Mol. Hum. Reprod. Advance Access originally published online on July 4, 2006
Molecular Human Reproduction 2006 12(9):587-591; doi:10.1093/molehr/gal052
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Quantitation of fetal DNA in maternal serum during the first trimester of pregnancy by the use of a DAZ repetitive probe
1Department of Medical Genetics, University of Modena, Modena, 2Genomic Research Centre, Cante di Montevecchio Association O.N.L.U.S., Fano (PU) and 3Department of Obstetrics and Gynecology, University of Modena, Modena, Italy
4 To whom correspondence should be addressed at: Department of Medical Genetics, University of Modena, Via del Pozzo 71, Modena 41100, Italy. E-mail: percesepe.antonio{at}unimo.it
| Abstract |
|---|
|
|
|---|
Cell-free fetal DNA in maternal plasma or serum is at present widely investigated as a source of fetal genetic material, both in studies of pregnancy-related disorders and in planning strategies for non-invasive prenatal diagnosis. Despite the number of trials already performed on the quantitation of fetal DNA, data about the amount of DNA at the beginning of pregnancy, in particular in the first trimester, remain limited. A new probe mapping on the deleted in azoospermia (DAZ) repetitive region of the Yq chromosome was designed for an early assessment of fetal DNA concentration in maternal serum. Among 57 pregnant women prospectively studied in their first trimester, fetal DNA was detected already by the 5th gestational week, with the analysis becoming reliable by the 8th week of gestation when a 100% accuracy in fetal sex determination was achieved. Moreover, in the three cases of pregnancy ending in fetal loss, the amount of fetal DNA apparently decreased before the abortion was diagnosed, whereas it consistently showed an increasing trend in normal pregnancies. Real-time PCR with the use of DAZ multilocus probe can efficiently quantitate free fetal DNA in the maternal serum at the beginning of pregnancy.
Key words: DAZ repetitive probe/fetal DNA quantitation
| Introduction |
|---|
|
|
|---|
In the search for strategies of non-invasive prenatal diagnosis, several procedures based on the analysis of fetal material in the maternal bloodstream have been established in the effort to avoid the risks involved with routine techniques of sampling. Fetal cells first (Bianchi et al., 1990
Recently, data accrued in normal gestations, correlating the amount of fetal DNA in the maternal plasma/serum with the progression of the pregnancy, have demonstrated the reliability of real-time PCR amplification of Y-chromosome sequences in the detection and quantification of fetal DNA starting from the 5th week of gestation (Rijnders et al., 2003
; Birch et al., 2005
; Galbiati et al., 2005
). Using PCR tests on single genes, such as SRY, several studies have reported high detection sensitivity rates (above 95%) also in the first trimester of pregnancy, with specificity approaching 100% (Sekizawa et al., 2001a
; Birch et al., 2005
); however, a multicentre study has shown a high rate of sensitivity variation among laboratories, ranging from 31 to 97% in the detection of male fetuses, also due to different DNA extraction yields (Johnson et al., 2004
). For increasing the reproducibility of quantitative measurements of the low copy number of fetal DNA in the first trimester of pregnancy, two groups have used probes annealing to multiple sequences mapping on the Y chromosome (such as DYS14 and DYZ3), first with conventional PCR techniques, achieving 95% sensitivity rates already in the first trimester (Honda et al., 2001
; Honda et al., 2002
), secondly with real-time PCR, demonstrating a 10-fold lower detection threshold compared to the single-copy sequences used in the previous studies (Zimmermann et al., 2005
). In the present article, we report the results achieved using an optimized DNA extraction protocol and real-time PCR with a new multiple probe (DAZ4M8), mapping on a 2.4-Kb repetitive sequence in each of the four DAZ [deleted in azoospermia] genes (Saxena et al., 2000
) on the Yq chromosome to analyse when at first fetal DNA can be reliably detected in the maternal blood and to determine the amount of DNA in the different weeks of gestation.
| Materials and methods |
|---|
|
|
|---|
Setting of the probe
To detect and to quantify fetal DNA in the maternal serum of pregnant women, DAZ sequences were used by designing a multilocus probe (DAZ4M8) with a conjugated minor groove binder (MGB, Applied Biosystem, Foster City, CA, USA). The MGB allows the creation of stable duplexes with single-stranded DNA targets, thus increasing sequence specificity at PCR extension temperatures (Kutyavin et al., 2000
Primers and probe were designed as follows: forward GCAACCTTTCTTTTCAGCCATT, reverse TGATATCCAGCAGTGACCTGAAAT, TaqMan probe CTGCTTATCCAAGATC, spanning a 67 bp length on the Y-repetitive sequences and labelled with 6-carboxyfluorescein (FAM). The shorter length of our probe compared to those commonly used represents a major advantage in reactions where the template is highly fragmented (in the maternal blood 70% of fetal DNA is shorter than 300 bp) (Li et al., 2004
).
According to BLAT search (http://genome.ucsc.edu/cgi-bin/hgBlat), the primer pair for DAZ4M8 produces five amplicons with 100% identity, mapping on the 2.4-Kb repetitive motifs of the DAZ gene region (one for each of DAZ1, DAZ2 and DAZ3 and two for DAZ4).
Sample accrual
The possibility that the variability of the DAZ region, reported in a range from three to seven copies in normal subjects (Saxena et al., 2000
; Fernandes et al., 2002
), could affect the results of the study was preliminarily explored before the use in pregnant women, in a sample of 100 DNA specimens from fertile men. Fertility status was proven by having fathered one or more children. Samples were randomly chosen among the DNAs stored in our laboratory after any molecular diagnostics not involving reproductive disorders, for which an informed consent for use in research projects was given at the time of sampling.
Fifty-seven pregnant women ranging from 5 to 12 weeks of gestation were enrolled after informed consent. Thirteen pregnancies were at risk for X-linked disorders, and the other 44 women had no known genetic risk. Women were asked to repeat the analysis at a 2-week interval: we obtained three blood samples in 15 women, two samples in 20, whereas 22 women had only one sample, for a total of 107 analyses performed.
Analytical procedure
A 9-ml sample of peripheral blood from all the pregnant women was collected and immediately processed for serum separation. The blood samples were centrifuged at 3000 g for 20 min in the original collection tube without anticoagulant; the serum was carefully removed and transferred into polypropylene tubes. Samples were again centrifuged at 3000 g for 10 min to remove all the residual intact cells and stored at 20°C until further processing.
The EXTRAgen kit (Amplimedical, Torino, Italy) was used for DNA extraction as follows: 300 µl of serum for each extraction was treated with a lysis solution (provided by the manufacturer), heated at 80°C to inactivate the proteins, ethanol precipitated and washed. The pellet was resuspended in 12 µl of pure water. For each woman, five separate extractions were carried out (300 µl x 5 = 1200 µl total volume of serum used), and the five re-suspended aliquots were put together in a single eppendorf tube, for a total of 60 µl of DNA available for analysis: in each of the three reactions per subject performed, we used 10 µl of template DNA, whereas for the ß-actin reactions, 3 µl of template DNA was used for each of the two analyses performed (3 µl x 2= 6 µl). The remaining template was stored at 20°C (DNA extractions were carried out in excess to ensure the availability of an extra volume for mix reactions preparation.)
Analysis on serum samples was based on the amplification of the DAZ region and of ß-actin, used as a reporter gene for measuring the total amount of DNA (for this latter, Applied Biosystem primers and probe labelled with FAM fluorophore were used). Two independent reactions were set up in a 25-µl volume containing 1x Taq polymerase buffer, 3.5 mM MgCl2, 200 µM dATP, dCTP, dGTP, 400 µM dUTP, 0.625 U of AmpliTaq Gold and 0.25 U of AmpErase uracil N-glycosylase (reagents supplied in a TaqMan PCR Core Reagent Kit, Applied Biosystem); for DAZ locus, we used 900 nM of reverse primer, 300 nM forward primer and 250 nM of probe; ß-actin primers and probes were used at a final concentration of 300 and 200 nM, respectively. Thermal cycling was initiated with a 2 min incubation at 50°C to allow the uracil N-glycosylase to act, followed by a first denaturation step of 10 min at 95°C and then 50 cycles at 95°C for 15 s and 65°C for 40 s. The iCycler iQ Real Time instrument was used for the analysis (Bio-rad Laboratories, Hercules, CA, USA).
Each sample was analysed in triplicate and male sex was assigned if DAZ amplification was observed in all replicates, whereas cases with a single positive result among the three replicates were evaluated as females; the final sex assignment was obtained through either fetal ultrasonography or karyotype analysis. Human male control DNA (Applied Biosystem) was used as standard template: the calibration curve, ranging from 100 genome equivalents (GE)/well to 0.1 GE/well, was run in triplicate and in parallel for each experimental session. Multiple water blanks and DNA extracted from non-pregnant women were used as negative controls and included in each session. No threshold was set for establishing the presence or absence of Y-derived DNA, but the fetal sex was assigned in comparison to the results of the negative control. To express the results as GE, the cycle thresholds (Ct) were converted into quantities (GE) by a conversion factor of 6.6 pg of DNA, both for the standard curve and for the DNAs under analysis. Each amount was expressed as the mean value resulting from the triplicate experiments, and a coefficient of variation (CV) among the replicates was calculated for the number of DNA copies.
Moreover, to estimate the limits of detection (LoD) for the test, probit regression analysis was used (SPSS 12 for Windows, SPSS Inc., Chicago, IL, USA), by assigning the various known dilutions of the control male DNA (100, 10, 1 and 0.1 GE/well) as positive reference and the amplification status observed in the pregnancies with a female fetus and in the negative controls as negative reference. The input copy number with a 95% probability of a positive result (male) was assigned as 95% LoD.
Significance of the variations of DNA concentrations across the study weeks was calculated through Pearsons linear regression. P values were set at <0.05.
As anti-contamination measures, aerosol-resistant pipette tips were used for all liquids. Separate areas were used for all the steps of the analysis, and all the manipulations were carried out by female staff in a laminar flow hood.
| Results |
|---|
|
|
|---|
The DAZ region was successfully amplified with our probe in all the 100 fertile control male subjects, thus excluding common deletions of the region in normal subjects.
Of the 57 women studied, 8 had a spontaneous abortion, 26 delivered a female fetus and 23 a male; of the 13 X-linked disease carriers, five had a female fetus and eight a male. The reporter gene ß-actin demonstrated the presence of amplifiable DNA in all the samples extracted from the maternal serum. Figure 1 shows examples of the raw PCR curves for DAZ-positive and DAZ-negative cases, control male and female DNAs and ß-actin. DAZ was detected in two of the three cases carrying a male fetus at a gestational age of 5 weeks, in five of six at a gestational age of 6 weeks, in five of six at a gestational age of 7 weeks. From the 8th to 12th gestational week, the presence of DAZ sequences was demonstrated in all the 34 maternal blood samples from male-bearing pregnancies. No case of false-positive DAZ detection was found (Table I). Triplicate analysis for each sample always yielded concordant results in males (also in those early cases wrongly assigned as females). For female-bearing pregnancies, although some positive signals could be found, their comparison with the results of the negative controls always allowed a correct assignment. Raw Ct data of those cases are reported in the supplementary table.
|
|
Figure 2 plots the predicted proportion of DAZ PCR amplifications resulting in male sex assignment against the input copy number according to probit regression analysis, setting the 95% LoD for male sex assignment for our DAZ4M8 PCR test at 6.6 GE/PCR (95% confidence intervals 4.413.7).
|
The box plot graph in Figure 3 describes the amount of fetal DNA for each gestational week: despite the data dispersion also due to the small sample size, the overall trend during the first trimester showed a significant correlation (r = 0.85, P = 0.008) between the DAZ concentration and the ongoing pregnancy, according to the following equation: DNA concentration = 233.3 + 40.5 x week; on the contrary, for the ß-actin gene in maternal serum (data not shown), no significant variations across the first trimester were found (r = 0.16, P = 0.16).
|
Finally, the trend of the fetal DNA amount in the three spontaneously aborted pregnancies carrying a male fetus is reported in Figure 4, apparently showing a decrease in the levels of fetal DNA before the abortion was diagnosed.
|
| Discussion |
|---|
|
|
|---|
In this article, we describe the setting and the application of a new probe (DAZ4M8) for the quantitation of free fetal DNA in the maternal bloodstream at each gestational week of the first trimester of pregnancy.
The absence of DAZ region deletions in all the 100 healthy, fertile men analysed demonstrates that the probe designed is suitable for the detection of fetal DNA in the maternal blood and confirms that there is only a negligible risk of a false-negative result in male fetal sex assignment, possibly due to de novo DAZ deletions, arising with a frequency of 1/4000 (Kuroda-Kawaguchi et al., 2001
).
Because of the repetitive nature of the probe and of the optimized DNA extraction procedure used, fetal DNA could be detected as early as the 5th week of pregnancy: the increase of the test sensitivity is also reflected by the higher median fetal DNA concentration in the first trimester (54.2 GE/ml), compared to 9.1 GE/ml reported by Galbiati et al. (2005)
and 15.9 GE/ml reported by Birch et al. (2005)
. However, the 95% LoD of our method for assigning the male sex, as determined by probit regression analysis, was found at 6.6 GE/PCR, a much higher threshold than 0.35 GE/PCR reported in a recent paper using DYS14, another repetitive probe mapping in the Y region (Zimmermann et al., 2005
); this could possibly reflect different experimental conditions or a true lower sensitivity of our probe compared to DYS14, mainly due to the 2-fold higher number of copies of the DYS14 (9 with 100% identity and one with 99%) versus the five amplicons produced by the DAZ4M8 primers.
A stepwise rise in fetal DNA concentrations (with the exception of two cases where the amount of fetal DNA was found decreased at the third time period although the pregnancy was continuing without complications) was observed through the weeks, whereas a drop in the DNA amount (<15 GE/ml) was recorded in the spontaneous miscarriages soon before the abortion was diagnosed (Figure 4). Although on the basis of few observations and with the need of being independently confirmed, it is possible to speculate, in analogy with different pregnancy complications leading to an increase of fetal DNA (Zhong et al., 2000b
; Sekizawa et al., 2002
), that the arrest of the fetal-placental exchanges is immediately reflected in the levels of fetal DNA in the maternal bloodstream.
This increase in the yield of the test by using an optimized DNA extraction procedure and a multiple probe, achieved in this study and in others (Zimmermann et al., 2005
), suggests that the amount of fetal DNA is easily detectable in an accurate sex diagnosis setting, starting from the 8th week of gestation, with a 100% test sensitivity and specificity.
For clinical purposes, the sensitivity of the test and therefore the earliest gestational age by which the technique becomes reliable is relevant, for example, in pregnancies at risk for adrenal hyperplasia, for the decision to administer dexamethasone treatment (Rijnders et al., 2001
), and in pregnancies at risk for X-linked diseases to decide whether invasive testing should be performed (Lo et al., 1998
). In this view, the test was used as a valuable first step in five cases at risk for X-linked disorders which avoided chorionic villus sampling and the risks involved with this procedure by testing negative for fetal Y sequences. Moreover, the finding of a relatively high concentration of fetal DNA in the first weeks of pregnancy confirms the feasibility of non-invasive genetic tests for mendelian disorders in the first weeks of gestation, as recently described (Li et al., 2005
), and supports the application of fetal DNA detection in early pregnancies achieved through in vitro fertilization to verify the successful implantation, in addition to the ultrasonography and HCG detection (Guibert et al., 2003
).
In conclusion, the use of a multilocus probe allowed the quantitation of free fetal DNA already at the beginning of the pregnancy through the increase of the sensitivity of the detection. The rise in the concentration of fetal DNA through the weeks and the apparent fall in the abortions suggest a strong correlation between ongoing pregnancy and fetal DNA amount in the maternal bloodstream.
| Supplementary data |
|---|
|
|
|---|
Supplementary data are available at Molecular Human Reproduction Online.
| Acknowledgements |
|---|
We thank T.E.S.T. s.r.l. laboratory for the enrollment of pregnant women. This work was supported in part by Cante di Montevecchio Association O.N.L.U.S.
| References |
|---|
|
|
|---|
Bianchi DW, Flint AF, Pizzimenti MF, Knoll JHM and Latt SA (1990) Isolation of fetal DNA from nucleated erythrocytes in maternal blood. Proc Natl Acad Sci USA 87,32793283.
Birch L, English CA, ODonoghue K, Barigye O, Fisk NM and Keer JT (2005) Accurate and robust quantification of circulating fetal and total DNA in maternal plasma from 5 to 41 weeks of gestation. Clin Chem 51,312320.
Chiu RW, Lau TK, Leung TN, Chow KCK, Chui DHK and Lo YM (2002) Prenatal exclusion of beta-thalassaemia major by examination of maternal plasma. Lancet 360,9981000.[CrossRef][Web of Science][Medline]
Fernandes S, Huellen K, Goncalves J, Dukal H, Zeisler J, Rajpert De Meyts E, Skakkebaek NE, Habermann B, Krause W, Sousa M et al. (2002) High frequency of DAZ1/DAZ2 gene deletions in patients with severe oligozoospermia. Mol Hum Reprod 8,286298.
Galbiati S, Smid M, Gambini D, Ferrari A, Restagno G, Viora E, Campogrande M, Bastonero S, Pagliano M, Calza S et al. (2005) Fetal DNA detection in maternal plasma throughout gestation. Hum Genet 117,243248.[CrossRef][Web of Science][Medline]
Gonzalez-Gonzalez MC, Garcia-Hoyos M, Trujillo MJ, Rodriguez de Alba M, Lorda-Sanchez I, Diaz-Recasens J, Gallardo E, Ayuso C and Ramos C (2002) Prenatal detection of a cystic fibrosis mutation in fetal DNA from maternal plasma. Prenat Diagn 22,946948.[CrossRef][Web of Science][Medline]
Guibert J, Benachi A, Grebille AG, Ernault P, Zorn JR and Costa JM (2003) Kinetics of SRY gene appearance in maternal serum: detection by real time PCR in early pregnancy after assisted reproductive technique. Hum Reprod 18,17331736.
Honda H, Miharu N, Ohashi Y and Ohama K (2001) Successful diagnosis of fetal gender using conventional PCR analysis of maternal serum. Clin Chem 47,4146.
Honda H, Miharu N, Ohashi Y, Samura O, Kinutani M, Hara T and Ohama K (2002) Fetal gender determination in early pregnancy through qualitative and quantitative analysis of fetal DNA in maternal serum. Hum Genet 110,7579.[CrossRef][Web of Science][Medline]
Johnson KL, Dukes KA, Vidaver J, LeShane ES, Ramirez I, Weber WD, Bischoff FZ, Hahn S, Sharma A, Dang DX et al. (2004) Interlaboratory comparison of fetal male DNA detection from common maternal plasma samples by real-time PCR. Clin Chem 50,516521.
Kuroda-Kawaguchi T, Skaletsky H, Brown LG, Minx PJ, Cordum HS, Waterston RH, Wilson RK, Silber S, Oates R, Rozen S et al. (2001) The AZFc region of the Y chromosome features massive palindromes and uniform recurrent deletions in infertile men. Nat Genet 29,279286.[CrossRef][Web of Science][Medline]
Kutyavin IV, Afonina IA, Mills A, Gorn VV, Lukhtanov EA, Belousov ES, Singer MJ, Walburger DK, Lokhov SG, Gall AA et al. (2000) 3¢-minor groove binder-DNA probes increase sequence specificity at PCR extension temperatures. Nucleic Acids Res 28,655661.
Leung TN, Zhang J, Lau TK, Hjelm NM and Lo YM (1998) Maternal plasma fetal DNA as a marker for preterm labour. Lancet 352,19041905.[Web of Science][Medline]
Li Y, Zimmermann B, Rusterholz C, Kang A, Holzgreve W and Hahn S (2004) Size separation of circulatory DNA in maternal plasma permits ready detection of fetal DNA polymorphisms. Clin Chem 50,10021011.
Li Y, Di Naro E, Zimmermann B, Holzegreve W and Hahn S (2005) Detection of paternally inherited fetal point mutations for beta-thalassemia using size-fractionated cell-free DNA in maternal plasma. JAMA 293,843849.
Lo YM, Corbetta N, Chamberlain PF, Rai V, Sargent IL, Redman CW and Wainscoat JS (1997) Presence of fetal DNA in maternal plasma and serum. Lancet 350,485487.[CrossRef][Web of Science][Medline]
Lo YM, Tein MS, Lau TK, Haines CJ, Leung TN, Poon PM, Wainscoat JS, Johnson PJ, Chang AM and Hjelm NM (1998) Quantitative analysis of fetal DNA in maternal plasma and serum: implications for noninvasive prenatal diagnosis. Am J Hum Genet 62,768775.[CrossRef][Web of Science][Medline]
Rijnders RJ, van der Schoot CE, Bossers B, de Vroede MA and Christiaens GC (2001) Fetal sex determination from maternal plasma in pregnancies at risk for congenital adrenal hyperplasia. Obstet Gynecol 98,374378.[CrossRef][Web of Science][Medline]
Rijnders RJ, Van Der Luijt RB, Peters ED, Goeree JK, Van Der Schoot CE, Ploos Van Amstel JK and Christiaens GC (2003) Earliest gestational age for fetal sexing in cell-free maternal plasma. Prenat Diagn 23,10421044.[CrossRef][Web of Science][Medline]
Rijnders RJ, Christiaens GC, Bossers B, van der Smagt JJ, van der Schoot CE and de Haas M (2004) Clinical applications of cell-free fetal DNA from maternal plasma. Obstet Gynecol 103,157164.[CrossRef][Web of Science][Medline]
Saito H, Sekizawa A, Morimoto T, Suzuki M and Yanaihara T (2000) Prenatal DNA diagnosis of a single-gene disorder from maternal plasma. Lancet 356,1170.
Saxena R, de Vries JWA, Repping S, Alagappan RK, Skaletsky H, Brown LG, Ma P, Chen E, Hoovers JMN and Page DC (2000) Four DAZ genes in two clusters found in the AZFc region of the human Y chromosome. Genomics 67,256267.[CrossRef][Web of Science][Medline]
Sekizawa A, Kondo T, Iwasaki M, Watanabe A, Jimbo M, Saito H and Okai T (2001a) Accuracy of fetal gender determination by analysis of DNA in maternal plasma. Clin Chem 47,18561858.
Sekizawa A, Sugito Y, Iwasaki M, Watanabe A, Jimbo M, Hoshi S, Saito H and Okai T (2001b) Cell-free fetal DNA is increased in plasma of women with hyperemesis gravidarum. Clin Chem 47,21642165.
Sekizawa A, Jimbo M, Saito H, Iwasaki M, Sugito Y, Yukimoto Y, Otsuka J and Okai T (2002) Increased cell-free fetal DNA in plasma of two women with invasive placenta. Clin Chem 48,353354.
Wataganara T, LeShane ES, Farina A, Messerlian GM, Lee T, Canick JA and Bianchi DW (2003) Maternal serum cell-free fetal DNA levels are increased in cases of trisomy 13 but not trisomy 18. Hum Genet 112,204208.[Web of Science][Medline]
Zhong XY, Burk MR, Troeger C, Jackson LR, Holzgreve W and Hahn S (2000a) Fetal DNA in maternal plasma is elevated in pregnancies with aneuploid fetuses. Prenat Diagn 20,795798.[CrossRef][Web of Science][Medline]
Zhong XY, Holzgreve W, Li JC, Aydinli K and Hahn S (2000b) High levels of fetal erythroblasts and fetal extracellular DNA in the peripheral blood of a pregnant woman with idiopathic polyhydramnios: case report. Prenat Diagn 20,838841.[CrossRef][Web of Science][Medline]
Zhong XY, Holzgreve W and Hahn S (2002) The levels of circulatory cell free fetal DNA in maternal plasma are elevated prior to the onset of preeclampsia. Hypertens Pregnancy 21,7783.[CrossRef][Web of Science][Medline]
Zimmermann B, El-Sheikhah A, Nicolaides K, Holzgreve W and Hahn S (2005) Optimized real-time quantitative PCR measurement of male fetal DNA in maternal plasma. Clin Chem 51,15981604.
Submitted on March 10, 2006; resubmitted on May 8, 2006; accepted on May 13, 2006.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
C. F. Wright and H. Burton The use of cell-free fetal nucleic acids in maternal blood for non-invasive prenatal diagnosis Hum. Reprod. Update, January 1, 2009; 15(1): 139 - 151. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Yin, E.H.Y. Ng, X. Zhang, Y. He, J. Wu, and K.Y. Leung Correlation of maternal plasma total cell-free DNA and fetal DNA levels with short term outcome of first-trimester vaginal bleeding Hum. Reprod., June 1, 2007; 22(6): 1736 - 1743. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





