Mol. Hum. Reprod. Advance Access originally published online on March 9, 2007
Molecular Human Reproduction 2007 13(5):323-332; doi:10.1093/molehr/gam005
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Altered expression of HOXA10 in endometriosis: potential role in decidualization
1 Department of Obstetrics and Gynecology, Northwestern University, Chicago, IL, USA 2 Department of Obstetrics, Gynecology and Reproductive Sciences 3 Department of Molecular, Cellular and Developmental Biology, Yale University, New Haven, CT, USA 4 Departments of Obstetrics and Gynecology, University of Illinois at Chicago, Chicago, IL, USA 5 Department of Pediatrics, Medical College of Wisconsin, Milwaukee, WI, USA
6 To whom correspondence should be addressed at: Division of Reproductive Biology Research, Department of Obstetrics and Gynecology, Northwestern University, 303 E. Superior St, Lurie 4-117, Chicago, IL 60611, USA. Tel.: 312 503 5377; Fax: 312 503 0095; E-mail: j-kim4{at}northwestern.edu
| Abstract |
|---|
|
|
|---|
Endometriosis is a poorly understood gynaecologic disorder that is associated with infertility. In this study, we examined the expression of HOXA10 in the eutopic endometrium of baboons with induced endometriosis. A decrease in HOXA10 mRNA was observed after 3, 6, 12 and 16 months of disease, which reached statistical significance at 12 and 16 months. HOXA10 protein levels were decreased in both the epithelial and stromal cells of the endometrium. Furthermore, expression of ß3 integrin (ITGB3), which is upregulated by HOXA10, was decreased, whereas EMX2, a gene that is inhibited by HOXA10, was increased. Next, methylation patterns of the HOXA10 gene were analysed in the diseased and control animals. The F1 region on the promoter was found to be the most significantly methylated in the endometriosis animals and this may account for the decrease in HOXA10 expression. Finally, we demonstrate that stromal cells from the eutopic endometrium of baboons with endometriosis expressed significantly higher levels of insulin-like growth factor binding protein-1 (IGFBP1) mRNA than disease-free animals in response to estradiol, medroxyprogesterone acetate and dibutyryl cAMP (H + dbcAMP). The functional role of HOXA10 in IGFBP1 expression was further explored using human endometrial stromal cells (HSC). Overexpression of HOXA10 in HSC resulted in a decrease of IGFBP1 mRNA, whereas silencing HOXA10 caused an increase of IGFBP1 mRNA, even in the presence of H + dbcAMP. These data demonstrate that HOXA10 negatively influences IGFBP1 expression in decidualizing cells. Thus, the decrease in HOXA10 levels may in part be involved with the altered uterine environment associated with endometriosis.
Key words: decidualization/endometriosis/endometrium/HOXA10/uterus
| Introduction |
|---|
|
|
|---|
Endometriosis is a common gynaecological disorder that is poorly understood. It is characterized by the presence of uterine endometrial tissue outside of the uterine cavity and is mainly associated with severe pelvic pain and/or infertility (Eskenazi and Warner, 1997). One potential cause of the disease is retrograde menstruation which results in the deposition of endometrial tissue into the peritoneal cavity. Indeed, studies in animals have demonstrated that when endometrial cells are deposited in the peritoneal cavity, lesions similar to the endometriotic lesions observed in women develop (Schenken and Asch, 1980; Zamah et al., 1984; Vernon and Wilson, 1985; Bruner et al., 1997; D'Hooghe, 1997; Grummer, 2006). The baboon has been used as a model to understand early and progressive events associated with the establishment of the disease (D'Hooghe, 1997; Fazleabas, 2006). When menstrual effluent is placed in the peritoneum of disease-free animals, ectopic lesions develop. Moreover, over time, progressive changes can be observed in both ectopic and eutopic endometrium (D'Hooghe et al., 1995; Fazleabas et al., 2003; Fazleabas, 2006).
Endometriosis has been associated with lower pregnancy rates in women undergoing IVF (Barnhart et al., 2002). Whether it is due to suboptimal oocyte quality or a compromised endometrium remains a controversial issue. Studies have shown that gene expression in the endometrium of women with endometriosis is aberrant, making the endometrium suboptimal for an implanting blastocyst (Kao et al., 2003). Some of the genes studied include c-fos, aromatase, endometrial bleeding factor, hepatocyte growth factor, leukaemia-inhibitory factor, matrix metalloproteinases, progesterone receptors (PGR), glycodelin, integrins and empty spiracles homolog 2 (EMX2) (Lessey et al., 1994; Sugawara et al., 1997; Attia et al., 2000; Tabibzadeh et al., 2000; Yang et al., 2002; Kao et al., 2003; Daftary and Taylor, 2004; Uzan et al., 2004; Dimitriadis et al., 2006; Hastings et al., 2006). Although homeobox A10 (HOXA10) and HOXA11 are normally up-regulated during the window of implantation, expression of both genes were decreased during this period in women with endometriosis (Gui et al., 1999, Taylor et al., 1999). In addition, endometrial HOXA10 expression was altered in women with polycystic ovary syndrome and hydrosalpinx which are associated with decreased implantation (Cermik et al., 2003). Furthermore, in ectopic pregnancies, there was an increased tubal expression of HOXA10 (Salih and Taylor, 2004).
HOXA10 is one member of the homeobox gene family that plays a fundamental role in development (Krumlauf, 1992). Homeobox proteins contain a unique homeodomain consisting of a 61 amino acid residue polypeptide, which binds to the DNA. In adult tissues, HOXA10 acts as a transcription factor, regulating a number of genes, such as cyclin-dependent kinase inhibitor 1A (Bromleigh and Freedman, 2000), genes of the Wnt pathway (Ferrell et al., 2005), ITGB3 (Daftary et al., 2002), EMX2 (Troy et al., 2003), and FK506 binding protein 4 (Daikoku et al., 2005).
HOXA10 null mice are infertile due to a defect with stromal cell decidualization at the site of implantation (Benson et al., 1996). The importance of HOXA10 in implantation is further supported by experiments using antisense oligonucleotides to HOXA10 which were injected into the mouse uterus and as a result, implantation rates decreased (Bagot et al., 2000). The role of HOXA10 in the human endometrium, however, is less clear. HOXA10 is up-regulated in response to estrogen and progesterone and its levels increase dramatically during the mid-secretory phase of the menstrual cycle (Taylor et al., 1998). Thus, the differential expression of HOXA10 in the endometrium, as well as its abnormal expression in women with endometriosis suggests that HOXA10 may be essential to the implantation process.
In this study, we report that the expression of HOXA10 in the eutopic endometrium of baboons which were induced to develop endometriosis was lower than that of disease-free animals. This decrease was accompanied by abnormal expression of the HOXA10 target genes, EMX2 and ITGB3. The methylation status of the HOXA10 gene was analysed as one potential mechanism for the decrease in expression. Finally, we demonstrate one possible role of HOXA10 as an inhibitor to IGFBP1 gene expression during decidualization.
| Materials and methods |
|---|
|
|
|---|
Baboon model of endometriosis
The baboons utilized in this study were purchased from the Southwest National Primate Center (San Antonio, TX). The animals were normally cycling females ranging in age from 7 to 12 years and weighing between 12 and 18 kg. The females were housed in individual cages in the Biological Research Laboratories of the University of Illinois. Endometriosis was experimentally induced in six reproductively aged baboons by intraperitoneal inoculation with menstrual endometrium on day 2 of two consecutive menstrual cycles (where day 1 was the first day of mense). Details of the inoculation have been previously described (Fazleabas et al., 2002, 2003). The progression of disease was monitored in each animal by consecutive laparoscopies at 3, 67, 910, 12 and 1516 months after inoculation. Laparoscopy and laparotomies were performed between days 9 and 11 post-ovulation, which is the mid-luteal stage of the menstrual cycle for the baboon and coincides with the window of uterine receptivity (Fazleabas et al., 1999). The stage of the cycle was determined by measuring estradiol (E2) levels in daily blood draws to determine the day of ovulation as previously reported (Fazleabas et al., 1999). At each laparoscopy, the number of lesions was counted and changes within the pelvic cavity were documented by video recording (Fazleabas et al., 2003; Hastings et al., 2006). Significantly, more red lesions were observed 3 months following inoculation with menstrual endometrium, whereas at 6 months of disease, significantly more blue endometriotic lesions were present. Thereafter, similar levels of red, blue, chocolate, white and mixed lesions were observed, although there was a trend towards an increased number of red lesions, indicating that the disease is still active (Hastings et al., 2006). Following each laparoscopy, a laparotomy was performed and endometrial tissue (ranging from 0.5 to 1 g) was obtained using an endometriectomy procedure (Fazleabas et al., 1999). All experimental procedures were approved by the Animal Care Committee of the University of Illinois, Chicago.
Analysis of the eutopic endometrial tissues from baboons with or without endometriosis
Quantitative real-time PCR in endometrial tissues
Real-time PCR for baboon endometrial tissues was done using the LightCycler (Roche Diagnostics Corporation, Indianapolis, IN, USA). The reaction was carried out using the LightCycler RNA Master SYBR Green I kit. Reaction conditions included 1.0 µg of RNA, 2 or 3 mM Mn[OAc]2 for HOXA10 and ß-actin (ACTB), respectively, 150 nM of each primer, and 1 x RNA Master SYBR Green, for a final reaction volume of 20 µl. L. Primers for each gene were designed using the human sequences:
- HOXA10 forward: 5'-AGGTGGACGCTGCGGCTAATCTCTA-3'
- HOXA10 reverse: 5'-GCCCCTTCCGAGAGCAGCAAAG-3'
- ACTB, forward: 5'-CGTACCACTGGCATCGTGAT-3'
- ACTB reverse: 5'-GTGTTGGCGTACAGGTCTTTG-3'
- ITGB3 forward: 5'-GACAAGGGCTCTGGAGACAG-3'
- ITGB3 reverse: 5'-ACTGGTGAGCTTTCGCATCT-3'
- EMX2 forward: 5'-ACTAGCCCCGAGAGTTTCATTTTG-3'
- EMX2 reverse: 5'-CTCCAGCTTCTGCCTTTTGAACTTT-3'
- MEIS1 forward: 5'-TCGCGCAGAAAAACCTCTAT-3'
- MEIS1 reverse: 5'-GGCATTTTCCCTTTCAAACA-3'
- HOXA10 reverse: 5'-GCCCCTTCCGAGAGCAGCAAAG-3'
Immunohistochemistry
Baboon endometrial tissue was fixed in formalin, embedded in paraffin, cut into 5-µm sections and mounted onto slides. Slides were deparaffinized and dehydrated through a series of xylene and ethanol washes, followed by permeabilization in 95% cold ethanol. After a 5-min rinse in distilled water, an antigen-retrieval step was performed by steaming the slides in 0.01-M sodium citrate buffer for 20 min, followed by cooling for 20 min. Slides were rinsed for 5 min in phosphate-buffered saline with 0.1% Tween 20 (PBST), and sections were circumscribed with a hydrophobic pen. Endogenous peroxidase was quenched with 3% hydrogen peroxide for 5 min followed by a 5-min PBST wash. Nonspecific binding was blocked with 1.5% normal horse serum in PBST for 1 h at room temperature. Slides were incubated with the HOXA10 antibody (anti-goat antibody, Santa Cruz Biotechnology, Santa Cruz, CA, USA) overnight at 4°C. Normal goat immunoglobulin G (Santa Cruz Biotechnology) was used as a negative control for HOXA10 antibody. This antibody has been used in previous studies to detect HOXA10 in the human endometrium (Sarno et al., 2005). Biotinylated secondary antibodies were purchased from Vector Laboratories (Burlingame, CA, USA). Horse
-goat secondary antibody was applied for 1 h at 4°C. Slides were washed in 1 x PBST, incubated in ABC Elite (Vector Laboratories) for 15 min at room temperature, washed in 1x PBST and incubated for 5 min in diaminobenzidine (Vector Laboratories). A 20-s exposure to hematoxylin was used as a counterstain. Slides were rehydrated through 3-min ethanol and xylene washes and mounted with Permount. All slides were processed simultaneously. The HOXA10 protein immunohistochemistry results were quantified by two blinded evaluators. An H-score was determined separately for the glandular and stromal cells on each slide. The H-score was calculated with the following equation:
|
|
Statistical analysis
Non-parametric statistical analysis was performed on quantitative mRNA expression levels of IGFBP1, ITGB3, EMX2 and MEIS1 measured in eutopic endometrial tissues from control baboons and those with endometriosis using the two-tailed MannWhitney U-test. Non-parametric analysis of variance (ANOVA) was performed on quantitative mRNA expression levels and protein H-scores of HOXA10 in endometriotic endometrium from animals across the disease time course using the KruskalWallis one-way ANOVA and Dunn's Multiple Comparisons Test. Analysis was carried out using InStat (GraphPad Software Inc., San Diego, CA, USA). P < 0.05 was considered statistically significant.
Methylation of the HOXA10 gene
Bisulphite sequencing of HOXA10 gene
Genomic DNA was extracted from eutopic endometrial tissues of six disease-free and six baboons with endometriosis. Bisulphite sequencing was done on DNA obtained from each animal and the data represent independent analysis of the promoter region for each animal. DNA was modified with sodium bisulphite following the manufacturer's instructions (Zymo Research, Orange, CA, USA). This modification resulted in a conversion of unmethylated cytosine to thymine, whereas the methylated cytosine remained unchanged (Frommer et al., 1992). A total of 60 ng of bisulphite-modified DNA was subjected to PCR amplification and directly sequenced using the ABI 3700 automated sequencing system (Applied Biosystems, Foster City, CA, USA). The primers used for bisulphite sequencing have been previously reported (Wu et al., 2005).
Statistical analysis
For the methylation studies, a randomization test, described previously in Wu et al. (2005) was used to determine the statistical significance of the difference in methylation patterns between baboons with endometriosis and those without. Briefly, for each CpG site, no methylation was coded as 0, partial methylation as 0.5, and complete methylation as 1. Partial methylation occurred when equal amounts of cytosine and guanine were present in the sample. For each animal, the sum of the scores in each of the fragments was calculated and recorded, and the differences in the summed scores between the endometriosis and the disease-free animals were compared. A total of 20 000 permutations were conducted to arrive at the empirical P-value, P =
iIi/n, where n is the number of permutations and Ii is the indicator variable indicating whether or not the score Si, defined to be the difference in mean total score between the diseased and control groups at the ith permutation, exceeds the control group observed score S0. For gene expression data, a one-sided t-test was used. All computations were carried out with R, a language and environment for statistical computing and graphics (version 2.2.1, www.r-project.org).
In vitro studies of decidualization
Cell culture
Human endometrial tissue was obtained from hysterectomies from premenopausal women with benign gynaecological complaint and no clinically documented abnormalities of the endometrium. Women who were being treated with hormones prior to surgery or those with endometriosis were excluded from the study. All studies and the experimental use of human tissues were approved by the Human Subject Committee at Northwestern University in accordance with U.S. Department of Health regulations. Human and baboon endometrial stromal cells were isolated as previously described (Kim et al., 2003). Cells were maintained in Roswell Park Memorial Institute (RPMI)-1640 (Invitrogen, Carlsbad, CA, USA), supplemented with sodium pyruvate, penicillin/streptomycin and 10% fetal bovine serum (FBS, Mediatech, Herndon, VA, USA) that was treated with dextran-coated charcoal (Sigma, St Louis, MO, USA) according to the manufacturer's protocol to deplete FBS of steroids.
Hormone treatment of cells
Baboon and human stromal cells of the endometrium were grown until 80% confluence and subsequently treated with or without the hormones, 36 nM E2-17ß, 1 µM medroxyprogesterone acetate and 0.1 mM dbcAMP (Sigma). This hormonal treatment will be referred to as H + dbcAMP. Cells were treated for 48 h and then lysed with either TriReagent for subsequent RNA isolation or RIPA buffer for recuperation of proteins.
Western blot
Stromal cells from the baboon endometrium were lysed using RIPA buffer (150 mM NaCl, 1% IGEPAL, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris and pH 8.0) with protease inhibitors (Sigma) to recuperate whole cell proteins. Protein content was measured using the Micro BCA protein assay kit (Pierce, Rockford, IL, USA). Proteins were run on a precast 7.5% acrylamide gel (BioRad, Hercules, CA, USA) and transferred onto PVDF membrane. Membranes were blocked with 5% milk in Tris-buffered saline with 0.1% Tween-20 (TBST) and then incubated with primary antibody to HOXA10 (generously donated by E. Eklund, Northwestern University, Chicago, IL, USA), followed by incubation with secondary peroxidase-conjugated goat anti-rabbit. Protein complexes were detected with a chemiluminescent detection kit (Amersham Biosciences, Piscataway, NJ, USA).
Influence of HOXA10 on IGFBP1 gene expression
Small interfering RNA transfection
The HOXA10 siRNA was synthesized by Dharmacon (siGENOME duplex, Lafayette, CO, USA). A non-related control siRNA that targets the firefly luciferase protein (Dharmacon) was used as a control. Cells were grown until 60% confluence at which time they were transfected with HOXA10 siRNA or control siRNA with Lipofectamine 2000 (Invitrogen). Cells were transfected for 6 h, then treated with H + dbcAMP for 48 h in RPMI with 2% stripped FBS. Cells were lysed with TriReagent (Molecular Research Center, Cincinnati, OH, USA). Silencing of the HOXA10 gene was verified by real-time PCR.
Adenovirus infection
The cDNA coding for HOXA10 in the pcDNA3.1 (+) expression vector was digested with NotI and HindIII and was subcloned into a shuttle vector. The human Ad5(dE1/dE3) replication-deficient recombinant adenovirus in which the expression of HOX10A is under the control of CMV promoter was manufactured by a commercial vendor (Vector Labs, Philadelphia, PA, USA). Viruses with an empty CMV construct (Vector Labs) were used as a control. Endometrial stromal cells were grown until 90% confluence at which time they were infected with the adenovirus construct expressing HOXA10 or the empty CMV vector. Cells were infected for 24 h with a multiplicity of infection of 10 pfu per cell. Cells were treated with or without H + dbcAMP for 48 h in RPMI with 2% stripped FBS.
Quantitative PCR for HOXA10 in stromal cells
Real-time PCR for baboon endometrial stromal cells was done using the ABI PRISM 7000 System (Applied Biosystems). One microgram of total RNA was reverse transcribed in a volume of 20 µl and real-time PCR using SYBR green fluorescence was performed. Each real-time PCR reaction consisted of 1 µl RT product, 10 µl SYBR Green PCR Master Mix (Applied Biosystems) and 500 nM forward and reverse primers for HOXA10 and IGFBP1 (IDT, Coralville, IA, USA). Reactions were carried out on an ABI PRISM 7700 Sequence Detection System for 40 cycles (95°C for 15 s, 60°C for 1 min) after an initial 10-min incubation at 95°C. The primers used for real-time PCR are,
- HOXA10 forward: 5' CCTTCCGAGAGCAGCAAA 3'
- HOXA10 reverse: 5' GTCTGGTGCTTCGTGTAGGG 3'
- IGFBP1 forward: 5'GCTCTCCATGTCACCAACAT3'
- IGFBP1 reverse: 5'TCTCCTGATGTCTCCTGTGC3'
- HOXA10 reverse: 5' GTCTGGTGCTTCGTGTAGGG 3'

Ct method (Livak and Schmittgen, 2001), with the ribosomal protein 36B4 mRNA as an internal control. Data reported are the mean fold change ± SEM for three independent experiments.
Statistical analysis
A paired t-test was performed to compare the effects of siHOXA10 versus siCTRL or AD-HOXA10 versus AD-CMV.
| Results |
|---|
|
|
|---|
HOXA10 expression in endometriosis
Baboons were induced to develop endometriosis as previously reported (Fazleabas et al., 2002, 2003). After 3, 6, 12 and 16 months from the time of induction, eutopic endometrial tissue was taken from animals that were in the mid-luteal stage of the menstrual cycle. HOXA10 mRNA expression in the endometrium of baboons with or without endometriosis was measured by real-time PCR (Figure 1A). After 3 and 6 months of disease, we observed a trend for decreased expression of HOXA10, although this was not statistically significant. After 12 and 16 months of disease, the levels of HOXA10 decreased significantly.
|
Immunohistochemical analysis of HOXA10 demonstrated that HOXA10 was localized to both the stroma and epithelium of the normal endometrium (Figure 1B and C). There was a reduction of HOXA10 staining in the glands and basal stroma, whereas the superficial stroma remained unaffected in animals with induced endometriosis (Figure 1D and E). Semi-quantitative H-score analysis of HOXA10 immunostaining showed a statistically significant reduction in the 12- and 16-month animals compared with the controls (Figure 1F).
To determine whether the decrease in HOXA10 resulted in a corresponding alteration in its down-stream target genes, levels of ITGB3 and EMX2, previously reported to be up-regulated and down-regulated, respectively, by HOXA10 (Daftary et al., 2002; Troy et al., 2003) were measured by real-time PCR. Baboons that had the disease for 12 and 16 months exhibited a lower expression of ITGB3 (Figure 2A) and higher expression of EMX2 (Figure 2B) in the endometrium compared with the disease-free animals. MEIS1, which has been shown to form a heterodimer with HOXA10 on some target genes but is not a direct target of HOXA10, was not affected in endometriosis (Figure 2C). Thus, the decrease in HOXA10 observed in the eutopic endometrium of baboons with endometriosis had consequential effects on down-stream targets of HOXA10.
|
Methylation of the HOXA10 gene
We investigated whether methylation is one mechanism by which HOXA10 was decreased in the eutopic endometrium of baboons with endometriosis. The methylation status was determined by treating the genomic DNA with sodium bisulphite followed by sequencing the promoter region of HOXA10. Previously, three fragments were identified as methylated regions in the human HOXA10 gene (Wu et al., 2005). The F1 region is located in the 5' promoter region of HOXA10. F2 and F3 are located within the intron region between exons 1 and 2. The F1 region in the DNA from disease-free animals was not methylated, whereas the DNA from animals with endometriosis exhibited complete and partial methylation (Figure 3A). This hypermethylation was statistically significant (P = 0.01). In F2 and F3, the differences in the methylation pattern in diseased animals compared with control animals were less obvious and did not reach statistical significance (Figure 3B and 3C). When methylation patterns from all three fragments were combined, the endometriosis animals had significantly more methylated CpG sites than the controls (P = 0.05). Thus, the decrease in HOXA10 levels observed in the endometrium of baboons with endometriosis could be partially explained by the methylation status of the HOXA10 gene.
|
Decidualization in endometrial stromal cells of endometriosis
In the baboon, in vivo decidualization occurs in the presence of a conceptus (Kim et al., 1999). We have previously shown that in vitro decidualization of endometrial stromal cells of the baboon requires long-term treatment with sex steroids and a cAMP agonist (H + dbcAMP; Fazleabas et al., 2002). After 48 h of H + dbcAMP, levels of IGFBP1 mRNA are barely detectable by conventional RT-PCR in endometrial stromal cells from disease-free baboons (Kim et al., 2003). When endometrial stromal cells from baboons with endometriosis were treated with H + dbcAMP for 48 h, the fold-increase of IGFBP1 mRNA levels was significantly higher than that of normal animals (17-fold versus 380-fold increase from no hormone treatment; Figure 4A). The HOXA10 protein levels in the stromal cells from the diseased animal were lower when treated with or without H + dbcAMP, whereas HOXA10 protein was evident in cells from the control animals (Figure 4B and 4C). As a comparison, basal levels of IGFBP1 mRNA in the baboon endometrium were measured by real-time PCR of whole endometrial tissue. Although the data did not reach statistical significance, IGFBP1 expression in the endometrium from animals with endometriosis was higher than that of disease-free animals (Figure 4D). Immunohistochemical analysis confirmed that IGFBP1 was primarily localized to the glandular epithelium and not to stromal cells (data not shown), similar to the endometrium of disease-free baboons in late luteal phase of the menstrual cycle (Fazleabas et al., 1989).
|
Role of HOXA10 in IGFBP1 regulation
Given the abnormal induction of IGFBP1 in endometrial stromal cells of baboons with endometriosis and the decrease in HOXA10 expression in these animals, we asked whether HOXA10 was able to regulate the IGFBP1 gene. Due to the limited availability of baboon endometrial tissue, these mechanistic studies were done with human endometrial stromal cells (HSC).
HSC were infected with adenoviruses containing either the HOXA10 cDNA (AD-HOXA10) or empty CMV (AD-CMV) constructs as a control. After infection, cells were treated with H + dbcAMP to induce decidualization. After HOXA10 was overexpressed and cells were treated with H + dbcAMP, levels of IGFBP1 mRNA significantly decreased compared with the AD-CMV infected cells as measured by real-time PCR analysis (Figure 5).
|
Complimentary to these studies, HOXA10 was silenced using specific siRNA oligonucleotides to observe its effects on the IGFBP1 gene. HSC were transfected with siHOXA10 and then treated with H + dbcAMP to induce IGFBP1. Expression of IGFBP1 increased significantly when HOXA10 was silenced compared with the control, demonstrating that HOXA10 can indeed regulate the IGFBP1 gene (Figure 6A). The decrease of HOXA10 mRNA after siRNA transfection was validated by real-time PCR (Figure 6B). These results are in agreement with those of the overexpression studies and demonstrate that HOXA10 can attenuate IGFBP1 expression during decidualization. Thus, we provide here the evidence for one potential mechanism by which decreased HOXA10 protein in endometriosis could lead to an increased expression of IGFBP1 during decidualization of these cells.
|
| Discussion |
|---|
|
|
|---|
Endometriosis remains an enigmatic disease, due in part to a lack of appropriate animal models. The baboon model of endometriosis has demonstrated many similar phenotypes as the disease found in women (Gashaw et al., 2006; Hastings and Fazleabas, 2006; Hastings et al., 2006). One advantage of this model is the accessibility of eutopic endometrial tissues at specific stages of the disease as well as at specific times of the menstrual cycle. This is especially critical when attempting to elucidate the repertoire of endometrial genes responsible for infertility that is often associated with endometriosis. In addition, the etiology of endometriosis is unknown. Although some have accepted the theory that retrograde menstruation causes endometriosis, others have speculated that there is an inherent defect in the endometrium that allows for the development of the disease. The baboon model demonstrates a cause and effect relationship in that endometriosis can be induced in otherwise normal baboons by placing menstrual effluent into the peritoneal cavity and this, in time, causes aberrant expression of genes in the eutopic endometrium, as demonstrated in this study. Furthermore, the modulation we observe in the eutopic endometrium in response to disease occurs relatively quickly and is maintained or progresses in relationship with length of disease (Gashaw et al., 2006; Hastings et al., 2006). Given the similarities of the disease between the baboon and human, the baboon serves as a useful animal model to study infertility associated with endometriosis.
The cause of suboptimal fertility in women with endometriosis remains unclear. The use of assisted reproductive technologies has provided new approaches and insights to this problem in women with endometriosis. A meta-analysis of 20 published studies of IVF outcomes in patients with endometriosis concluded that both endometrial receptivity and oocyte and embryo quality contribute to the decreased pregnancy rates (Barnhart et al., 2002). In contrast, a study (Pellicer et al., 1995) using an oocyte donor model suggested that compromised oocyte quality and not endometrial receptivity contributed to reduced fertility, whereas other studies (Arici et al., 1996) demonstrated that women with mild disease had the lowest implantation rate which was secondary to compromised endometrial receptivity. Thus, the underlying cause of endometriosis-associated infertility is probably multifactorial, but the removal or suppression of lesions does improve pregnancy outcomes (Littman et al., 2005; Sallam et al., 2006).
HOXA10 is one gene that is normally up-regulated in the human endometrium during the window of implantation. In women with endometriosis, HOXA10 is down-regulated during this period (Taylor et al., 1999). Here we demonstrate that the levels of HOXA10 are similarly down-regulated in the eutopic endometrium of baboons with endometriosis and that this down-regulation occurs more dramatically as the disease progresses. Expression levels of two down-stream target genes of HOXA10, ITGB3 and EMX2 were also different than that of normal animals, and it is most likely that other down-stream target genes of HOXA10 are affected by this diminished expression in baboons with endometriosis.
One mechanism by which HOXA10 levels are decreased in endometriosis is by the methylation of this gene. Wu et al. (2005) have shown that methylation of HOXA10 in the endometrium with women with endometriosis is aberrant compared with those without endometriosis. Here we demonstrate that the methylation pattern of HOXA10 in baboons with endometriosis is also different from the disease-free animals. Specifically, fragment 1, which is located in the 5' promoter region of the HOXA10 gene, is methylated in baboons with endometriosis while DNA from disease-free animals is not methylated. The location of fragment 1 in the promoter region of HOXA10, its significant difference in methylation patterns in endometriosis, taken together with the decreased expression of the HOXA10 gene, strongly implicates that methylation of this region is important in decreasing HOXA10 gene expression in the baboon. Fragments 2 and 3 are located within intron 1 and although some sites in fragments 2 and 3 were methylated in control animals, this was not consistent or sufficient for gene silencing, since the HOXA10 gene continues to be expressed. Differences in methylation patterns between control and diseased animals was less clear in fragments 2 and 3 as well. This is in contrast to the data observed in women with severe disease (Wu et al., 2005). The most likely explanation, aside from species variation, is the difference in the length and severity of the disease. In the baboon model, the duration from the induction of endometriosis to tissue harvest was at most 16 months, whereas in humans, the duration from the onset of overt endometriosis symptoms and, more relevantly, to the harvest of endometrial tissue samples would be presumably much longer and more severe. In addition, ageing and chronic inflammation are known to be two risk factors for methylation (Hsieh et al., 1998; Issa, 1999; Issa et al., 2001). However, since the promoter hypermethylation is usually associated with gene silencing, the difference in methylation patterns of fragment F1 is more relevant, since both fragments F2 and F3 are in the first intron region.
Decidualization is critical for the successful establishment and maintenance of pregnancy. In the baboon, this process occurs in vivo in response to the conceptus (Kim et al., 1999) and in vitro with long-term treatment of endometrial stromal cells with hormones and dbcAMP (Kim et al., 2003). The major marker for decidualization in the baboon is IGFBP1. The significant increase in IGFBP1 expression in response to H + dbcAMP in diseased animals was notable and unexpected. Recently, it has been reported that the endometrium from women with endometriosis has reduced decidualization capacity (Klemmt et al., 2006), which is contrary to this study. The conflicting observations of the two studies may be due to differences in experimental design as well as status of disease. Klemmt et al. (2006) did not include progesterone to induce decidualization. Only a cAMP agonist, 8-Br-cAMP, was used to treat the stromal cells. Although this treatment may be effective in inducing some genes associated with the decidualization process, it is also known that progesterone is critical in the decidualization process (Brosens and Gellersen, 2006). PGRA null mice exhibit impaired decidualization (Mulac-Jericevic et al., 2000). PGR interacts with other transcription factors and modulates its transactivation potential (Owen et al., 1998; Richer et al., 1998; Christian et al., 2002; Kim et al., 2005). PGR does bind to the IGFBP1 promoter region in the presence of the ligand (Kim et al., 2005). Although the specific mechanism of action of PGR in decidualization remains unclear, it is critical and influences the function of other decidualization genes (Brosens and Gellersen, 2006). This is especially important when studying endometrial tissue from endometriosis since the expression of PGR is different in disease versus disease-free women (Attia et al., 2000) and baboons (Hastings and Fazleabas, 2006). The other important difference observed between the two studies is the length of time of exposure to endometriosis. Thus, the difference between the women in the study of Klemmt et al. (2006) and the baboons in this study could be due to the effect of long-term versus short-term disease. In addition, the cells used in the Klemmt study were obtained randomly at different stages of the menstrual cycle, whereas our studies in the baboon were done with cells obtained during the window of receptivity. Since cells from this stage of the cycle are appropriately primed to respond to a decidualization stimulus, they may more accurately reflect the effects of endometriosis on stromal cell function. Recently, it has been reported that activin A is increased in the eutopic endometrium from women with endometriosis (Rombauts et al., 2006). Since activin A has been demonstrated to promote decidualization (Jones et al., 2002), this increase could result in an increased decidualization response as well.
We and others have shown that HOXA10, on its own, can modestly up-regulate the IGFBP1 promoter (Gao et al., 2002, Kim et al., 2003), and co-operatively up-regulate IGFBP1 promoter activity with FOXO1A (Kim et al., 2003). Thus, the inhibitory effect of HOXA10 on endogenous IGFBP1 gene was unexpected. The regulation of the endogenous IGFBP1 gene by HOXA10 in response to H + dbcAMP most likely involves other processes and transcription factors which cannot be explained by reporter studies. For example, promoter constructs used in reporter studies usually do not encompass the entire promoter region of a particular gene, do not include intronic regions of a gene, which have been shown to bind transcription factors and may play a role in regulating gene expression, and do not undergo chromatin remodelling. The mechanisms by which HOXA10 attenuates IGFBP1 expression remain to be elucidated. The increase in IGFBP1 expression in endometrial tissues at the mid-luteal stage of the menstrual cycle supports the inhibitory role of HOXA10 on the IGFBP1 gene. Previously, it has been shown that IGFBP1 is expressed in the glands of the baboon endometrium during the late secretory stage of the menstrual cycle (Fazleabas et al., 1989) and supports the observations that the endometrium of baboons with endometriosis exhibits a late secretory phenotype rather than the normal mid-secretory phenotype (Jones et al., 2006).
One of the roles of IGFBP1 is to modulate the action of insulin-like growth factors (IGFs) (Jones and Clemmons, 1995). If the levels of IGFBP1 were elevated during decidualization, the normal balance of IGFBP1 to IGFs would be offset and thus result in inadequate function of IGFs. In addition, IGFBP1 can act independently of IGFs which could also disrupt normal cell signalling, via integrin receptors (Jones et al., 1993). To our knowledge, this is the first report that demonstrates a putative inhibitory role of HOXA10 in decidualization. HOXA10 has been demonstrated to act as a repressor molecule in other systems. HOXA10 represses the CYBB and NCF2 genes in differentiating myeloid cells and in mature phagocytes (Eklund et al., 2000; Lu et al., 2003). HOXA10 represses EMX2 expression in Ishikawa cells (Troy et al., 2003). The decrease in HOXA10 levels observed in endometriosis could lead to the de-repression of other critical genes in decidualization. We are currently investigating the role of HOXA10 in regulating other genes of decidualization.
We present here the evidence that HOXA10 is aberrantly expressed in the eutopic endometrium of baboons with endometriosis. Furthermore, endometrial stromal cells from these animals respond differently to hormonal stimuli and express significantly high levels of IGFBP1. The differences observed in the eutopic endometrium of baboons with endometriosis compared with non-diseased animals in our study may affect the receptive nature of the endometrium and, thus, influence the embryo/endometrial crosstalk that is necessary for successful implantation.
| Acknowledgements |
|---|
|
|
|---|
We are grateful to Sue Ferguson-Gottschall and the Cell Culture and Tissue Procurement Core of the University of Illinois, funded by U54 NICHD SCCPRR Grant for their technical assistance. These studies were supported by grant HD044715 from the National Institutes of Health and a grant from the Friends of Prentice (JJK) and by NIH grant U54 HD 40093 (ATF) and HD036887 (HST).
| References |
|---|
|
|
|---|
Arici A, Oral E, Bukulmez O, Duleba A, Olive DL, Jones EE. (1996) The effect of endometriosis on implantation: results from the Yale University in vitro fertilization and embryo transfer program. Fertil Steril 65:603607.[Web of Science][Medline]
Attia GR, Zeitoun K, Edwards D, Johns A, Carr BR, Bulun SE. (2000) Progesterone receptor isoform A but not B is expressed in endometriosis. J Clin Endocrinol Metab 85:28972902.
Bagot CN, Troy PJ, Taylor HS. (2000) Alteration of maternal Hoxa10 expression by in vivo gene transfection affects implantation. Gene Ther 7:13781384.[CrossRef][Web of Science][Medline]
Barnhart K, Dunsmoor-Su R, Coutifaris C. (2002) Effect of endometriosis on in vitro fertilization. Fertil Steril 77:11481155.[CrossRef][Web of Science][Medline]
Benson GV, Lim H, Paria BC, Satokata I, Dey SK, Maas RL. (1996) Mechanisms of reduced fertility in Hoxa-10 mutant mice: uterine homeosis and loss of maternal Hoxa-10 expression. Development 122:26872696.[Abstract]
Bromleigh VC and Freedman LP. (2000) p21 is a transcriptional target of HOXA10 in differentiating myelomonocytic cells. Genes Dev 14:25812586.
Brosens JJ and Gellersen B. (2006) Death or survival - progesterone-dependent cell fate decisions in the human endometrial stroma. J Mol Endocrinol 36:389398.
Browne H and Taylor H. (2006) HOXA10 expression in ectopic endometrial tissue. Fertil Steril 85:13861390.[CrossRef][Web of Science][Medline]
Bruner KL, Matrisian LM, Rodgers WH, Gorstein F, Osteen KG. (1997) Suppression of matrix metalloproteinases inhibits establishment of ectopic lesions by human endometrium in nude mice. J Clin Invest 99:28512857.[Web of Science][Medline]
Cermik D, Selam B, Taylor HS. (2003) Regulation of HOXA-10 expression by testosterone in vitro and in the endometrium of patients with polycystic ovary syndrome. J Clin Endocrinol Metab 88:238243.
Christian M, Zhang X, Schneider-Merck T, Unterman TG, Gellersen B, White JO, Brosens JJ. (2002) Cyclic AMP-induced forkhead transcription factor FKHR, cooperates with CCAAT/enhancer-binding protein beta in differentiating human endometrial stromal cells. J Biol Chem 277:2082520832.
Daftary GS and Taylor HS. (2004) EMX2 gene expression in the female reproductive tract and aberrant expression in the endometrium of patients with endometriosis. J Clin Endocrinol Metab 89:23902396.
Daftary GS, Troy PJ, Bagot CN, Young SL, Taylor HS. (2002) Direct regulation of beta3-integrin subunit gene expression by HOXA10 in endometrial cells. Mol Endocrinol 16:571579.
Daikoku T, Tranguch S, Friedman DB, Das SK, Smith DF, Dey SK. (2005) Proteomic analysis identifies immunophilin FK506 binding protein 4 (FKBP52) as a downstream target of Hoxa10 in the periimplantation mouse uterus. Mol Endocrinol 19:683697.
D'Hooghe TM. (1997) Clinical relevance of the baboon as a model for the study of endometriosis. Fertil Steril 68:613625.[CrossRef][Web of Science][Medline]
D'Hooghe TM, Bambra CS, Raeymaekers BM, De Jonge I, Lauweryns JM, Koninckx PR. (1995) Intrapelvic injection of menstrual endometrium causes endometriosis in baboons (Papio cynocephalus and Papio anubis). Am J Obstet Gynecol 173:125134.[CrossRef][Web of Science][Medline]
Dimitriadis E, Stoikos C, Stafford-Bell M, Clark I, Paiva P, Kovacs G, Salamonsen LA. (2006) Interleukin-11, IL-11 receptoralpha and leukemia inhibitory factor are dysregulated in endometrium of infertile women with endometriosis during the implantation window. J Reprod Immunol 69:5364.[CrossRef][Web of Science][Medline]
Eklund EA, Jalava A, Kakar R. (2000) Tyrosine phosphorylation of HoxA10 decreases DNA binding and transcriptional repression during interferon gamma-induced differentiation of myeloid leukemia cell lines. J Biol Chem 275:2011720126.
Eskenazi B and Warner ML. (1997) Epidemiology of endometriosis. Obstet Gynecol Clin North Am 24:235258.[CrossRef][Web of Science][Medline]
Fazleabas AT. (2006) A baboon model for inducing endometriosis. Methods Mol Med 121:9599.[Medline]
Fazleabas AT, Jaffe RC, Verhage HG, Waites G, Bell SC. (1989) An insulin-like growth factor-binding protein in the baboon (Papio anubis) endometrium: synthesis, immunocytochemical localization, and hormonal regulation. Endocrinology 124:23212329.
Fazleabas AT, Donnelly KM, Srinivasan S, Fortman JD, Miller JB. (1999) Modulation of the baboon (Papio anubis) uterine endometrium by chorionic gonadotrophin during the period of uterine receptivity. Proc Natl Acad Sci USA 96:25432548.
Fazleabas AT, Brudney A, Gurates B, Chai D, Bulun S. (2002) A modified baboon model for endometriosis. Ann NY Acad Sci 955:308317 discussion 3402, 396406.[Web of Science][Medline]
Fazleabas AT, Brudney A, Chai D, Langoi D, Bulun SE. (2003) Steroid receptor and aromatase expression in baboon endometriotic lesions. Fertil Steril 80:Suppl 2, 820827.[CrossRef][Web of Science][Medline]
Ferrell CM, Dorsam ST, Ohta H, Humphries RK, Derynck MK, Haqq C, Largman C, Lawrence HJ. (2005) Activation of stem-cell specific genes by HOXA9 and HOXA10 homeodomain proteins in CD34+ human cord blood cells. Stem Cells 23:644655.[CrossRef][Web of Science][Medline]
Frommer M, McDonald LE, Millar DS, Collis CM, Watt F, Grigg GW, Molloy PL, Paul CL. (1992) A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc Natl Acad Sci USA 89:18271831.
Gao J, Mazella J, Tseng L. (2002) Hox proteins activate the IGFBP-1 promoter and suppress the function of hPR in human endometrial cells. DNA Cell Biol 21:819825.[CrossRef][Web of Science][Medline]
Gashaw I, Hastings JM, Jackson KS, Winterhager E, Fazleabas AT. (2006) Induced endometriosis in the baboon (Papio anubis) increases the expression of the proangiogenic factor CYR61 (CCN1) in eutopic and ectopic endometria. Biol Reprod 74:10601066.
Grummer R. (2006) Animal models in endometriosis research. Hum Reprod Update 12:641649.
Gui Y, Zhang J, Yuan L, Lessey BA. (1999) Regulation of HOXA-10 and its expression in normal and abnormal endometrium. Mol Hum Reprod 5:866873.
Hastings JM, Jackson KS, Mavrogianis PA, Fazleabas AT. (2006) The estrogen early response gene FOS, is altered in a baboon model of endometriosis. Biol Reprod 75:176182.
Hsieh CJ, Klump B, Holzmann K, Borchard F, Gregor M, Porschen R. (1998) Hypermethylation of the p16INK4a promoter in colectomy specimens of patients with long-standing and extensive ulcerative colitis. Cancer Res 58:39423945.
Issa JP. (1999) Aging DNA methylation and cancer. Crit Rev Oncol Hematol 32:3143.[Web of Science][Medline]
Issa JP, Ahuja N, Toyota M, Bronner MP, Brentnall TA. (2001) Accelerated age-related CpG island methylation in ulcerative colitis. Cancer Res 61:35733577.
Jones JI and Clemmons DR. (1995) Insulin-like growth factors and their binding proteins: biological actions. Endocr Rev 16:334.
Jones JI, Gockerman A, Busby WH Jr, Wright G, Clemmons DR. (1993) Insulin-like growth factor binding protein 1 stimulates cell migration and binds to the alpha 5 beta 1 integrin by means of its Arg-Gly-Asp sequence. Proc Natl Acad Sci USA 90:1055310557.
Jones RL, Salamonsen LA, Findlay JK. (2002) Activin A promotes human endometrial stromal cell decidualization in vitro. J Clin Endocrinol Metab 87:40014004.
Jones CJP, Denton J, Fazleabas AT. (2006) Morphological and glycosylation changes associated with the endometrium in a baboon model of endometriosis. Hum Reprod 21:30683080.
Kao LC, Germeyer A, Tulac S, Lobo S, Yang JP, Taylor RN, Osteen K, Lessey BA, Giudice LC. (2003) Expression profiling of endometrium from women with endometriosis reveals candidate genes for disease-based implantation failure and infertility. Endocrinology 144:28702881.
Kim JJ, Jaffe RC, Fazleabas AT. (1999) Blastocyst invasion and the stromal response in primates. Hum Reprod 14:Suppl 2, 4555.
Kim JJ, Taylor HS, Akbas GE, Foucher I, Trembleau A, Jaffe RC, Fazleabas AT, Unterman TG. (2003) Regulation of insulin-like growth factor binding protein-1 promoter activity by FKHR and HOXA10 in primate endometrial cells. Biol Reprod 68:2430.
Kim JJ, Buzzio OL, Li S, Lu Z. (2005) Role of FOXO1A in the regulation of insulin-like growth factor-binding protein-1 in human endometrial cells: interaction with progesterone receptor. Biol Reprod 73:833839.
Klemmt PA, Carver JG, Kennedy SH, Koninckx PR, Mardon HJ. (2006) Stromal cells from endometriotic lesions and endometrium from women with endometriosis have reduced decidualization capacity. Fertil Steril 85:564572.[CrossRef][Web of Science][Medline]
Krumlauf R. (1992) Transforming the Hox code. Curr Biol 2:641643.[CrossRef][Medline]
Lessey BA, Castelbaum AJ, Sawin SW, Buck CA, Schinnar R, Bilker W, Strom BL. (1994) Aberrant integrin expression in the endometrium of women with endometriosis. J Clin Endocrinol Metab 79:643649.[Abstract]
Littman E, Giudice L, Lathi R, Berker B, Milki A, Nezhat C. (2005) Role of laparoscopic treatment of endometriosis in patients with failed in vitro fertilization cycles. Fertil Steril 84:15741578.[CrossRef][Web of Science][Medline]
Livak KJ and Schmittgen TD. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402408.[CrossRef][Web of Science][Medline]
Lu Y, Goldenberg I, Bei L, Andrejic J, Eklund EA. (2003) HoxA10 represses gene transcription in undifferentiated myeloid cells by interaction with histone deacetylase 2. J Biol Chem 278:4779247802.
Mulac-Jericevic B, Mullinax RA, DeMayo FJ, Lydon JP, Conneely OM. (2000) Subgroup of reproductive functions of progesterone mediated by progesterone receptor-B isoform. Science 289:17511754.
Owen GI, Richer JK, Tung L, Takimoto G, Horwitz KB. (1998) Progesterone regulates transcription of the p21(WAF1) cyclin- dependent kinase inhibitor gene through Sp1 and CBP/p300. J Biol Chem 273:1069610701.
Pellicer A, Oliveira N, Ruiz A, Remohi J, Simon C. (1995) Exploring the mechanism(s) of endometriosis-related infertility: an analysis of embryo development and implantation in assisted reproduction. Hum Reprod 10 Suppl 2, 9197.
Richer JK, Lange CA, Manning NG, Owen G, Powell R, Horwitz KB. (1998) Convergence of progesterone with growth factor and cytokine signaling in breast cancer. Progesterone receptors regulate signal transducers and activators of transcription expression and activity. J Biol Chem 273:3131731326.
Rombauts L, Donoghue J, Cann L, Jones RL, Healy DL. (2006) Activin-A secretion is increased in the eutopic endometrium from women with endometriosis. Aust NZ J Obstet Gynaecol 46:148153.[CrossRef][Web of Science][Medline]
Salih SM and Taylor HS. (2004) HOXA10 gene expression in human fallopian tube and ectopic pregnancy. Am J Obstet Gynecol 190:14041406.[CrossRef][Web of Science][Medline]
Sallam HN, Garcia-Velasco JA, Dias S, Arici A. (2006) Long-term pituitary down-regulation before in vitro fertilization (IVF) for women with endometriosis. Cochrane Database Syst Rev CD004635.
Sarno JL, Kliman HJ, Taylor HS. (2005) HOXA10, Pbx2, and Meis1 protein expression in the human endometrium: formation of multimeric complexes on HOXA10 target genes. J Clin Endocrinol Metab 90:522528.
Schenken RS and Asch RH. (1980) Surgical induction of endometriosis in the rabbit: effects on fertility and concentrations of peritoneal fluid prostaglandins. Fertil Steril 34:581587.[Web of Science][Medline]
Sugawara J, Fukaya T, Murakami T, Yoshida H, Yajima A. (1997) Increased secretion of hepatocyte growth factor by eutopic endometrial stromal cells in women with endometriosis. Fertil Steril 68:468472.[CrossRef][Web of Science][Medline]
Tabibzadeh S, Mason JM, Shea W, Cai Y, Murray MJ, Lessey B. (2000) Dysregulated expression of ebaf, a novel molecular defect in the endometria of patients with infertility. J Clin Endocrinol Metab 85:25262536.
Taylor HS, Arici A, Olive D, Igarashi P. (1998) HOXA10 is expressed in response to sex steroids at the time of implantation in the human endometrium. J Clin Invest 101:13791384.[Web of Science][Medline]
Taylor HS, Bagot C, Kardana A, Olive D, Arici A. (1999) HOX gene expression is altered in the endometrium of women with endometriosis. Hum Reprod 14:13281331.
Troy PJ, Daftary GS, Bagot CN, Taylor HS. (2003) Transcriptional repression of peri-implantation EMX2 expression in mammalian reproduction by HOXA10. Mol Cell Biol 23:113.
Uzan C, Cortez A, Dufournet C, Fauvet R, Siffroi JP, Darai E. (2004) Eutopic endometrium and peritoneal, ovarian and bowel endometriotic tissues express a different profile of matrix metalloproteinases-2, -3 and -11, and of tissue inhibitor metalloproteinases-1 and -2. Virchows Arch 445:603609.[CrossRef][Web of Science][Medline]
Vernon MW and Wilson EA. (1985) Studies on the surgical induction of endometriosis in the rat. Fertil Steril 44:684694.[Web of Science][Medline]
Wu Y, Halverson G, Basir Z, Strawn E, Yan P, Guo SW. (2005) Aberrant methylation at HOXA10 may be responsible for its aberrant expression in the endometrium of patients with endometriosis. Am J Obstet Gynecol 193:371380.[CrossRef][Web of Science][Medline]
Yang S, Fang Z, Suzuki T, Sasano H, Zhou J, Gurates B, Tamura M, Ferrer K, Bulun S. (2002) Regulation of aromatase P450 expression in endometriotic and endometrial stromal cells by CCAAT/enhancer binding proteins (C/EBPs): decreased C/EBPbeta in endometriosis is associated with overexpression of aromatase. J Clin Endocrinol Metab 87:23362345.
Zamah NM, Dodson MG, Stephens LC, Buttram VC Jr, Besch PK, Kaufman RH. (1984) Transplantation of normal and ectopic human endometrial tissue into athymic nude mice. Am J Obstet Gynecol 149:591597.[Web of Science][Medline]
Submitted on January 9, 2007; accepted on January 12, 2007.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S. Matsuzaki, M. Canis, C. Darcha, J.-L. Pouly, and G. Mage HOXA-10 expression in the mid-secretory endometrium of infertile patients with either endometriosis, uterine fibromas or unexplained infertility Hum. Reprod., December 1, 2009; 24(12): 3180 - 3187. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.G. Braundmeier and A.T. Fazleabas The non-human primate model of endometriosis: research and implications for fecundity Mol. Hum. Reprod., October 1, 2009; 15(10): 577 - 586. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-W. Guo Epigenetics of endometriosis Mol. Hum. Reprod., October 1, 2009; 15(10): 587 - 607. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Winterhager, R. Grummer, P.A. Mavrogianis, C.J.P. Jones, J.M. Hastings, and A.T. Fazleabas Connexin expression pattern in the endometrium of baboons is influenced by hormonal changes and the presence of endometriotic lesions Mol. Hum. Reprod., October 1, 2009; 15(10): 645 - 652. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Aghajanova, M. C. Velarde, and L. C. Giudice The Progesterone Receptor Coactivator Hic-5 Is Involved in the Pathophysiology of Endometriosis Endocrinology, August 1, 2009; 150(8): 3863 - 3870. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Tsuno, K. Nasu, A. Yuge, H. Matsumoto, M. Nishida, and H. Narahara Decidualization Attenuates the Contractility of Eutopic and Ectopic Endometrial Stromal Cells: Implications for Hormone Therapy of Endometriosis J. Clin. Endocrinol. Metab., July 1, 2009; 94(7): 2516 - 2523. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Bromer, J. Wu, Y. Zhou, and H. S. Taylor Hypermethylation of Homeobox A10 by in Utero Diethylstilbestrol Exposure: An Epigenetic Mechanism for Altered Developmental Programming Endocrinology, July 1, 2009; 150(7): 3376 - 3382. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. P. Jones, I. M. Inuwa, L. G. Nardo, P. Litta, and A. T. Fazleabas Eutopic Endometrium From Women With Endometriosis Shows Altered Ultrastructure and Glycosylation Compared to That From Healthy Controls--A Pilot Observational Study Reproductive Sciences, June 1, 2009; 16(6): 559 - 572. [Abstract] [PDF] |
||||
![]() |
T.M. D'Hooghe, C.M. Kyama, D. Chai, A. Fassbender, A. Vodolazkaia, A. Bokor, and J.M. Mwenda Nonhuman Primate Models for Translational Research in Endometriosis Reproductive Sciences, February 1, 2009; 16(2): 152 - 161. [Abstract] [PDF] |
||||
![]() |
G. Weiss, L. T. Goldsmith, R. N. Taylor, D. Bellet, and H. S. Taylor Inflammation in Reproductive Disorders Reproductive Sciences, February 1, 2009; 16(2): 216 - 229. [Abstract] [PDF] |
||||
![]() |
C. Wang, P. A. Mavrogianis, and A. T. Fazleabas Endometriosis Is Associated with Progesterone Resistance in the Baboon (Papio anubis) Oviduct: Evidence Based on the Localization of Oviductal Glycoprotein 1 (OVGP1) Biol Reprod, February 1, 2009; 80(2): 272 - 278. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Lee, H. Du, and H. S. Taylor Experimental Murine Endometriosis Induces DNA Methylation and Altered Gene Expression in Eutopic Endometrium Biol Reprod, January 1, 2009; 80(1): 79 - 85. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Borghese, F. Mondon, J.-C. Noel, I. Fayt, T.-M. Mignot, D. Vaiman, and C. Chapron Research Resource: Gene Expression Profile for Ectopic Versus Eutopic Endometrium Provides New Insights into Endometriosis Oncogenic Potential Mol. Endocrinol., November 1, 2008; 22(11): 2557 - 2562. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Penna, H. Du, R. Ferriani, and H. S. Taylor Calpain5 expression is decreased in endometriosis and regulated by HOXA10 in human endometrial cells Mol. Hum. Reprod., October 1, 2008; 14(10): 613 - 618. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Lu, J. Hardt, and J.J. Kim Global analysis of genes regulated by HOXA10 in decidualization reveals a role in cell proliferation Mol. Hum. Reprod., June 1, 2008; 14(6): 357 - 366. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Minici, F. Tiberi, A. Tropea, M. Orlando, M. F. Gangale, F. Romani, S. Campo, A. Bompiani, A. Lanzone, and R. Apa Endometriosis and human infertility: a new investigation into the role of eutopic endometrium Hum. Reprod., March 1, 2008; 23(3): 530 - 537. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||












