Mol. Hum. Reprod. Advance Access originally published online on April 12, 2007
Molecular Human Reproduction 2007 13(6):381-390; doi:10.1093/molehr/gam015
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Characterization of cAMP/PKA/CREB signaling cascade in the bonnet monkey corpus luteum: expressions of inhibin-
and StAR during different functional status
1 Department of Molecular Reproduction, Development and Genetics Indian Institute of Science, Bangalore 560012, India 2 Primate Research Laboratory, Indian Institute of Science, Bangalore, 560012, India
3 Correspondence address. E-mail: rmm{at}mrdg.iisc.ernet.in
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionSupplementary dataAcknowledgementsReferences |
|---|
Luteinizing hormone mediates its nuclear action primarily by activating cAMP/Protein kinase A (PKA) pathway leading to phosphorylation of cAMP response element binding (CREB) family of transcription factors. Earlier studies have documented altered cAMP responsiveness of luteal cells during maturation, and in the rhesus monkey, extinction of CREB expression following luteinization and ovulation. In the course of studies aimed at characterizing LH-cAMP signaling pathway, we serendipitously discovered that CREB is after all present in the monkey corpus luteum (CL). The present experiments were carried out to examine the PKA activity, CREB expression and RT–PCR expression of inhibin-
(Inh-) subunit and steroidogenic acute regulatory protein (StAR) in CL obtained from a variety of model systems. PKA activity in the CL was maintained throughout the luteal phase. Messenger RNA expression by RT–PCR and Northern analyses and protein levels employing antibodies specific to total- and phospho-forms demonstrated presence of CREB in the CL. Additionally, immuno-histo/cytochemical analyses, Electrophoretic mobility shift assays and chromatin immunoprecipitation assays for Inh- and StAR genes further confirmed the presence of CREB in the CL. The present study, contrary to an earlier report, demonstrates the presence of CREB (both transcript and protein) in the monkey CL. Also, analysis of expression of Inh- and StAR genes (considered to be cAMP responsive), during different functional status of CL suggests that LH regulates their expression perhaps by cAMP/PKA/CREB pathway.
Key words:
bonnet monkey/corpus luteum/CREB/inhibin- and StAR expressions/PKA
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionSupplementary dataAcknowledgementsReferences |
|---|
Through secretion of progesterone (P4) as well as other hormones/factors, corpus luteum (CL) plays a pivotal role during establishment and, in some species, the maintenance of pregnancy in mammals (Niswender et al., 2000; Stouffer, 2003). In primates during non-fertile menstrual cycles, the CL has a finite lifespan and regresses at the end of the cycle to allow for initiation of a new cycle and ovulation to re-occur. On the other hand, during menstrual cycles in which conception occurs and implantation ensues, the prolongation of luteal function, beyond its lifespan, by the chorionic gonadotropin (CG) is obligatory for the maintenance of early pregnancy (Neill and Knobil, 1972; Zeleznik and Benyo, 1994). Understanding of molecular and biochemical events in the luteal cells will help in elucidating mechanisms by which functions of CL are governed to accommodate its dual responsibilities, namely luteolysis and rescue.
The classical adenylyl cyclase/cAMP/Protein kinase A (PKA) signaling pathway is considered to be the primary signaling cascade through which gonadotropins regulate gene expression in the ovary (Vandevoort et al., 1988; Richards, 2001; Conti, 2002). One major role of protein kinases is to regulate transcription factors that interact with specific DNA control elements located in the promoter region of target genes and thereby activate or repress transcription (Richards, 2001; Richards et al., 2002). The cAMP response element binding protein (CREB) is a member of large super family of DNA binding proteins collectively known as the bZIP proteins. CREB functions as the final communicative link in the regulation of gene expression in response to activation of cAMP-mediated signaling cascades by hormones via its phosphorylation at Ser133, and interaction with CRE (TGACGTCA) or CRE-like sequences of target genes (Mukherjee et al., 1996; Montminy, 1997; Flammer et al., 2006). Extensive studies carried out on biological functions of CREB have shown that it plays a vital role in a variety of cellular processes including proliferation (Kinjo et al., 2005; Kovach et al., 2006), differentiation and as survival factor (Saini et al., 2004). In the ovary, the promoter regions of several genes, such as - and ß-subunits of inhibin (Inh), steroidogenic acute regulatory protein (StAR), aromatase (AROM) and inducible cAMP early repressor (ICER) possess CRE or CRE-like sequence that is under the control of cAMP/PKA/CREB pathway (Pei et al., 1991; Fitzpatrick et al., 1994; Michael et al., 1997; Ardekani et al., 1998; Mukherjee et al., 1998; Manna et al., 2002). In monkeys, Somers et al. (1995) reported loss of 43 kDa CREB expression after ovulation and the authors speculated that some of the nuclear actions of cAMP/PKA/CREB pathway may be suppressed in the CL without compromising the ability of luteal cells to produce P4 in response to circulating LH levels. Also, the authors further speculated that extinction of CREB expression in the CL may lead to cessation of proliferation, down-regulation of CREB-dependent cAMP mediated gene regulation and loss of protection of luteal cells from apoptosis (Zeleznik and Somers, 1999). However, more recent studies involving DD RT–PCR, transcriptome analysis by way of microarray analysis of CL tissues after inhibition of pituitary LH secretion (Yadav et al., 2004; Xu et al., 2005) provide compelling support for nuclear actions of LH, suggesting perhaps, albeit differently, the operation of full complement of cAMP/PKA/CREB pathway in the CL. Moreover, no definitive correlation between the activity of PKA and steriodogenesis in the monkey CL has been established, since PKA levels are reported to be maintained throughout the menstrual cycle, and paradoxically decrease in luteal tissue homogenates under in vitro conditions following hCG treatment (Benyo and Zeleznik, 1997).
In light of the above information, the present experiments were carried out with the following objectives: (i) to establish correlation between circulating P4 and the activity of PKA throughout the luteal phase, and during different functional status of CL, (ii) to systematically examine the expression and cellular localization of CREB in the bonnet monkey (Macaca radiata) CL and (iii) to examine the expression patterns of a few genes containing CRE-like sequences in the promoter region in the CL tissue during different functional status.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionSupplementary dataAcknowledgementsReferences |
|---|
Reagents
The polyclonal antibodies specific to CREB (#9192, raised in rabbits using the KLH coupled synthetic peptide which corresponds to residues encompassing Ser133 of human CREB), phospho-CREB (pCREB) (#9191, raised in rabbits using the KLH coupled synthetic phospho peptide which has phosphorylation at Ser133 of human CREB), ERK2 (#sc-154, raised in rabbits against the C-terminus of rat ERK2) and pCREB blocking peptide (#1090) were purchased from Cell Signaling Technology, Beverly, MA, USA (#9191, #9192 and #1090) and Santa Cruz Biotechnology, Santa Cruz, CA, USA (#sc-154). Signa TECT® cAMP-dependent protein kinase A assay system (V7480), pGEMT easy vector system I, avian myeloblastoma virus (AMV) RT, random hexamers, RNAsin and Wizard plasmid Mini-preparation purification kit were purchased from Promega, Madison, WI, USA. Oligonucleotide primers were synthesized by Sigma-Genosys, UK. DyNAzymeTM II DNA polymerase (F-501L) was purchased from Finnzymes, Finland. Restriction enzymes and 100 bp DNA ladder were obtained from MBI Fermentas, Germany. For random primer labeling, the random primer extension labeling kit (KT04) was purchased from Bangalore Genei, Bangalore, India. [
32 P]dCTP and [
32 P]ATP were procured from Perkin Elmer Life Sciences Inc., Boston, MA, USA. GnRH antagonist (Cetrorelix®; CET) was a kind gift from Asta Medica, Frankfurt, Germany. Human CG (hCG, Profasi®), hFSH (Metrodin) and hFSH plus hLH (Pergonal) were from Ares Serono, Aubonne, Switzerland. Anti-PECAM antibody coated Dynabeads (111.28) were purchased from Dynal Biotech S.A., Compiegne, France. All other reagents were purchased from Sigma Aldrich Co., St Louis, MO, USA, Gibco BRL, Gaithersburg, MD, USA or sourced locally.
Animal protocols and tissue collection
Experimental protocols in the monkeys were approved by the Institutional Animal Ethics Committee of the Indian Institute of Science. The general care and housing of monkeys at the Primate Research Laboratory, Indian Institute of Science, Bangalore have been described elsewhere (Srinath, 1979). Adult female bonnet monkeys (M. radiata) were monitored daily for onset of menses and blood samples (
1.5 ml) through femoral venipuncture were collected daily from day 8 to 12 of the menstrual cycle for determining the onset of estradiol (E2) and LH surges. Further blood samples were collected either daily or at more frequent intervals until the time of CL retrieval. For this study, 1 day after LH peak was designated as day 1 of the luteal phase. For the purposes of determining PKA activity, various analyses and expression of CREB and other genes, CL was obtained from monkeys from a variety of model systems (see below) as described previously (Yadav et al., 2004). Immediately after collection, the CL was cut into 4–5 pieces and snap frozen in liquid nitrogen before storage at – 70°C. One piece was fixed in 4% parformaldehyde for histochemical analysis when required.
Exp. I: stages of CL development and function
CL (n = 4/stage) was collected from monkeys experiencing spontaneous menstrual cycles at early- (d5), mid- (d8) and late- (d14) luteal phase of the menstrual cycle. For dissociation and isolation of luteal cells and for preparation of nuclear extracts, CL from at least two different monkeys during mid-luteal phase was utilized.
Exp. II: GnRH-antagonist induced luteolysis
In a previous study from this laboratory, it was observed that administration of GnRH-R antagonist, CET at a dose of 75 µg/kg BW twice daily for 3 days induced luteolysis and initiation of menses 4–5 days after start of treatment (Yadav et al., 2004). In the present experiment, CL was collected 48 h after administration of 5.25% glucose (Veh, n = 3) or CET (n = 3), since biochemical and molecular changes in response to CET treatment were marked in the CL tissue at this time point (Yadav and Medhamurthy, 2006).
Exp. III: simulation of early pregnancy
To simulate early pregnancy during the luteal phase of the non-fertile menstrual cycle, peri-implantation rise in CG was mimicked by exogenous administration of incremental dose of hCG treatment as reported previously from this laboratory (Yadav et al., 2004). CL was collected on day 14 of the luteal phase from monkeys (n = 3) receiving hCG treatment on days 9–13 of the luteal phase. The CL (n = 3) collected on day 14 of the luteal phase without treatment served as control tissue for hCG treatment.
Granulosa cell collection
Starting from day 1 of menses, monkeys were treated with exogenous human gonadotropin preparations, 25 IU of Metrodin twice daily i.m. for 6 days, followed by 25 IU of Pergonal twice daily i.m. for 3 days to promote multiple follicular growth and development as reported previously (Uma et al., 2003). Following laparotomy, granulosa cell (GC) containing follicular fluid was aspirated from individual pre-ovulatory-like follicles with the help of 24''G needle attached to 1 ml syringe and centrifuged at 290g for 7 min at 4°C. The resultant cell pellet was snap frozen in liquid nitrogen and stored at – 70°C until further analysis.
PKA assays
PKA assays were performed according to the manufacturer's instructions provided with the kit. The activity of PKA was determined by measuring the incorporation of 32P from [32P] ATP to biotinylated kemptide, a peptide substrate highly specific for PKA. The 32P labeled biotinylated substrate was recovered from the reaction mix with SAM2® Biotin Capture Membrane, a novel streptavidin matrix. Briefly, luteal tissue (15 mg) was homogenized in 100 µl of cold extraction buffer containing 25 mM Tris–HCl, 0.5 mM EDTA, 0.5 mM EGTA, 10 mM ßME, 1 µg/ml leupeptin, 1 µg/ml aprotinin and centrifuged at 14 000g at 4°C for 5 min. After determining protein concentration, the tissue lysate was diluted in 0.1 mg/ml BSA to adjust protein concentration in the lysates to 20 µg/5 µl, which was well within the previously determined linear range of PKA assay (15–50 µg protein). The kinase activity of the catalytic subunit of PKA in 5 µl of lysate was carried out in duplicates in a 25 µl reaction consisting of PKA assay buffer, cAMP, PKA biotinylated peptide substrate and [32P] ATP by incubating at 30°C for 5 min. The reaction was terminated by adding 12.5 µl of termination buffer and 10 µl of reaction mixture was spotted onto SAM membrane square, and the membrane was washed four times each with 2 M NaCl, 2 M NaCl in 1% H3PO4 and finally twice with double distilled water. The individual membrane square was dried and then transferred to liquid scintillation vials for counting 32P. A control reaction without the substrate was also included for determining the background activity and that was subtracted from the total activity of standard and test samples.
RNA isolation
Total RNA was isolated from CL tissue and GCs using Trizol reagent according to the manufacturer's recommendations. The quality and quantity of RNA samples were assessed spectrophotometrically as well as on a 1% formaldehyde agarose gel. The OD at 260:280 nm consistently gave a ratio of > 1.8.
Reverse transcription–polymerase chain reaction
Total RNA (1 µg) was used for reverse transcription in a 20 µl reaction using Avian Myeloblastoma Virus Reverse Transcriptase. After incubation for 1 h at 37°C, 1 µl of cDNA was amplified by PCR in a 50 µl reaction mixture containing 5 µl of 10 x PCR buffer, 0.2 mM dNTP, 50 ng of each primer, 2 mM MgCl2 and two units of DyNAzyme II DNA polymerase. The PCR products were cloned into pGEMT easy vector system I, and the identity of all products were confirmed by automated sequencing. The sequences obtained were compared with Genbank databases using computer searches and sequence alignments at http://www.ncbi.nlm.nih.gov and http://searchlauncher.bcm.tmc.edu. For quantification of CREB, Inh- and StAR mRNA expressions during different functional status, semi-quantitative RT–PCR was performed by optimizing the parameters including the number of cycles (Annealing temperature 58°C, 32 cycles for CREB, 27 cycles for Inh- and 24 cycles for StAR) such that all the products were in the exponential phase.
Northern analysis
Northern blot analysis of total RNA (20 µg) from the mid-stage CL was carried out essentially as described previously (Yadav et al., 2002).
Immunoblot analysis
CL tissue and GC lysates were prepared following the previously published procedures (Yadav et al., 2002). The lysates were resolved by 10% SDS–PAGE and electro blotted onto polyvinylidene difluoride (PVDF) membrane using semi-dry electro-transfer unit (BioRad Laboratories, Richmond, CA, USA). Autoradiographs were scanned using UVI-Tech gel documentation system and quantitated using UVI-Band Map (1999) software.
Dissociation and separation of luteal cells
CL from mid-luteal phase, after collection, was minced with scalpel blade and dissociated according to the method of Stouffer et al. (1976) with minor modifications. Briefly, tissue fragments were dispersed in M199 medium containing 24 mM HEPES pH 7.4, 0.2% BSA and incubated in shaker water bath at 37°C for 15 min. The supernatant was decanted and replaced with fresh dissociation medium containing 0.16% collagenase, 30 units/ml DNAse and 0.5% BSA. The tissue fragments were sheared using 10 ml pipette every 10 min to facilitate dissociation and after 45 min of dissociation, the medium was decanted and centrifuged at 250g for 5 min. Fresh medium containing collagenase was added to the remaining tissue for an additional 45 min of dissociation. Cells from both the dissociations were pelleted by centrifugation and washed four times with fresh M199 medium containing 0.2% BSA. Dispersed cells were subjected to 50% Percoll gradient to get rid of erythrocytes and damaged cells. Following centrifugation at 400g for 10 min, the enriched cell fraction was suspended in PBS. The endothelial cells were separated from the cell suspension using immunomagnetic beads coated with anti-PECAM antibody according to the manufacturer's protocol. The cell number was counted by hemocytometer and viability was determined by Trypan Blue exclusion method. An aliquot each of luteal and endothelial cell enriched fractions was cultured overnight at 37°C in an atmosphere of humidified air with 5% CO2 and the supernatant removed for determining P4 concentrations and only supernatant from the luteal cells indicated significant amount of P4. Additionally, the separated luteal and endothelial cell fractions were incubated with the necessary substrate and cofactor essential for identifying 3ß-hydroxysteroid dehydrogenase (3ß-HSD) activity in the luteal cells, which was carried out according to the method described previously for Leydig cells (Medhamurthy et al., 1995). Only separated luteal cells fraction stained for 3ß-HSD activity and cells were processed for immunocytochemistry and Chromatin immunoprecipitation (ChIP) assays as described later.
Immunohisto- and cytochemical analyses
Cryosections of 5 µm thickness of CL tissue were fixed in 4% parformaldehyde solution for 30 min. The sections were washed in PBS and boiled in 0.5 M sodium citrate for 6 min with intermittent cooling. After washing, sections were blocked for 1 h at room temperature with 0.5% BSA-PBS containing 5% normal goat serum. For immunocytochemical analysis, luteal cells were fixed using 4% parformaldehyde for 1 h at room temperature, washed in PBS and then blocked with 5% normal goat serum in 0.5% BSA-PBS for 1 h at room temperature. Slides were next incubated with suitable dilutions of antisera for CREB (1:100 for tissue sections and 1:300 for luteal cells) and pCREB (1:100 for tissue sections and 1:500 for luteal cells) overnight at 4°C. After several PBS washes, slides were incubated with tetramethyl rhodamine isothiocyanate (TRITC) conjugated goat anti-rabbit IgG (1:200) in 0.5% BSA-PBS for 1 h at room temperature. Slides were washed six times with PBS for 5 min each time and mounted in 50% glycerol containing DAPI (100 µg/ml) for counterstaining and visualized in the confocal microscope (Leica TCS, Wetzlar, Germany).
Nuclear extract preparation
Nuclear extracts were prepared from the mid-stage CL as described previously by Andrews and Faller (1991). Briefly, CL (100 mg) was homogenized employing Potter–Elvehjem Tissue Grinder with PTFE pestle in 1 ml of homogenization buffer (10 mM HEPES, pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.3 mM sucrose, 0.1 mM EGTA, 0.5 mM DTT, 1 mM Na3VO4, 1 mM NaF, 0.1% NP-40, 0.5 mM PMSF, 4 µg/ml aprotinin and 2 µg/ml leupeptin) and centrifuged at 870g for 20 min at 4°C. The pellet was washed twice with homogenization buffer, suspended in 150 µl of nuclear extract buffer (20 mM HEPES, pH 7.9, 420 mM NaCl, 1.5 mM MgCl2, 0.1 mM EGTA, 0.2 mM EDTA, 25% glycerol, 1 mM DTT, 0.5 mM spermidine, 10 µg/ml aprotinin, 5 µg/ml leupeptin, 1 mM Na3VO4 and 0.5 mM PMSF) and incubated on ice for 1 h with gentle mixing before centrifugation at 19 060g for 20 min. The resultant supernatant (nuclear fraction) was aliquoted and stored at – 70°C.
Electrophoretic mobility shift assays
Electrophoretic mobility shift assay (EMSA) was performed using nuclear extracts of mid-stage CL tissue according to the method described previously (Carlone and Richards, 1997). Briefly, nuclear extracts (5 µg) were incubated for 30 min at 4°C with 25 000 cpm of 32P end filled double stranded CRE probe of rat somatostatin gene (5' GATCCTTGGCTGACGTCAGAGAGAGAG 3') or double stranded CRE probe of monkey Inh- subunit gene (5'GCCACAGACATCTGCGTCAGAGATAGGAG 3') and salmon sperm DNA (1 µg) in a final buffer volume of 20 µl containing 15 mM Tris–HCl (pH 7.5), 100 mM KCl, 5 mM DTT, 1 mM EDTA, 5 mM MgCl2 and 12% glycerol. To determine the specificity of binding, 100-fold excess of unlabeled competitor CRE sequence was added. For super shift assays, the nuclear extracts were incubated with 1 µl of CREB antibody for 30 min on ice before the addition of labeled probe. Protein/DNA complexes were resolved on a 5% non-denaturing polyacrylamide gel in 0.5 x TBE at 100 V at 22°C. The gels were dried and exposed to Kodak X-ray film at – 70°C for 1–2 days.
ChIP assay
ChIP assays were performed by the modified technique described by Kuo and Allis (1999). Briefly, luteal cells (1 x 106) were treated with 1% formaldehyde at 37°C for 10 min with occasional shaking. The cells were washed twice in PBS containing protease inhibitors (1 µg/ml aprotinin, 1 µg/ml leupeptin and 1 mM PMSF), 20 mM sodium fluoride and 1 mM sodium orthovanadate. The resultant pellet was resuspended in 200–300 µl of ChIP lysis buffer (50 mM Tris, pH 8.1, 10 mM EDTA, 1% SDS containing the above cocktail of protease inhibitors) and incubated on ice for 10 min. Sonication of cell lysates was done seven times with a sonicator (KIKA Labortechnik Staufen, Germany) in 10-s bursts followed by cooling on ice for 2 min. After sonication, the samples were centrifuged (12 000g) for 15 min at 4°C and an aliquot of supernatant was used as input DNA for normalization of chromatin input, and the remainder was diluted 1:10 in ChIP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA and 16.7 mM Tris–HCl) containing the protease inhibitors as described earlier. Samples were directly used in ChIP assays or stored at – 70°C for later analysis. The chromatin solution was cleared with salmon sperm DNA/protein A-agarose 50% slurry for 1 h before overnight incubation at 4°C with 5 µl of CREB specific antibody. The chromatin-antibody-protein A-agarose complexes were washed sequentially once each (2 min on a rocker plate), in low salt (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris, pH 8.1 and 150 mM NaCl), high salt (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris, pH 8.1 and 500 mM NaCl), lithium chloride wash buffer (0.25 M LiCl, 1% NP-40, 1% sodium deoxycholate, 1 mM EDTA, 10 mM Tris, pH 8.1) and Tris/EDTA (10:1) buffer, and incubated twice in the elution buffer (1% SDS and 100 mM NaHCO3). The elutes were pooled and NaCl was added to a final concentration of 10 mM prior to heating the mixture at 65°C for 6 h to reverse the formaldehyde cross-links. The samples were digested with proteinase K for 1 h at 45°C, and the DNA from the samples were obtained by phenol/chloroform extraction and ethanol precipitation. DNA pellets were then re-suspended in 10 µl of nuclease free water, and 1 µl aliquot was used in the PCR reaction using primers flanking the CRE-like sequence in the promoter sequence of monkey Inh- subunit and StAR genes.
Hormone assays
Luteinizing hormone, E2 and P4 concentrations in serum were determined by specific radioimmunoassay as reported previously (Selvaraj et al., 1996; Yadav et al., 2004). The antisera to P4 (GDN #337) and E2 (GDN #244) were kindly provided by Professor GD Niswender (University of Colorado, Fort Collins, CO, USA).
Statistical analysis
Data were expressed as mean ± SEM. The data (hormone concentration, PKA activity and relative levels of mRNA and protein) were analysed by one-way ANOVA, followed by the Newman–Keuls multiple comparison test (PRISM Graph pad, version 2; Graph Pad software, Inc., USA). The P-value < 0.05 was considered statistically significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionSupplementary dataAcknowledgementsReferences |
|---|
Serum P4 concentrations and PKA activity in the CL during different functional status
Figure 1 represents circulating mean serum P4 concentrations (top panel) and PKA activity in CL tissues (bottom panel) from monkeys during different stages of luteal phase, before and 48 h after CET treatment, and during hCG treatment to mimic early pregnancy. Serum P4 concentrations were higher (P < 0.05) during mid-luteal phase compared to early- and late-luteal phases. A significant decrease (P < 0.05) in P4 concentration was observed in monkeys treated with CET compared with Veh treated monkeys (Fig. 1, top panel). Following hCG treatment, P4 concentrations on day 14 of the luteal phase were significantly higher (P < 0.05) as compared with concentrations in monkeys that did not receive hCG treatment (Fig. 1, top panel).
|
Assay of PKA activity at different stages of CL revealed that concomitant with higher P4 concentrations, higher PKA activity was observed during mid- compared with early- and late-luteal phases (Fig. 1, bottom panel). PKA activity was low in CL collected at 48 h following CET treatment as compared with the CL collected from Veh treated monkeys. Although hCG treatment did not show a marked increase in PKA activity, it was higher than that of age matched CL collected from untreated monkeys (Fig. 1, bottom panel).
Expression of CREB in the monkey CL
RT–PCR expression of CREB
To determine whether CREB, one of the downstream target substrates for PKA, is expressed in the CL, RT–PCR was performed on total RNA from GC and CL using primers [1F and 1R (Table 1) located in exons 8 and 10, respectively; Fig. 2A] designed for the conserved regions of human (CREB1), rat (
isoform) and bovine CREB cDNAs. As seen in Fig. 2C, an amplified signal of expected size of 400 bp was visualized both in monkey GC and CL. The RT–PCR product was eluted and cloned into pGEMT easy vector, and the nucleotide analysis of cloned product revealed 95% identity with the human CREB1 isoform (sequence analysis results are provided in the supplemental file 1). Also, the expression of CREB mRNA studied using semi-quantitative RT–PCR indicated that CREB expression did not change significantly throughout the luteal phase (supplemental file 2, Fig. 1). Utilizing the RT–PCR amplified cDNA as a probe, northern blot analysis of total RNA from mid-stage CL revealed presence of four transcripts (Fig. 2D). In the rat testis, alternative splicing during spermatogenesis can give rise to a truncated form of CREB due to the insertion of a 64 bp exon, the w exon, which contains in-frame stop codon (Walker et al., 1996). CREB-w isoform lacks nuclear translocation signal and the DNA binding domain found in the full-length protein and has been shown to be expressed only in the cytoplasm. To examine whether alternative RNA splicing leads to different CREB mRNA species including the w exon in the CL, RT–PCR was performed using primer pair 1F and 1R' located in exon 8 and exon 11, respectively, as these exons flank the w exon. As seen in Fig. 2B, if w exon is absent, the expected size of amplicon will be 463 bp, but if w exon is present, the expected size of the product would be 527 bp. In the case of rat testis, two bands of sizes 463 and 527 bp were obtained (Fig. 2E, lane 2), but only a single band of 463 bp was obtained in the monkey CL (Fig. 2E, lane 1) ruling out the presence of CREB mRNA species having w exon in the CL. To identify whether , and isoforms are present in the monkey CL, RT–PCR was performed using primer pair 2F and 2R located in exons 4 and 9, respectively (Fig. 2B). The expected size of the product corresponding to isoform would be 392 bp, and the expected size of the product containing and exons would be 434 and 503 bp, respectively. As expected, transcripts containing exons and and some additional transcripts could be seen in the case of rat testis (Fig. 2F, lane 2), but in the monkey CL, two bands I and II of sizes 392 and 434 bp were obtained (Fig. 2F, lane 1). Both the bands were eluted, cloned into pGEMT easy vector and sequence showed similarity with human and isoforms.
|
|
Immunoblot analyses of CREB
To determine CREB protein expression in the bonnet monkey CL, immunoblot analysis was carried out on the mid-stage CL lysate. To confirm the specificity of antibody employed for detecting total CREB, monkey GC and rat testis lysates were included as positive controls (Fig. 3A). A signal corresponding to 43 kDa could be visualized both in GC and CL lysates (Fig. 3A). In the rat testis lysate, in addition to the 43 kDa, signals corresponding to proteins of size between 43 and 29 kDa were visualized (Fig. 3A). Immunoblot analysis for CREB during different stages of CL revealed the presence of CREB through out the luteal phase (Fig. 3B) and no significant change in CREB expression was observed during the different stages of CL development (densitometric analysis results are provided in supplemental file 2, Fig. 2A).
|
Validation of immunoblot analysis of monkey CL for pCREB
To examine the activation status of CREB during CL development, immunoblot analysis was performed on protein lysates of luteal tissue of different stages using pCREB antibody. Levels of pCREB in the mid-stage luteal tissue showed significant increase (P < 0.01) as compared with the early- and late-luteal phase (Fig. 3C, graphical representation of densitometric analysis result is provided in supplemental file 2, Fig. 2B). To validate the specificity of pCREB antibody employed in the present study, immunoblot analysis was carried out by including a specific pCREB Ser133 blocking peptide in the primary antibody solution. The results of immunoblot analysis of mid-stage CL as well as GC lysate used as a positive control are presented in Fig. 3D. As can be seen, a signal corresponding to the expected size of pCREB could be visualized in lanes that did not contain the pCREB blocking peptide in the primary antibody solution (lanes 1 and 2, Fig. 3D), whereas the signal was abolished in lanes probed with the primary antibody solution containing pCREB blocking peptide (lanes 3 and 4, Fig. 3D). However, when the same blots, after stripping, were re-probed with antibody solution specific for total CREB, a signal corresponding to 43 kDa size protein could be visualized in all the lanes (Fig. 3D).
Immunolocalization of CREB in the CL
Examination of immunohistochemical staining for CREB in the mid-stage CL visualized using TRITC and DAPI staining for nucleus indicated presence of CREB both in the cytoplasm as well as in the nuclei (Fig. 4A). Immunocytochemistry was carried out on dispersed luteal cells for specific localization of CREB. Figure 4B shows the 3ß-HSD staining pattern of isolated luteal cells, whereas similar activity in endothelial cells could not be demonstrated. The immunocytochemistry revealed that both nuclear and cytoplasmic staining was observed for both CREB and pCREB (Fig. 4C).
|
Electrophoretic mobility shift assay
To determine whether or not labeled CRE probe bound nuclear proteins, EMSAs were performed on CL nuclear extracts. Two protein/DNA complexes were formed (Fig. 4D, lane 1), and the complexes could be competed out with an excess unlabeled CRE sequence (Fig. 4D, lane 3). To determine the specificity of complexes, super shift assays were performed by incubating the luteal nuclear extracts with antibody specific for CREB and two super shifts were obtained. The complex II was observed to be super shifted indicating the specificity of interaction of DNA/protein complexes with CREB antibody, whereas complex I appeared to be unaffected by antibody addition (Fig. 4D, lane 2).
In vivo interaction of CREB with Inh- and StAR promoter regions
To study whether there is any interaction between CREB and CRE-like sequence of Inh- subunit and StAR promoters in vivo, ChIP assays were performed with the dispersed macaque luteal cells. Employing the sequence stretches of promoter regions of Inh- of other species (Fig. 5A), primers were designed (Table 3) to amplify the region that harbored CRE-like sequence in the monkey Inh- promoter region from the luteal tissue (Fig. 5B). After sequencing and confirming the presence of CRE-like sequence in the Inh- gene promoter (supplemental file 1), ChIP assays were carried out. PCR using ChIP with CREB antibody showed distinct bands for both Inh- subunit and StAR promoters, respectively. There was no PCR amplification of immunoprecipitate using non-immune IgG alone (negative control) whereas the amplification of DNA (Input DNA) that had not been subjected to immunoprecipitation yield distinct bands for both Inh- subunit and StAR promoters (Fig. 5E).
|
|
Expressions of Inh-
and StAR during different functional status of CLSemi-quantitative RT–PCR expression of Inh-
and StAR showed significantly higher expression in mid-stage CL (P < 0.05) compared with CL from early- and late-luteal phase (Fig. 6A and B). Messenger RNA expression of Inh- and StAR was lower (P < 0.05) at 48 h following CET treatment and higher in CL collected following hCG treatment on days 9–13 of the luteal phase.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionSupplementary dataAcknowledgementsReferences |
|---|
In higher primates, circulating LH and CG during non-fertile and fertile cycles, respectively, are absolutely essential for maintenance of structure and function of CL (Neill and Knobil, 1972; Zeleznik and Benyo, 1994; Stouffer, 2003). However, the intracellular processes and mechanisms by which LH/CG act to maintain and/or rescue CL structure and function are far from clear. Several studies have addressed changes in classical cAMP/PKA/CREB signaling cascade in luteal cells (Richards et al., 1995). Interestingly, alterations in responsiveness to cAMP levels have been observed in luteal cells following ovulation (Richards et al., 1998). In the present study, experiments have been carried out to assess different elements of cAMP signaling cascade in the macaque CL with a view to relate the expression of Inh-
and StAR genes to different functional status of CL. The observations that higher PKA activity was maintained throughout the luteal phase in the present study are essentially in accordance with the similar findings observed in cynomolgus monkeys by Benyo and Zeleznik (1997). However, the findings of modest increase in the PKA activity observed post hCG treatment is in contrast to a significant decrease in the hCG-induced PKA activity reported in cynomolgus monkeys. The findings of higher PKA activity during early- and late-luteal phase during non-fertile cycles characterizing low circulating P4 levels as well as modest change in PKA activity following CET and hCG treatments suggest a lack of apparent direct relationship between PKA activity and steroidogenesis. The notion that steroidogenesis occurs independent of PKA activity has been suggested in experiments in which agents such as forskolin increase steroidogenesis independent of PKA activity via cAMP-GEFs (Chin and Abayasekara, 2004). However, studies employing inhibitors of PKA activity have demonstrated alterations in gonadotropin-stimulated steroidogenesis (Morris and Richards, 1995; Seger et al., 2001). Activation of ERK1/2 in human granulosa-lutein cells by hCG has been shown to be PKA-dependent, and inhibition of PKA activity by PKA inhibitor (PKI) has been shown to down-regulate ERK1/2 activation leading to decrease in P4 production (Dewi et al., 2002). It has been suggested that activated PKA might directly alter steroidogenesis by the way of phosphorylation of critical cytoplasmic proteins, and in this regard, mutations of StAR affecting phosphorylation at position Ser75 or Ser195 significantly reduces pregnenolone production (Arakane et al., 1997). It has been reported that regulation of the PKA pathway itself is governed by factors that control its cellular localization and state of activation. The catalytic subunit of A-kinase is inhibited by the regulatory subunit which binds to cellular scaffolding proteins called A-kinase anchor proteins (AKAPs) (Hunzicker-Dunn et al., 1998; Carr et al., 1999) and regulation of subunits of PKA, AKAPs and PKI( as observed during the induced luteolysis are suggestive of importance of PKA actions in the CL function. Demonstration of the presence of CREB using multiple criteria such as mRNA expression, immunoblot analysis of protein expression employing two different antibodies, mobility shift assays, ChIP assays and immunolocalization studies provide compelling evidence for the presence of CREB in luteal tissue of the bonnet monkey. This finding is in stark contrast to the report of extinction of CREB expression following luteinization in the rhesus macaque (Somers et al., 1995). It is difficult to explain the contrasting results obtained in the two separate, but related species of macaques except to point out that there may indeed be interspecies differences considering that individual species appear to have evolved unique but different mechanisms to regulate CL function. That the activator form of CREB rather than other isoforms appears to predominate in the CL tissue is borne out by the observation of lack of expression of CREB repressor isoforms. The absence of CREB expression has a profound effect on the way the CL functions in primates considering that its lifespan gets extended until such time the placenta assumes the major responsibility of P4 production. Zeleznik and Somers (1999) hypothesized that extinction of CREB expression would compromise transcriptional activity and would render luteal cells vulnerable to apoptosis as CREB functions as a critical survival factor in many cell types (Jean et al., 1998). Interestingly, barring a few reports that have examined various apoptotic elements during induced or spontaneous luteolysis, clear cut evidence for apoptosis of luteal cells in primates is yet to be documented (Shikone et al., 1996; Fraser et al., 1999; Yadav and Medhamurthy, 2006) in the way it is seen following induced or spontaneous luteolysis in many of the non-primate species (Niswender et al., 2000). In contrast to the speculation of disruption in transcriptional activity as a consequence of loss of CREB expression as suggested by Zeleznik and Somers (1999), several studies have documented LH/hCG regulation of expression of a number of genes involved in cellular processes such as steroidogenesis and structural/ tissue remodeling in the primate CL (Benyo et al., 1993a,b; Yadav et al., 2004; Xu et al., 2005). It is well known that CREB promotes cellular gene expression, following its phosphorylation at Ser133 via recruitment of coactivator paralogs such as CREB binding protein and p300 (Flammer et al., 2006), but what is interesting about importance of CREB as a key molecule in cell signaling is that in addition to cAMP, numerous stimuli including hypoxia and growth factors also induce Ser133 phosphorylation with stoichiometry and kinetics comparable with those induced by cAMP (Du et al., 2000). Moreover, phosphorylation independent of Ser133 and/or phosphorylation of Ser at other positions enable CREB to function as an activated transcription factor. In any case, mere presence of various elements of cAMP/PKA/CREB signaling pathway does not in itself guarantee their role/importance in the transcriptional regulation of gene expression in the CL tissue, since alterations in cAMP responsiveness during CL maturation is well documented in rodents and monkeys (Zeleznik and Benyo, 1994; Richards et al., 2002; Stouffer, 2003). Furthermore, the major caveat for less enthusiasm for CREB's role in the primate CL is perhaps due to the occurrence of relatively low circulating LH milieu leading to modest increase in the cAMP/PKA/CREB activation status. Moreover, during later part of the luteal phase, a progressive decrease in the sensitivity of CL to circulating LH milieu has been documented (Stouffer, 2003). Nonetheless, the observation that CL function displays unusual dependence on LH/CG levels and the fact that it recovers its full function potential relatively briskly after LH replacement following transient withdrawal of LH (Hutchison and Zeleznik, 1985; Medhamurthy et al., 2006) strongly points to resilience of CL structure and function, suggestive of utilization of various LHr signaling cascades including perhaps the classic cAMP/PKA/CREB pathway.
Unlike in most non-primate species, expression of Inh-( and Inh ßA subunits in the primate CL is well documented as well as their regulation by LH (Basseti et al., 1990; Schwall et al., 1990; Fraser et al., 1995). In the present study, Inh- and StAR expression, both of which possess CRE-like sequences in the promoter regions, examined during different functional states of CL, indicated that expression varied with the activity and/or circulating levels of LH/hCG. Although the findings do not suggest whether there was de novo transcriptional activity or changes in turnover, nonetheless, the results suggest involvement of the cAMP/PKA/CREB pathway in the expression of both these genes, since regulation of expression of these genes via cAMP/PKA/CREB pathway in other steroidogenic tissues has been demonstrated. However, it remains to be determined whether factors other than CREB play a role in the control of expression of these genes. In summary, these findings suggest that CREB is indeed present in the primate CL, and that the expression profiles of StAR and Inh- during different functional status of CL are reflective of circulating gonadotropin levels.
|
Supplementary data |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionSupplementary dataAcknowledgementsReferences |
|---|
Supplementary data are available at http://molehr.oxfordjournals.org/
|
|
Acknowledgements |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionSupplementary dataAcknowledgementsReferences |
|---|
We thank Mr P. Jayaram for help with analysis and preparation of MS. The staff at PRL is gratefully acknowledged for their help with blood sampling and surgeries. Ms S.P. is supported by a fellowship from the Council of Scientific and Industrial Research, New Delhi, India. This work was supported financially by the Department of Biotechnology and infrastructure grant support by the University Grants Commission. Portions of this work were presented at the 37th Annual Meeting of the Society for the Study of Reproduction, 2004, Vancouver, Canada. (Abstract 19)
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionSupplementary dataAcknowledgementsReferences |
|---|
Andrews NC and Faller DV. (1991) A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res 19:2499.
Arakane F, King SR, Du Y, et al. (1997) Phosphorylation of steroidogenic acute regulatory protein (StAR) modulates its steroidogenic activity. J Biol Chem 272:32656–32662.
Ardekani AM, Romanelli JC, Mayo KE. (1998) Structure of the rat inhibin and activin ßA subunit gene and regulation in an ovarian granulosa cell line. Endocrinology 139:3271–3279.
Basseti SG, Winters SJ, Keeping HS, et al. (1990) Serum immunoreactive inhibin levels before and after luteectomy in the cynomolgus monkey (Macaca fascicularis). J Clin Endocrinol Metab 70:590–594.[Abstract]
Benyo DF and Zeleznik AJ. (1997) Cyclic adenosine monophosphate signaling in the primate corpus luteum: Maintenance of protein kinase A Activity throughout the luteal phase of the menstrual cycle. Endocrinology 138:3452–3458.
Benyo DF, Little-Ihrig L, Zeleznik AJ. (1993a) Noncoordinated expression of luteal cell messenger ribonucleic acids during human chorionic gonadotropin stimulation of the primate corpus luteum. Endocrinology 133:699–704.[Abstract]
Benyo DF, Ravindranath N, Bassett S, et al. (1993b) Cellular aspects of corpus luteum function in the primate. Hum Reprod 8:102–106.
Carlone DL and Richards JS. (1997) Functional interactions, phosphorylation, and levels of 3',5'-cyclic adenosine monophosphate-regulatory element binding protein and steroidogenic factor-1 mediate hormone-regulated and constitutive expression of aromatase in gonadal cells. Mol Endocrinol 11:292–304.
Carr DW, Cutler RE Jr, Cottom JE, et al. (1999) Identification of cAMP-dependent protein kinase holoenzymes in preantral- and preovulatory-follicle-enriched ovaries, and their association with A-kinase-anchoring proteins. Biochem J 344:613–623.[CrossRef][ISI][Medline]
Chin EC and Abayasekara DR. (2004) Progesterone secretion by luteinizing human granulosa cells: a possible cAMP-dependent but PKA-independent mechanism involved in its regulation. J Endocrinol 183:51–60.
Christenson LK, Stouffer RL, Strauss JF III. (2001) Quantitative analysis of the hormone-induced hyperacetylation of histone H3 associated with the steroidogenic acute regulatory protein gene promoter. J Biol Chem 276:27392–27399.
Conti M. (2002) Specificity of the cyclic adenosine 3',5'-monophosphate signal in granulosa cell function. Biol Reprod 67:1653–1661.
Dewi DA, Abayasekara DR, Wheeler-Jones CP. (2002) Requirement for ERK1/2 activation in the regulation of progesterone production in human granulosa-lutein cells is stimulus specific. Endocrinology 143:877–888.
Du K, Asahara H, Jhala US, et al. (2000) Characterization of a CREB gain-of-function mutant with constitutive transcriptional activity in vivo. Mol Cell Biol 20:4320–4327.
Fitzpatrick SL and Richards JS. (1994) Identification of a cyclic adenosine 3', 5'-monophosphate-response element in the rat aromatase promoter that is required for transcriptional activation in rat granulosa cells and R2C leydig cells. Mol Endocrinol 8:1309–1319.[Abstract]
Flammer JR, Popova KN, Pflum MK. (2006) Cyclic AMP response element-binding protein (CREB) and CAAT/enhancer-binding protein beta (C/EBPß) bind chimeric DNA sites with high affinity. Biochemistry 45:9615–9623.[CrossRef][Medline]
Fraser HM, Lunn SF, Cowen GM, et al. (1993) Localization of inhibin/activin subunit mRNAs during the luteal phase in the primate ovary. J Mol Endocrinol 10:245–257.[Abstract]
Fraser HM, Lunn SF, Whitelaw PF, et al. (1995) Induced luteal regression: differential effects on follicular and luteal inhibin/activin subunit mRNAs in the marmoset monkey. J Endocrinol 144:201–208.[Abstract]
Fraser HM, Lunn SF, Harrison DJ, et al. (1999) Luteal regression in the primate: different forms of cell death during natural and gonadotropin-releasing hormone antagonist or prostaglandin analogue-induced luteolysis. Biol Reprod 61:1468–1479.
Hunzicker-Dunn M, Scott JD, Carr DW. (1998) Regulation of expression of A-kinase anchoring proteins in rat granulosa cells. Biol Reprod 58:1496–1502.
Hutchison JS and Zeleznik AJ. (1985) The corpus luteum of the primate menstrual cycle is capable of recovering from a transient withdrawal of pituitary gonadotropin support. Endocrinology 117:1043–1049.[Abstract]
Jean D, Harbison M, McConkey DJ, et al. (1998) CREB and its associated proteins act as survival factors for human melanoma cells. J Biol Chem 273:24884–24890.
Kinjo K, Sandoval S, Sakamoto KM, et al. (2005) The role of CREB as a proto-oncogene in hematopoiesis. Cell Cycle 4:1134–1135.[ISI][Medline]
Kovach SJ, Price JA, Shaw CM, et al. (2006) Role of cyclic-AMP responsive element binding (CREB) proteins in cell proliferation in a rat model of hepatocellular carcinoma. J Cell Physiol 206:411–419.[CrossRef][ISI][Medline]
Kuo MH and Allis CD. (1999) In vivo cross-linking and immunoprecipitation for studying dynamic protein: DNA associations in a chromatin environment. Methods 19:425–433.[CrossRef][ISI][Medline]
Manna PR, Dyson MT, Eubank DW, et al. (2002) Regulation of steroidogenesis and the steroidogenic acute regulatory protein by a member of the cAMP response-element binding protein family. Mol Endocrinol 16:184–199.
Medhamurthy R, Suresh R, Paul SS, et al. (1995) Evidence for follicle-stimulating hormone mediation in the hemiorchidectomy-induced compensatory increase in the function of the remaining testis of the adult male bonnet monkey (Macaca radiata). Biol Reprod 53:525–531.[Abstract]
Medhamurthy R and Priyanka G. (2006) Induction of luteolysis by a single injection of GnRH receptor antagonist in the bonnet monkey: Cellular events associated with LH rescue of the corpus luteum function. Program of the Eighty-eighth Annual Meeting of the Endocrine Society, Boston, MA Abstract 1109.
Michael MD, Michael LF, Simpson ER. (1997) A CRE-like sequence that binds CREB and contributes to cAMP-dependent regulation of the proximal promoter of the human aromatase P450 (CYP19) gene. Mol Cell Endocrinol 134:147–156.[CrossRef][ISI][Medline]
Montminy M. (1997) Transcriptional regulation by cyclic AMP. Annu Rev Biochem 66:807–822.[CrossRef][ISI][Medline]
Morris JK and Richards JS. (1995) Luteinizing hormone induces prostaglandin endoperoxide synthase-2 and luteinization in vitro by A-kinase and C-kinase pathways. Endocrinology 136:1549–1558.[Abstract]
Mukherjee A, Park-Sarge OK, Mayo KE. (1996) Gonadotropins induce rapid phosphorylation of the 3',5'-cyclic adenosine monophosphate response element binding protein in ovarian granulosa cells. Endocrinology 137:3234–3245.[Abstract]
Mukherjee A, Urban J, Sassone-Corsi P, et al. (1998) Gonadotropins regulate inducible cyclic adenosine 3', 5'-monophosphate early repressor in the rat ovary: implications for inhibin alpha subunit gene expression. Mol Endocrinol 12:785–800.
Neill JD and Knobil E. (1972) On the nature of the initial luteotropic stimulus of pregnancy in the Rhesus monkey. Endocrinology 90:34–38.[ISI][Medline]
Niswender GD, Juengel JL, Silva PJ, et al. (2000) Mechanisms controlling the function and life span of the corpus luteum. Physiol Rev 80:1–29.
Pei L, Dodson R, Schoderbek WE, et al. (1991) Regulation of the alpha inhibin gene by cyclic adenosine 3', 5'-monophosphate after transfection into rat granulosa cells. Mol Endocrinol 4:521–534.
Richards JS. (2001) New signaling pathways for hormones and cyclic adenosine 3',5'-monophosphate action in endocrine cells. Mol Endocrinol 15:209–218.
Richards JS, Fitzpatrick SL, Clemens JW, et al. (1995) Ovarian cell differentiation: a cascade of multiple hormones, cellular signals, and regulated genes. Recent Prog Horm Res 50:223–254.[ISI][Medline]
Richards JS, Russell DL, Robker RL, et al. (1998) Molecular mechanisms of ovulation and luteinization. Mol Cell Endocrinol 145:47–54.[CrossRef][ISI][Medline]
Richards JS, Russell DL, Ochsner S, et al. (2002) Novel signaling pathways that control ovarian follicular development, ovulation, and luteinization. Recent Prog Horm Res 57:195–220.
Saini HS, Gorse KM, Boxer LM, et al. (2004) Neurotrophin-3 and a CREB-mediated signaling pathway regulate Bcl-2 expression in oligodendrocyte progenitor cells. J Neurochem 89:951–961.[CrossRef][ISI]<