histological dating of tissues was done according to the criteria of Noyes et al. (1950)Go.

Real-time RT–PCR
For real-time PCR, cDNA was generated with 0.5 µg of total RNA using Omniscript Reverse Transcription (RT) reagent (QIAGEN). The RNA was incubated in 20 µl of a RT reaction mixture [x1 RT buffer, 0.5 mM dNTP, 1 µM random hexamers, 10 U Rnasin (RNase inhibitor) and 4 U Omniscript reverse transcriptase] at 37°C for 1 h. The reverse transcriptase was inactivated by heating at 95°C for 5 min. PCR was performed in 96-well optical reaction plates (Applied Biosystems) on cDNA equivalent to 25 ng RNA in a volume of 25 µl, containing x1 reaction buffer (EUROGENTEC); forward and reverse appropriate primers were selected from Assay on Demand (Applied Biosystems). Real-time PCR was performed for GSK and glyceraldehyde-3-phosphatedehydrogenase (GAPDH) gene, using the ABI-Prism 7700 Sequence System (Applied Biosystems) using the following conditions: 10 min at 95°C for one cycle and 15 s at 95°C, 1 min at 60°C for 40 cycles. Primer sequences for GSK were as follows: GSK sense: 5'ATTACGGGACCCAAATGTCA3'; GSK antisense: 5'ATTGGTCTGTCCACGGTCTC3'; GAPDH sense: 5'ATC ACTGCCACCCAGAAGACT3'; GAPDH antisense: 5'CATGCCACTGAG CTTCCCGTT3'.

Control PCR was done with water replacing cDNA. All the controls gave a threshold cycle (CT) value of 40, indicating no detectable PCR product under these cycle conditions. ABI Sequence Detection System 1.6 software (Applied Biosystems) was used to determine the cycle number at which fluorescence emission crossed the automatically determined threshold level (CT). All samples were run in triplicate.

The cycle at which each reaction reached threshold fluorescence was defined as the CT for that reaction. The results were analysed using comparative method and the values were normalized to GAPDH RNA expression by subtracting mean CT of GAPDH from mean target CT for each sample, to obtain the mean {Delta}CT. The mean {Delta}CT values were then converted into fold change based on a doubling of PCR product in each PCR cycle, according to the manufacturer’s guidelines.

WBA
Cells and tissue were sonicated in protein lysis buffer and protein concentrations determined by the BCA Protein Assay kit (Pierce, Rockford, IL, USA). For each sample, 35 µg of protein was separated on a 7.5% polyacrylamide gel. The separated proteins were transferred electrophoretically to Immobilon-P membranes (Millipore Corp., New Bedford, MA, USA). Membranes were blocked for 2 h in a 5% milk buffer before overnight incubation with GSK-3ß and phospho-GSK-3ß antibodies at primary dilution of 1 : 1000 (Cell Signaling Technology, Inc., Beverly, MA). The blots were subjected to enhanced chemiluminescence (ECL Western Blotting Detection System, Amersham Corp., Arlington Heights, IL, USA), with enzyme conjugate anti-mouse IgG horseradish peroxidase as a secondary antibody. Blots were then exposed to autoradiography film. The resulting bands corresponding to ~48 kDa were compared by scanning densitometry. To ensure equal loading, we stripped protein blots and reprobed them for GAPDH.

Immunohistochemistry
Tissues were fixed in formalin and embedded in paraffin, and 5 µm sections were cut and mounted onto slides. Sections were then de-paraffinized, rehydrated and pre-incubated with 3% horse serum in phosphate-buffered saline (PBS) for 20 min, followed by 4 h of incubation at room temperature with affinity-purified polyclonal antibodies (Cell Signaling Technology, Inc., Beverly, MA, USA) to total GSK-3ß (1 : 50 dilution) and phosphorylated GSK-3ß (pGSK)-3ß (1 : 25 dilution). The IgG concentration for GSK-3ß was 140 µg/ml and for pGSK-3ß was 53 µg/ml. The antibodies used are specific to the two ß isoforms of the protein and do not cross-react with GSK-3{alpha} but do cross-react with the human, rodent and rabbit GSK-3ß protein. For signal detection, we used the avidin–biotin–peroxidase (ABC) technique with diaminobenzidine as the substrate. Sections were counterstained with haematoxylin. Negative control experiments were performed in all IHC studies by omitting the primary antibody and substituting it with normal rabbit serum. Positive control studies were performed with samples of adult rodent testes, shown previously to express GSK-3ß in both the early meiotic prophase (preleptotenes, leptotenes) and Sertoli cells of the seminiferous tubules (Guo et al., 2003Go).

Cell culture
HES cells provided by Dr Douglas A. Kniss (The Ohio State University, Columbus, OH, USA) were cultured in Medium 199 (M199, GIBCO) supplemented with 10% fetal bovine serum, 10 mM L-glutamine and 0.5 mM L-Arg in a 5% CO2-humidified atmosphere. Cells were used after three passages. At the time of experiments, cells were detached by trypsinization. About 1 x 105 cells/well were plated into a six-well tissue culture plate and cultured in growth medium for 24 h. Experiments were carried out using at least 70% confluent cells in M199. After 24 h of serum starving, medium was replaced with experimental medium consisting of M199 with 2% charcoal-treated fetal bovine serum supplemented with 10 mM L-glutamine and 0.5 mM L-Arg. To determine the effects of progesterone and RU486 on GSK-3ß expression, cells were treated with vehicle or progesterone (10-8–10–6 M) and harvested at 24 h. The progesterone antagonist RU486 (10–5 M) was added 2 h before the addition of progesterone. Control wells contained the vehicle diluent.

Statistical analysis
The WBA data comparing proliferative and secretory GSK-3ß levels were analysed by Student’s t-test. The culture data for either mRNA or protein were analysed by one-factor ANOVA followed by the Student–Newman–Keuls test for in between group comparisons. P values <0.05 were considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Expression and distribution of total GSK-3ß in human female reproductive tissues
WBA (Figure 2A) showed the highest total GSK-3ß expression in the endometrium, followed by myometrium, ovary and Fallopian tubes. IHC analysis of the reproductive tract for GSK-3ß demonstrated expression in the endometrium (Figure 2D), ovary (Figure 2E) and Fallopian tubes (Figure 2F). Endometrial tissue showed staining predominantly in the glandular epithelial cells of the endometrium (Figure 2D). Staining was also observed in luteinized stromal cells of the ovary (Figure 2E ), epithelial cells and smooth muscle cells of the Fallopian tubes (Figure 2F). In the myometrium (data not shown), diffuse staining was noted in smooth muscle cells. The negative control showed no staining (Figure 2B), whereas the positive control (Figure 2C) showed the expected previously described GSK-3ß staining in seminiferous tubules and Sertoli cells (Guo et al., 2003Go).


Figure 2
View larger version (76K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2. (A) Western blot analysis of glycogen synthase kinase-3ß (GSK-3ß) throughout the reproductive tract. Lane 1, post-menopausal ovary; lane 2, premenopausal endometrium;lane3,premenopausal ovary; lane 4, premenopausal Fallopian tube; lane 5, premenopausal myometrium; lane 6, perimenopausal endometrium; lane 7, post-menopausal myometrium; lane 8, post-menopausal endometrium; and lane 9, endometrioma. (B–F) Localization of GSK-3Bß in various tissues (brown colour indicates positive staining). (B) Rat testis negative control (x20). (C) Rat testis positive control, arrow indicates seminiferous tubules (x20). (D) Premenopausal secretory endometrium. (E) Ovary, arrow indicates luteinized stromal cells (x40). (F) Premenopausal Fallopian tube (x20).

 

Comparative quantitative total and Ser9 GSK-3ß expression in human endometrium in various stages of the menstrual cycle
WBA for total and pGSK-3ß in endometria obtained from proliferative phase (n = 4) and secretory phase (n = 5) is shown in Figure 3A and B, respectively. The expression of total GSK-3ß protein did not vary throughout the menstrual cycle. However, expression of pGSK-3ß varied with more than a 5-fold increase in its expression in secretory phase samples as compared with the proliferative phase (Figure 3B) (P < 0.001). IHC analysis for GSK-3ß and pGSK-3ß was performed in endometria from various stages of the menstrual cycle. IHC analysis for total GSK-3ß demonstrated uniform staining of epithelial cells throughout the menstrual cycle (data not shown). Expression of pGSK-3ß was not uniformly detectable in controls irrespective of stage of the menstrual cycle (Figure 4 , panels B, C, F and J). Consistent with total GSK-3ß results, pGSK-3ß is restricted in its expression by IHC analysis to the epithelial compartment (Figure 4, panels G–L), and consistent with western blotting, its expression in the proliferative phase epithelial cells is marginal (panels B and C) but peaks shortly after ovulation on day 17 secretory endometrium (panels H and M). Elevation is sustained but less pronounced in the late secretory phase (Figure 4, panels K, L and N).


Figure 3
View larger version (17K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 3. Western blot analysis showing expression of glycogen synthase kinase-3ß (GSK-3ß) (top panel) and phospho-GSK-3ß (bottom panel) in the endometrium during the menstrual cycle. Lanes 1–4, proliferative phase; lanes 5–10, secretory phase; and lane 11, menstrual phase. The bar plots represent mean ± SEM of GSK-3ß and pGSK-3ß band density from the proliferative (Prolif) and secretory (Sec) phase. **P < 0.001.

 

Figure 4
View larger version (122K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 4. Immunohistochemical localization of phosphorylated glycogen synthase kinase-3ß (pGSK-3ß) in the endometrium during various stages of the menstrual cycle. Panels A–D, proliferative phase endometrium; panels E–H, early secretory endometrium; panels I–L, late secretory endometrium. Panels A, C, E, G, I and K are x10, whereas B, D, F, G, H and L are x20 magnification. Panels A, B, E, F, I and J are negative controls (no primary antibody added). Comparison of panels C and D (proliferative phase) with G, H (early secretory) and K, L (late secretory) shows the increase in staining intensity in Ser-9 GSK-3ß during the secretory phase. Panels M and N are close-ups of panels H and L to show histologic detail and confinement of the staining to the epithelium.

 

In vitro studies: progesterone regulates GSK-3ß phosphorylation in HES cells
In cell culture experiments using HES cells, progesterone at doses of 10–6 and 10–8 M did not alter total GSK-3ß mRNA as determined by real-time RT-PCR (Figure 5A). Progesterone also did not alter total GSK-3{alpha} protein levels (data not shown) but stimulated pGSK-3ß protein expression (Figure 5B). This effect of progesterone could be blocked by the anti-progestin RU486 suggesting that inactivation of GSK-3ß through phosphorylation is mediated through progesterone and its receptor (Figure 5B). This experiment also indicates under basal conditions phosphorylation of a portion of GSK-3ß occurs and this can be further stimulated by progesterone.


Figure 5
View larger version (29K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 5. (A) Representative bar graph of the effect of various concentrations of progesterone (P4) or control vehicle (CON) with and without RU486 on phosphorylated glycogen synthase kinase-3ß (pGSK-3ß) expression in HES cells as determined by WBA. (B) Western blots and the summarized data expressed as mean band densities (±SEM) from two separate experiments demonstrating the effects of P4 with and without RU486. Control (n = 9) and n = 5 for all other treatment groups. *P < 0.05 versus control.

 


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The hormonal control of endometrial receptivity is a complex process leading to changes in both the epithelial and the stromal compartments of the post-ovulatory endometrium. Some of these changes include the development of the post-ovulatory triad which includes the presence of giant mitochondria, subnuclear glycogen and a nuclear channel system (Noyes et al., 1950Go; Dockery et al., 1988Go; Demir et al., 2002Go). Although it is generally accepted that the glycogen secretion in the secretory endometrium is under hormonal control, little is known about the mechanism of this control and the implantation process. More is known about the regulation of glycogen synthesis post-implantation and its critical role in rodent early pregnancy. Recently, AKT2 (PKB), one of the most prominent regulators of inactivation of GSK-3ß through serine phosphorylation, was implicated in the regulation of glycogen synthesis. In AKT2-deficient mice, there is loss of ‘glycogen’ cells in the syncytiotrophoblast, leading to placental malfunction, fetal growth impairment and premature pregnancy loss (Yang et al., 2003Go). This study demonstrates that GSK-3ß protein is expressed throughout the reproductive tract with the greatest expression in the endometrium. Furthermore, both IHC analysis and WBA showed that although total GSK-3ß protein and mRNA expression does not show cyclic variation, the phosphorylated form of the enzyme varies during the cycle, with significantly higher expression during the secretory phase when progesterone levels are known to be elevated. The lack of menstrual cycle variance in total GSK-3ß mRNA/protein expression is in agreement with the findings of Tulac et al. (2003Go). Our in vitro studies indicate that progesterone although unable to activate transcriptional events leading to the increase in GSK-3ß mRNA steady state or the translated total protein levels can directly act on the endometrial cells to up-regulate through post-translational modification the expression of phosphorylated GSK-3ß. These data support the hypothesis that progesterone induces the phosphorylation of GSK-3ß thereby rendering it inactive. Active GSK-3ß inactivates through phosphorylation the rate-limiting enzyme in glycogen synthesis, GS at three distinct residues (Ferrer et al., 2003Go). Inactivation of GSK-3ß would relieve inhibition of GS leading to greater glycogen synthesis during the secretory phase. On the basis of our proposed model (Figure 1), aberrations in the inactivation of GSK-3ß could result in inadequate glycogen production and potentially failure of implantation. The endometrial glycogen content is an important determinant of fertility, and earlier studies showed decreased endometrial glycogen stores in a subset of infertility patients (Maeyama et al., 1977Go). It may be speculated that the lower endometrial glycogen levels in these patients could be secondary to defects in GSK-3ß phosphorylation. Another condition in which altered GSK-3ß phosphorylation could be causing infertility is in patients with polycystic ovary syndrome (PCOS) with hyperinsulinaemia. Insulin is known to down-regulate GSK-3ß activity through Ser-9 phosphorylation in fat, liver and muscle tissues in diabetes- and obesity-prone C57BL/6J mice (Eldar-Finkelman et al., 1999Go). We speculate that insulin resistance along with anovulation and absence of luteal phase progesterone in patients with PCOS could blunt the endometrial expression of pGSK-3ß in luteal phase along with glycogen synthesis and contribute to the higher incidence of implantation failures previously reported in these patients (Glueck et al., 2002Go). Modulators of GSK-3ß, which have recently become available (Cohen and Goedert, 2004Go) if made clinically available, could provide a means for manipulating endometrial GSK-3ß and correcting defects in its expression. Although our present work has focused on the role of GSK-3ß in glycogen metabolism in the secretory endometrium, this kinase has many other downstream substrates (Cohen and Frame, 2001Go) including transcription factors and proteins involved in both cell cycle regulation and apoptosis. We cannot exclude other consequences of progesterone-mediated inactivation of GSK-3ß in the secretory human endometrium. It has been previously shown that the activity of the GS is 3-fold higher in the glandular versus the stromal cells of the human luteal phase endometrium and a strong expression of glycogen phosphorylase is present in the stroma (Souda et al., 1985Go). Although GSK-3ß is the dominant regulator of GS, other factors contribute to its regulation. In mice lacking Glut4 glucose transporter, GS is regulated positively through a variety of factors such as hexokinase II, glucose-6-phosphate and a simultaneous decrease in the activity of glycogen phosphorylase (Kim et al., 2005Go). These data together with the apparent absence of pGSK-3ß in the stromal cells of the endometrium suggest differential mechanisms of regulation of glycogen synthesis in each of these cell types.

GSK-3ß is expressed in reproductive tissues such as the Fallopian tube and ovary raising questions regarding its physiological role in these sites. Its homology to yeast meiotic regulators, its expression profile in the male testes at initiation of meiosis and its inhibition in vitro of S phase meiosis I implicate it in the initiation of meiosis in rodents (Guo et al., 2003Go). Its expression profile in the female genital ridge (unpublished observation) could potentially implicate it in a similar role in the initiation of meiosis in female oocytes in utero. Others have reported that GSK-3ß inhibits progesterone-mediated Xenopus oocyte maturation (Fisher et al., 1999Go; Nebreda and Ferby, 2000Go) and that progesterone inactivates GSK-3ß in immature, G2-arrested Xenopus oocytes leading to their maturation and resumption of G2 to M transition of meiosis I. In this model, GSK-3ß is critical for the progesterone-mediated resumption of meiosis in arrested oocytes. These studies, along with our own, demonstrate the multifunctional role of GSK-3ß in a variety of reproductive tissues.

In summary, Wnt signalling and GSK-3ß are widely expressed in the female reproductive tract. Both Wnt and PI3-kinase/AKT signalling are regulated by E2 and progesterone and play important roles in the cyclical changes in the human endometrial epithelium. Here, we add to this body of knowledge showing that the GSK-3ß phosphorylated form shows cyclic variation in the endometrium and phosphorylation of GSK-3ß in the endometrium is regulated by progesterone and that this inhibtion of GSK-3ß is temporaly and cellularly coinicident with the increased glycogen synthesis in the luteal phase epithelium. Additional studies in patients with various causes of implantation failure should help define the physiological role of this enzyme in endometrial physiology and pathology.


    Acknowledgements
 
This work was supported in part by NIH RO3HD41409-01 to O.K.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Bowdish KS and Mitchell AP (1993) Bipartite structure of an early meiotic upstream activation sequence from Saccharomyces cerevisiae. Mol Cell Biol 13,2172–2181.[Abstract/Free Full Text]

Bowdish KS, Yuan HE and Mitchell AP (1994) Analysis of RIM11, a yeast protein kinase that phosphorylates the meiotic activator IME1. Mol Cell Biol 14,7909–7919.[Abstract/Free Full Text]

Chen B, Pan H, Zhu L, Deng Y and Pollard JW (2005) Progesterone inhibits the estrogen-induced phospoinositide 3-kinase->AKT – GSK-3beta – CyclinD1->pRB pathway to block uterine epithelial cell proliferation. Mol Endocrinol 19,1978–1990.[Abstract/Free Full Text]

Cohen P and Frame S (2001) The renaissance of GSK-3. Nat Rev Mol Cell Biol 2,769–776.[CrossRef][ISI][Medline]

Cohen P and Goedert M (2004) GSK-3 inhibitors: development and therapeutic potential. Nat Rev Drug Discov 3,479–487.[CrossRef][ISI][Medline]

Demir R, Kayisli UA, Celik-Ozenci C, Korgun ET, Demir-Weusten AY and Arici A (2002) Structural differentiation of human uterine luminal and glandular epithelium during early pregnancy: an ultrastructural and immunohistochemical study. Placenta 23,672–684.[CrossRef][ISI][Medline]

Dockery P, Li TC and Rogers AW (1988) The ultrastructure of the glandular epithelium in the timed endometrial biopsy. Hum Reprod 3,826–834.[Abstract/Free Full Text]

Dominguez I and Green JB (2001) Missing links in GSK-3 regulation. Dev Biol 235,303–313.[CrossRef][ISI][Medline]

Eldar-Finkelman H, Schreyer SA, Shinohara MM, LeBoeuf RC and Krebs EG (1999) Increased glycogen synthase kinase-3 activity in diabetes- and obesity-prone C57BL/6J mice. Diabetes 48,1662–1666.[Abstract]

Embi N, Rylatt DB and Cohen P (1980) Glycogen synthase kinase-3 from rabbit skeletal muscle. Separation from cyclic-AMP-dependent protein kinase and phosphorylase kinase. Eur J Biochem 107,519–527.[ISI][Medline]

Ferrer JC, Favre C and Gomis RR (2003) Control of glycogen deposition. FEBS Lett 546,127–132.[CrossRef][ISI][Medline]

Fisher DL, Morin N and Doree M (1999) A novel role for glycogen synthase kinase-3 in Xenopus development: maintenance of oocyte cell cycle arrest by a beta-catenin-independent mechanism. Development 126,567–576.[Abstract]

Frame S and Cohen P (2001) GSK-3 takes centre stage more than 20 years after its discovery. Biochem J 359,1–16.[CrossRef][ISI][Medline]

Glueck CJ, Streicher P and Wang P (2002) Treatment of polycystic ovary syndrome with insulin-lowering agents. Expert Opin Pharmacother 3,1177–1189.[CrossRef][Medline]

Guo TB, Chan KC, Hakovirta H, Xiao Y, Toppari J, Mitchell AP and Salameh WA (2003) Evidence for a role of glycogen synthase kinase-3 beta in rodent spermatogenesis. J Androl 24,332–342.[Abstract/Free Full Text]

Hemmings BA, Yellowlees D, Kernohan JC and Cohen P (1981) Purification of glycogen synthase kinase 3 from rabbit skeletal muscle. Copurification with the activating factor (FA) of the (Mg-ATP) dependent protein phosphatase. Eur J Biochem 119,443–451.[ISI][Medline]

Hou X, Tan Y, Li M, Dey SK and Das SK (2004) Canonical Wnt signaling is critical to estrogen mediated uterine growth. Mol Endocrinol 18,3035–3049.[Abstract/Free Full Text]

Kim YB, Peroni OD, Aschenbach WG, Minokoshi Y, Kotani K, Zisman A, Kahn CR, Goodyear LJ and Kahn BB (2005) Muscle-specific deletion of the Glut4 glucose transporter alters multiple regulatory steps in glycogen metabolism. Mol Cell Biol 25,9713–9723.[Abstract/Free Full Text]

Klein PS and Melton DA (1996) A molecular mechanism for the effect of lithium on development. Proc Natl Acad Sci USA 93,8455–8459.[Abstract/Free Full Text]

Maeyama M, Sudo I, Saito K, Matsuo I and Nakahara K (1977) Glycogen estimation by a rapid enzymic method in very small samples of human endometrium: glycogen content in the endometrium of infertile patients during the menstrual cycle. Fertil Steril 28,159–162.[ISI][Medline]

Malathi K, Xiao Y and Mitchell AP (1997) Interaction of yeast repressor-activator protein Ume6p with glycogen synthase kinase 3 homolog Rim11p. Mol Cell Biol 17,7230–7236.[Abstract]

Malathi K, Xiao Y and Mitchell AP (1999) Catalytic roles of yeast GSK-3beta/shaggy homolog Rim11p in meiotic activation. Genetics 153,1145–1152.[Abstract/Free Full Text]

Milwidsky A, Palti Z and Gutman A (1980) Glycogen metabolism of the human endometrium. J Clin Endocrinol Metab 51,765–770.[Abstract]

Moon RT, Brown JD and Torres M (1997) WNTs modulate cell fate and behavior during vertebrate development. Trends Genet 13,157–162.[CrossRef][ISI][Medline]

Nebreda AR and Ferby I (2000) Regulation of the meiotic cell cycle in oocytes. Curr Opin Cell Biol 12,666–675.[CrossRef][ISI][Medline]

Noyes RW, Hertig AT and Rock J (1950) Dating the endometrial biopsy. Fertil Steril 1,3–25.[Medline]

Robertson SA, Roberts CT, Farr KL, Dunn AR and Seamark RF (1999) Fertility impairment in granulocyte-macrophage colony-stimulating factor-deficient mice. Biol Reprod 60,251–261.[Abstract/Free Full Text]

Sarkissian M, Mendez R and Richter JD (2004) Progesterone and insulin stimulation of CPEB-dependent polyadenylation is regulated by Aurora A mediated uterine growth and glycogen synthase kinase-3. Genes Dev 18,48–61.[Abstract/Free Full Text]

Secchi J, Lecaque D, Tournemine C and Philibert D (1987) Early glycogenesis in the uterine glandular cells of the rabbit induced by progestins: a quantitative investigation. Cell Tissue Res 248,359–364.[ISI][Medline]

Shapiro SS, Dyer SD and Colas AE (1980) Progesterone-induced glycogen accumulation in human endometrium during organ culture. Am J Obstet Gynecol 136,419–425.[ISI][Medline]

Siegfried E and Perrimon N (1994) Drosophila wingless: a paradigm for the function and mechanism of Wnt signaling. Bioessays 16,395–404.[CrossRef][ISI][Medline]

Siegfried E, Chou TB and Perrimon N (1992) Wingless signaling acts through zeste-white 3, the Drosophila homolog of glycogen synthase kinase-3, to regulate engrailed and establish cell fate. Cell 71,1167–1179.[CrossRef][ISI][Medline]

Souda Y, Fukuma K, Kawano T, Tanaka T, Matsuo I and Maeyama M (1985) Activities of glycogen synthetase and glycogen phosphorylase in the human endometrium: relative distribution in isolated glands and stroma. Am J Obstet Gynecol 153,100–105.[ISI][Medline]

Stambolic V, Ruel L and Woodgett JR (1996) Lithium inhibits glycogen synthase kinase-3 activity and mimics wingless signalling in intact cells. Curr Biol 6,1664–1668.[CrossRef][ISI][Medline]

Su X, Schuler L and Shapiro S (1996) Cloning and characterization of a glycogen synthase cDNA from human endometrium. J Steroid Biochem Mol Biol 59,459–465.[CrossRef][ISI][Medline]

Tulac S, Nayak NR, Kao LC, Van Waes M, Huang J, Lobo S, Germeyer A, Lessey BA, Taylor RN, Suchanek E et al. (2003) Identification, characterization, and regulation of the canonical Wnt signaling pathway in human endometrium. J Clin Endocrinol Metab 88,3860–3866.[Abstract/Free Full Text]

Tulac S, Overgaard MT, Hamilton AE, Jumble NL, Suchanek E and Giudice LC (2006) Dickkopt-1, an inhibitor of Wnt signaling is regulated by progesterone in human endometrial stromal cells. J Clin Endocrinol Metab 91,1453–1461.[Abstract/Free Full Text]

Woodgett JR (1990) Molecular cloning and expression of glycogen synthase kinase-3/factor A. EMBO J 9,2431–2438.[ISI][Medline]

Woodgett JR (1994) Regulation and functions of the glycogen synthase kinase-3 subfamily. Semin Cancer Biol 5,269–275.[ISI][Medline]

Woodgett JR (2001) Judging a protein by more than its name: GSK-3. Sci STKE 2001,RE12.

Yang ZZ, Tschopp O, Hemmings-Mieszczak M, Feng J, Brodbeck D, Perentes E and Hemmings BA (2003) Protein kinase B alpha/Akt1 regulates placental development and fetal growth. J Biol Chem 278,32124–32131.[Abstract/Free Full Text]

Submitted on May 17, 2006; resubmitted on June 6, 2006; accepted on June 21, 2006.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
12/9/543    most recent
gal065v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Salameh, W.
Right arrow Articles by Khorram, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Salameh, W.
Right arrow Articles by Khorram, O.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?