Skip Navigation


Mol. Hum. Reprod. Advance Access originally published online on May 9, 2007
Molecular Human Reproduction 2007 13(7):461-464; doi:10.1093/molehr/gam031
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/7/461    most recent
gam031v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (4)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Ravel, C.
Right arrow Articles by McElreavey, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ravel, C.
Right arrow Articles by McElreavey, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2007. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Mutations in the protamine 1 gene associated with male infertility

C. Ravel1,2, S. Chantot-Bastaraud1,2, B. El Houate2,3, I. Berthaut1, L. Verstraete4, V. De Larouziere1, D. Lourenço1, A. Dumaine1, J.M. Antoine4, J. Mandelbaum1, J.P. Siffroi1 and K. McElreavey2,5

1 Université Pierre et Marie Curie Paris-6, EA1533, AP-HP, Hôpital Tenon, Paris, France 2 Reproduction, Fertility and Populations, Institut Pasteur, Paris, France 3 Institut Pasteur of Morocco, Casablanca, Morocco 4 AP-HP, Hôpital Tenon, Department of Obstetrics and Gynecology, Paris, France

5 Correspondence address. Tel: +33 1 45 68 89 20; E-mail: kenmce{at}pasteur.fr


    Abstract
 Top
 Abstract
 Introduction
 Methods and Materials
 Results
 Discussion
 Acknowledgements
 References
 
In elongating spermatids, human sperm chromatin undergoes a complex compaction in which the transition proteins are extensively replaced by the protamine proteins. Several human studies demonstrate that expression of the protamine proteins is altered in some men with male infertility. For this study, we screened the PRM1 (protamine 1) gene for mutations in a large cohort of 281 men seeking infertility treatment. We identified the c.102G > T transversion that results in an p.Arg34Ser amino acid change in two men. One of these patients presented with oligozoospermia associated with increased sperm DNA fragmentation. The second individual was normospermic but together with his partner sought treatment for idiopathic couple infertility. We also identified a novel missense mutation (c.119G > A, p.Cys40Tyr) in a man with oligoasthenozoospermia. These mutations were not observed in control populations. Interestingly, we also detected variants both 5' and 3' to the PRM1 open-reading frame specifically in infertile individuals. Four individuals with unexplained severe oligozoospermia were heterozygote for a c.–107G > C change that is located at –15 bp from the transcription initiation site of the gene. This mutation may influence PRM1 expression. In addition, a c.*51G > C variant was detected in the 3'UTR of PRM1 specifically in a man with severe oligoasthenozoospermia.

Key words: DNA fragmentation/male infertility/protamine 1 mutation/spermatogenesis


    Introduction
 Top
 Abstract
 Introduction
 Methods and Materials
 Results
 Discussion
 Acknowledgements
 References
 
During spermiogenesis, testis-specific nuclear proteins termed transition proteins and protamines are required for spermatid chromatin compaction (reviewed by Sassone-Corsi, 2002). During this process, somatic histones are replaced with the transition proteins TNP1 and TNP2. Subsequently, in elongating spermatids, the protamine proteins PRM1 and PRM2 replace TNP1 and TNP2. Protamines are small, highly arginine-rich, nuclear proteins that in the haploid phase of spermatogenesis are required for sperm head condensation and associated transcriptional silencing (Sassone-Corsi, 2002). The genes PRM1, PRM2 and TNP2 are located within a 25-kb fragment of chromosome 16p13.3, whereas TNP1 is located on chromosome 2 (Engel et al., 1992). A third gene, or probable pseudogene, exhibiting a testis-specific expression profile, termed PRM3, has been identified and localized between PRM2 and TNP2 (Schluter et al., 1996).

Recently, there has been considerable interest in the impact of mutations or variants in the protamine genes on male fertility. Lee et al. (1995) observed that premature translation of the Prm1 gene in mice caused precocious nuclear condensation leading to the arrest of spermatid differentiation. In addition, a number of reports have noted abnormal PRM1/PRM2 ratios in the sperm of infertile human males, suggesting that the relative amounts of each protamine is important for proper spermatid differentiation (Balhorn et al., 1988; Belokopytova et al., 1993; Bench et al., 1998; Steger et al., 2003; Aoki et al., 2005a, 2006a; Carrell et al., 2007). This is consistent with studies in mice, where haploinsufficiency of Prm1 or Prm2 is known to specifically cause infertility in male mice (Cho et al., 2001). In one recent study by Carrell and colleagues, 37 patients were identified with abnormally low PRM1/PRM2 ratios, 99 patients with normal PRM1/PRM2 ratios and 13 patients with abnormally high PRM1/PRM2 ratios (Aoki et al., 2005b). DNA fragmentation was significantly elevated in the patients with low PRM1/PRM2 ratios. There was also a significant increase in the incidence of DNA fragmentation in patients with diminished levels of either PRM1 or PRM2. These data highlight a relationship between human sperm protamine content on the one hand and increased levels of DNA fragmentation on the other. The underlying causes of PRM1/PRM2 ratio deregulation in infertile males is unknown, although studies have shown decreased levels of PRM1 mRNA in testes from infertile men (Steger et al., 2003). The ratio of sperm PRM1 to PRM2 is important since it is directly related to fertilization pregnancy rates, although the precise mechanism that is responsible for this is unknown (Aoki et al., 2006b). Individual sperm cells that display the lowest protamine levels show diminished viability and increased susceptibility to DNA damage (Aoki et al., 2006c).

The studies described earlier highlight a potentially important contribution of protamine anomalies to male infertility. However, studies aimed at finding mutations in either the PRM1 or PRM2 genes linked to infertility have been less productive. Carrell and colleagues did not observe an association between polymorphisms in the PRM1 or PRM2 genes and human sperm protamine deficiency (Aoki et al., 2006d), although they did observe a novel heterozygous mutation (p.Arg33Ser) in both a severely infertile male and a fertile control. In a Japanese study of 226 infertile men, no causal mutations were identified in the coding regions of the PMR1 gene, although a nonsense mutation was detected in the PMR2 gene in one infertile male (Tanaka et al., 2003). Iguchi et al. (2006) reported a G/T nucleotide substitution in 3 of 30 unrelated men with idiopathic infertility. The 30 infertile individuals that were initially screened all had normal sperm counts but showed abnormal DNA fragmentation (>27% of sperm fragmented) and were hence candidates for mutations in a protamine gene. This mutation is predicted to cause an arginine to serine substitution at codon position 34 (p.Arg34Ser). This change was not observed in a further 226 sterile individuals. Interestingly, a reanalysis of the sequence data from both the study by Iguchi et al. (2006) and by Aoki et al. (2006d) suggests that they had both identified an identical c.102G > T mutation that results in the Arg34Ser amino acid change.

In this study, we describe a screen of a large number of fertile and infertile men for variants in the PRM1 gene that may be associated with the fertility status. We identified two individuals with the p.Arg34Ser variant. One of these individuals had severe oligozoospermia and showed high levels of DNA fragmentation. The second individual had a sperm count within the normal range but he sought infertility treatment. A second missense mutation p.Cys40Tyr was observed in a single infertile individual with oligoasthenozoospermia. Other variants were observed both 5' and 3' to the open-reading frame specifically in men with reduced sperm counts. These variants may influence PRM1 expression.


    Methods and Materials
 Top
 Abstract
 Introduction
 Methods and Materials
 Results
 Discussion
 Acknowledgements
 References
 
Study population
DNA samples were obtained from peripheral blood lymphocytes of 281 consenting individuals who presented with idiopathic male infertility. This population consisted of azoospermic (n = 119) and oligozoospermic men (n = 162). A second group consisted of 35 men who were normospermic but together with their female partner sough assisted reproductive technologies (ARTs) for idiopathic couple infertility. A third control group consisted of 111 men who were either normospermic and fertile (n = 30) or the father of at least two children (n = 81; semen parameters unknown). The fourth group consisted of a large mixed ethnic panel of unknown fertility status (n = 192). All individuals were studied in compliance with local board-approved study of human subjects. The semen parameters of patients and controls were analysed by conventional light microscopic semen evaluation using WHO criteria for sperm count and motility. Individuals with known causes of infertility such as chromosome anomalies (including Y chromosome AZF deletions), cystic fibrosis and exposure to chemo- or radiotherapy were excluded from the study. The case and control samples were from one clinical centre (Tenon Hospital, Paris, France) and they were of mixed ethnic origin. All DNA samples were obtained from peripheral blood lymphocytes by standard methods.

DNA sequencing and confirmation of c.102G > T variant
Each PCR reaction consisted of 100 ng genomic DNA, 100 µM dNTPs, 0.2 µM of each primer [either Pr597: 5' CATAGGCAGCCCCTACACTC 3'; Pr087: 5' CCCTCTCAAGAACAAGGAGAGAA 3' (product size 684 bp), or PRM1F: 5' CCACGGAGGAG TCATC TTGT 3' and PRM1R: 5'-ATTTATTGACAGGCGGC ATT-3' (product size 680 bp)], 10 mM MgCl2 and 0.1 U Taq polymerase (Bioline) in a final volume of 20 µl. PCR was performed using GeneAmp PCR System 9700 (AB Applied Biosystems, Foster City, CA, USA). PCR conditions for the Pr597/Pr087 amplicon were as described by Igushi et al. (2006). Amplication of the PRM1F/PRM1R amplicon was performed by an initial step of 95°C for 5 min followed by 35 cycles of 95°C for 30 s, 60°C for 30 s, 72°C for 30 s followed by an elongation step of 72°C for 5 min. About 5 µl of each PCR fragment was then electrophoresed in a 2% agarose gel stained in ethidium bromide (1 µg/ml) to verify the expected length of the amplified fragment. DNA sequence analysis was performed using at least 200 ng of purified DNA, 20 ng of primer and fluorescently labelled Taq DyeDeoxy terminator reaction mix (Applied Biosystems) according to the manufacturer's instructions. DNA sequence was determined using an ABI 3700 automated DNA sequencer. Restriction fragment length polymorphism (RFLP) assay was used to screen in all samples that had the c.102G < T polymorphism as described by Igushi et al. (2006) with some modifications. PCR products were digested with BseRI restriction enzyme at 37°C for 4 h and separated on 2% agarose gels. In the presence of the wild-type sequence variant, the Pr597/Pr087 product digests to give fragments of 369 and 315 bp, whereas the PRM1F/PRM1R product digests to give two fragments of 393 and 287 bp. The mutation c.102G > T results in a lack of digest by BseRI. Sequence analysis was performed using the PRM1F/PRM1R amplicon and the PRM1F primer. Amplicons generated using both primer pairs were digested with restriction enzyme to confirm the presence/absence of the mutation. All mutations that were identified in this study have been named using the guidelines described by the human genome variation society (http://www.hgvs.org/mutnomen).

Evaluation of DNA sperm fragmentation by TUNEL assay
Spermatozoa were adjusted to a final concentration of 5–20 x 106/ml, washed in phosphate-buffered saline, centrifuged, and the pellet was fixed in a solution of 33.3% methanol and 66.6% acetic acid. In Situ Cell Death Detection Kit Fluorescein (Roche Applied Science) was used for the TUNEL assay following recommendations of the manufacturer. Sample evaluation was performed under an epifluorescence microscope with the DNA-stain DAPI (Sigma Diagnostics) staining in blue the nucleus of the spermatozoa and a 490 nm filter FITC (green fluorescence of the DNA fragmented sperm). Four hundred spermatozoa were evaluated for percentage of DNA fragmentation of the nucleus. DNA sperm fragmentation was analysed determining total numbers of spermatozoa and percentages of cells with fragmented DNA.


    Results
 Top
 Abstract
 Introduction
 Methods and Materials
 Results
 Discussion
 Acknowledgements
 References
 
In the study populations, we identified a number of polymorphic variants that are summarized in Table 1. Two samples were observed to have the presence of the T variant at position 102 by direct sequencing of DNA samples and by confirmation of the mutation by RFLP-PCR (Fig. 1a). Both individuals were heterozygous for the mutation. One is an infertile patient who presented with a semen volume of 2.4 ml, a sperm count of 6.7 x 106 spz/ml, a progressive motility of 15% and a vitality of 65%. A total of 400 spermatozoa were analysed using the TUNEL assay. This assay revealed 55% of sperm exhibiting DNA fragmentation (slides were scored blindly by two independent investigators and inter-individual variability was not significant, P = 0.57; Fig. 1c). The inheritance of the single nucleotide polymorphism (SNP) is unknown, since this individual was adopted at birth and his precise ethnic origin is unknown. The second individual carrying the c.102G > T transversion belonged to the group of men seeking ART for idiopathic couple infertility. Semen parameters for this individual were within the normal range: sperm count of 179 x 106 spz/ml, a progressive motility of 60% and a vitality of 71%. However, the couple was unsuccessful in achieving pregnancy following four attempts of IVF. This variant was not observed in the fertile/normospermic group nor was it observed in a screen of 192 individuals of mixed ethnic background using the PCR-RFLP method (data not shown). Sperm was not available for the TUNEL assay.


View this table:
[in this window]
[in a new window]

 
Table 1: Sequence variants observed in the PRM1 gene and the allelic frequencies of each variant the three study populations

 

Figure 1
View larger version (36K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1: (A) RFLP-PCR analysis of (1) patient heterozygous for the c.102G > T variant following digestion with the enzyme Bse RI, (2) undigested DNA and (3) patient homozygous for the wildtype G/G variant. (B) Sequence analysis of the c.102G > T variant by direct sequencing of the PRM1F/PRM1R amplicon. (C) Example of the TUNEL assay. The green fluorescence indicates the presence of fragmented DNA. Spermatozoa are counterstained with 4,6-diamidino-2-phenylindole (DAPI). The analysis revealed >50% of sperm with DNA fragmentation

 
A novel missense mutation, p.Cys40Tyr, was observed in one individual with oligoasthenozoospermia. This, otherwise healthy, individual had a sperm count of 1.8 x 106/ml. Sperm was not available for the TUNEL assay.

The c.54G > A change was previously reported by Aoki et al. (2006c), as a rare silent polymorphic variant and our data are consistent with this hypothesis. Likewise, the c.93G > C variant that results in a p.Gln31His change was observed only in the control population and may also represent a rare polymorphic variant with little impact on fertility.

Other variants were observed in both the 5' flanking region of the gene and also in the 3'UTR region of the cDNA. The c.–107G > C change was observed in the heterozygote state in four men, each of whom had unexplained severe oligozoospermia (<5 x 106 spz/ml). The consequence of this change on the expression profile of PRM1 is unknown. However, the mutation is located 15 bp upstream of the transcription initiation site in the promoter region and sequence analysis by Tfsitescan (http://www.ifti.org/cgi-bin/ifti/Tfsitescan.pl) indicates that the mutation creates a binding site for hepatocyte nuclear factor 3 (HNF-3). The c.*51G > C variant in the 3'UTR was observed in the heterozygote state in one individual with severe oligoasthenozoospermia (0.18 x 106 spz/ml). He also has an infertile brother who was unavailable for study. The c.54G > C variant has been previously reported and may be an inconsequential polymorphism.


    Discussion
 Top
 Abstract
 Introduction
 Methods and Materials
 Results
 Discussion
 Acknowledgements
 References
 
During the elongating spermatid stage of spermiogenesis, human sperm chromatin undergoes a complex compaction in which the majority of histones are replaced by protamines. This involves the temporary replacement of the histones by transition proteins, followed by the replacement of most histones by PRMs 1 and 2. Changes in PRM1/PRM2 ratios have been observed in some infertile men. As suggested by Carrell et al. (2007), this could be due to two scenarios: (i) abnormal protamine expression is indicative of a generalized defect in mRNA storage and/or translation that affects other mRNA transcripts or (ii) protamines may act as a checkpoint of spermatogenesis. Our study suggests that a small percentage of infertile men may have amino acid variants in the PRM1 gene that may affect spermatogenesis and that some individuals also have 5' or 3' variants that may affect protein expression levels. The influence of these variants may explain the observations of altered PRM1/PRM2 ratios in some infertile men (Steger et al., 2003; Aoki et al., 2006b).

Our data support a link between the p.Arg34Ser variant and male infertility, however, the relationship may be complex. In contrast to the three cases reported by Iguchi et al. (2006), in this study, one of the individuals who carried the p.Arg34Ser mutation was oligozoospermic. However, he did exhibit a high level of DNA fragmentation in his sperm measured using the TUNEL assay. The second individual who carried the p.Arg34Ser variant had normal semen parameters but there was an associated couple infertility problem. Unfortunately, sperm was not available from this individual for DNA fragmentation studies, and therefore, we do not know if this case is similar to the three others reported by Iguchi et al. (2006). This SNP has been reported in the dbSNP (rs35576928), although there is no information on the allelic frequencies or population diversity for the substitution. We were unable to detect this change in a mixed ethnic panel of 192 individuals, nor in our control panel of 111 fertile/normospermic individuals (total of 606 chromosomes). This suggests that the mutation is either recurrent or a rare variant. Although the c.102G > T variant results in an amino acid change, as commented by Iguchi et al. (2006), it is unclear if this SNP is responsible for the phenotype or if it is linked to another causal variant. Analysis of the entire protamine coding sequence in these patients did not reveal any other amino acid substitutions, although variants may be present in promoter/enhancer regions outside of the fragment that was analysed in this study.

A second missense mutation, p.Cys40Tyr, was detected in an individual with oligoasthenozoospermia. Unfortunately, sperm was unavailable for study, so it is unclear if this change is associated with increased levels of DNA damage. BLAST analysis indicates that this motif is conserved in mammals with the exception of the horseshoe bat (Rhinolophus ferrumequinum), where it is also changed to a Tyr residue.

Other variants were observed in this study some of which appear to be inconsequential polymorphisms, whereas others may be associated with the phenotype. The observation that a mutation in the promoter region of PRM1 generates a new DNA-binding site for the transcription factor HNF-3 suggests that the mutation could influence gene expression. This change was observed in four men with unexplained reduced sperm counts. Each of these men was heterozygous for the mutation. Likewise, the novel variant in the 3'UTR of PRM1, c.*51G > C, may also influence mRNA stability, perhaps by altering the binding of factors such as MSY2 or MSY4, known to be necessary for stabilizing the mRNA transcript during spermatogenesis (Giorgini et al., 2001, 2002; Yang et al., 2007). It would be of interest to determine if there is an association between these 5' and 3' variants in the PRM1 gene and infertility in men, showing reduced levels of PRM1 mRNA (Steger et al., 2003).


    Acknowledgements
 Top
 Abstract
 Introduction
 Methods and Materials
 Results
 Discussion
 Acknowledgements
 References
 
This work was supported by grants from the Electricité de France (EDF) and l'Association pour la Recherche sur le Cancer (ARC).


    References
 Top
 Abstract
 Introduction
 Methods and Materials
 Results
 Discussion
 Acknowledgements
 References
 
Aoki VW, Liu L, Carrell DT. Identification and evaluation of a novel sperm protamine abnormality in a population of infertile males. Hum Reprod (2005a) 20:1298–1306.[Abstract/Free Full Text]

Aoki VW, Moskovtsev SI, Willis J, et al. DNA integrity is compromised in protamine-deficient human sperm. J Androl (2005b) 26:741–748.[Abstract/Free Full Text]

Aoki VW, Liu L, Carrell DT. A novel mechanism of protamine expression deregulation highlighted by abnormal protamine transcript retention in infertile human males with sperm protamine deficiency. Mol Hum Reprod (2006a) 12:41–50.[Abstract/Free Full Text]

Aoki VW, Liu L, Jones KP, et al. Sperm protamine 1/protamine 2 ratios are related to in vitro fertilization pregnancy rates and predictive of fertilization ability. Fertil Steril (2006b) 86:1408–1415.[CrossRef][Web of Science][Medline]

Aoki VW, Emery BR, Liu L, et al. Protamine levels vary between individual sperm cells of infertile human males and correlate with viability and DNA integrity. J Androl (2006c) 27:890–898.[Abstract/Free Full Text]

Aoki VW, Christensen GL, Atkins JF, et al. Identification of novel polymorphisms in the nuclear protein genes and their relationship with human sperm protamine deficiency and severe male infertility. Fertil Steril (2006d) 86:1416–1422.[CrossRef][Web of Science][Medline]

Balhorn R, Reed S, Tanphaichitr N. Aberrant protamine 1/protamine 2 ratios in sperm of infertile human males. Experientia (1988) 44:52–55.[CrossRef][Web of Science][Medline]

Belokopytova IA, Kostyleva EI, Tomilin AN, et al. Human male infertility may be due to a decrease of the protamine P2 content in sperm chromatin. Mol Reprod Dev (1993) 34:53–57.[CrossRef][Web of Science][Medline]

Bench G, Corzett MH, De Yebra L, et al. Protein and DNA contents in sperm from an infertile human male possessing protamine defects that vary over time. Mol Reprod Dev (1998) 50:345–353.[CrossRef][Web of Science][Medline]

Carrell DT, Emery BR, Hammoud S. Altered protamine expression and diminished spermatogenesis: what is the link? Hum Reprod Update (2007) 13:313–27.[Abstract/Free Full Text]

Cho C, Willis WD, Goulding EH, et al. Haploinsufficiency of protamine-1 or -2 causes infertility in mice. Nat Genet (2001) 28:82–86.[CrossRef][Web of Science][Medline]

Engel W, Keime S, Kremling H, et al. The genes for protamine 1 and 2 (PRM1 and PRM2) and transition protein 2 (TNP2) are closely linked in the mammalian genome. Cytogenet Cell Genet (1992) 61:158–159.[CrossRef][Web of Science][Medline]

Giorgini F, Davies HG, Braun RE. MSY2 and MSY4 bind a conserved sequence in the 3' untranslated region of protamine 1 mRNA in vitro and in vivo. Mol Cell Biol (2001) 21:7010–7019.[Abstract/Free Full Text]

Giorgini F, Davies HG, Braun RE. Translational repression by MSY4 inhibits spermatid differentiation in mice. Development (2002) 129:3669–3679.[Abstract/Free Full Text]

Iguchi N, Yang S, Lamb DJ, et al. An SNP in protamine 1: a possible genetic cause of male infertility? J Med Genet (2006) 43:382–384.[Abstract/Free Full Text]

Lee K, Haugen HS, Clegg CH, et al. Premature translation of protamine 1 mRNA causes precocious nuclear condensation and arrests spermatid differentiation in mice. Proc Natl Acad Sci USA (1995) 92:12451–12455.[Abstract/Free Full Text]

Sassone-Corsi P. Unique chromatin remodeling and transcriptional regulation in spermatogenesis. Science (2002) 296:2176–2178.[Abstract/Free Full Text]

Steger K, Fink L, Failing K, et al. Decreased protamine-1 transcript levels in testes from infertile men. Mol Hum Reprod (2003) 9:331–336.[Abstract/Free Full Text]

Schluter G, Celik A, Obata R, et al. Sequence analysis of the conserved protamine gene cluster shows that it contains a fourth expressed gene. Mol Reprod Dev (1996) 43:1–6.[CrossRef][Web of Science][Medline]

Tanaka H, Miyagawa Y, Tsujimura A, et al. Single nucleotide polymorphisms in the protamine-1 and -2 genes of fertile and infertile human male populations. Mol Hum Reprod (2003) 9:69–73.[Abstract/Free Full Text]

Yang J, Morales CR, Medvedev S, et al. In the absence of the mouse DNA/RNA-binding protein MSY2, messenger RNA instability leads to spermatogenic arrest. Biol Reprod (2007) 76:48–54.[Abstract/Free Full Text]

Submitted on February 5, 2007; resubmitted on March 19, 2007; accepted on March 26, 2007.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Biol. Reprod.Home page
K. Poplonska, M. Kwiatkowska, A. Wojtczak, and J. Polit
Immunogold Evidence Suggests That Endoplasmic Reticulum Is the Site of Protamine-Type Protein Synthesis and Participates in Translocation of These Proteins into the Nucleus During Chara vulgaris Spermiogenesis
Biol Reprod, March 1, 2009; 80(3): 572 - 580.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
C. Gazquez, J. Oriola, S. de Mateo, J. M. Vidal-Taboada, J. L. Ballesca, and R. Oliva
A Common Protamine 1 Promoter Polymorphism (-190 C->A) Correlates With Abnormal Sperm Morphology and Increased Protamine P1/P2 Ratio in Infertile Patients
J Androl, September 1, 2008; 29(5): 540 - 548.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
E Kichine, S Msaidie, A D Bokilo, A Ducourneau, A Navarro, N Levy, P Terriou, P Collignon, G Boetsch, J Chiaroni, et al.
Low-frequency protamine 1 gene transversions c.102G->T and c.-107G->C do not correlate with male infertility.
J. Med. Genet., April 1, 2008; 45(4): 255 - 256.
[Full Text] [PDF]


Home page
Biol. Reprod.Home page
E. Dube, L. Hermo, P. T.K Chan, and D. G Cyr
Alterations in Gene Expression in the Caput Epididymides of Nonobstructive Azoospermic Men
Biol Reprod, February 1, 2008; 78(2): 342 - 351.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/7/461    most recent
gam031v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (4)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Ravel, C.
Right arrow Articles by McElreavey, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ravel, C.
Right arrow Articles by McElreavey, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?