Skip Navigation


Mol. Hum. Reprod. Advance Access originally published online on February 4, 2008
Molecular Human Reproduction 2008 14(3):143-150; doi:10.1093/molehr/gan005
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
14/3/143    most recent
gan005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Berkowitz, K. M.
Right arrow Articles by Jongens, T. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Berkowitz, K. M.
Right arrow Articles by Jongens, T. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2008. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Germline expression of mammalian CTF18, an evolutionarily conserved protein required for germ cell proliferation in the fly and sister chromatid cohesion in yeast

Karen M. Berkowitz1,2,4, Klaus H. Kaestner3 and Thomas A. Jongens1,3

1Center for Research on Reproduction and Women's Health, School of Medicine, University of Pennsylvania, 1307 BRB II/III, 421 Curie Blvd, Philadelphia, PA 19104-6160, USA 2Department of Obstetrics and Gynecology, University of Pennsylvania, Philadelphia, PA 19104, USA 3Department of Genetics, University of Pennsylvania, Philadelphia, PA 9104, USA

4Correspondence address. Tel: +1-215-573-1944; Fax: +1-215-573-7627; E-mail: kberkowitz{at}obgyn.upenn.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Funding
 Acknowledgements
 References
 
Cutlet/CTF18 encodes an evolutionarily conserved protein that is crucial for germline development in Drosophila melanogaster. Loss of function of cutlet in the fly results in a sterile phenotype due to the failure of germline stem cells to proliferate. CTF18 was first identified in Saccharomyces cerevisiae as a sister chromatid cohesion factor that is essential for the faithful transmission of chromosomes during DNA replication. We have cloned and characterized the human and mouse CTF18 orthologs of the D. melanogaster gene, cutlet. We have demonstrated that CTF18 mRNA is expressed in human and mouse testis and ovary, and that CTF18 protein is expressed throughout the male and female germline of the mouse. We suggest a unique biological role for CTF18 in mammalian germ cell development based on its mammalian germline expression, high degree of evolutionary conservation, and role in DNA replication and chromosomal stability in yeast.

Key words: CTF18/DNA replication/germ cell development/germline expression/CTF18-replication factor C-like complex


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Funding
 Acknowledgements
 References
 
The germ cell complement and the processes that regulate germ cell development determine reproductive potential. Factors that reduce germ cell number or interfere with gametogenesis can limit or even preclude reproduction, leading to infertility. Studies of sterile mutants in lower organisms have shed new light on the processes that control mammalian germ cell development. We are interested in understanding the molecular mechanisms that govern mammalian gametogenesis, and began our analysis with mutations affecting germline development in the fruitfly, in which such mutations can be easily screened for.

One such large-scale forward genetic screen in Drosophila melanogaster yielded the cutlet gene (Jaffe and Jongens, 2001). In ovaries of flies lacking cutlet, the germline stem cells fail to proliferate normally, and few if any oocyte chambers are formed, resulting in sterility. Defects of the eye and wing are also seen in cutlet loss-of-function animals, however these defects are relatively mild and the adult organs appear to function normally. Studies by Jaffe and Jongens (2001) have shown that loss of cutlet function causes decreased cellular proliferation possibly due to a role in DNA replication in the affected tissues.

Cutlet is the ortholog of the Saccharomyces cerevisiae gene, CTF18 (formerly CHL12), initially identified as a gene necessary for fidelity of chromosome transmission during mitosis (Kouprina et al., 1994). Recently, CTF18 was found to be a component of an alternative and novel replication factor C-like complex, CTF18-RLC. Replication factor C (RFC) is required for DNA replication and consists of five evolutionarily conserved subunits that form a multiprotein complex. The primary role of RFC is to load proliferating cell nuclear antigen (PCNA), a protein that functions as a sliding clamp, onto DNA during replication (Waga and Stillman, 1998). After PCNA is loaded onto DNA, DNA polymerases bind to the resulting DNA–RFC–PCNA complex allowing DNA replication to occur in a rapid and highly processive manner (Mossi and Hubscher, 1998; Waga and Stillman, 1998). RFC ensures the fidelity of DNA replication and also functions in DNA recombination and DNA repair in bacteria and yeast (McAlear et al., 1996; Mossi and Hubscher, 1998; Schmidt et al., 2001). In alternative RFC complexes, the largest subunit of RFC, RFC1, is replaced by a different protein component to form an RFC-like complex, called an RLC. Three RLCs have been described in which RFC1 is replaced by either Rad24, Elg1 or CTF18. These complexes play vital but distinct roles in DNA replication and genome stability (Kim and MacNeill, 2003). In the RFC-like complex, CTF18-RLC, the large subunit of RFC is replaced by CTF18, and two additional components, Dcc1 and Ctf8, are added to form a complex consisting of seven subunits. CTF18-RLC appears to be required for sister chromatid cohesion during DNA replication in yeast (Hanna et al., 2001; Mayer et al., 2001), and recently CTF18 was cloned in human immortalized cell lines and found to form a CTF18-RLC that is also likely involved in establishment of mammalian sister chromatid cohesion (Bermudez et al., 2003; Merkle et al., 2003). In yeast, the CTF18-RLC complex is crucial for the association of the newly replicated sister chromatids until anaphase and thus helps to maintain the stability of the genome (Kim and MacNeill, 2003). Loss-of-function mutations in CTF18 in yeast result in premature separation of sister chromatids, chromosome loss and ultimately aneuploidy (Kouprina et al., 1994; Hanna et al., 2001; Mayer et al., 2001). In vitro, CTF18-RLC can interact with human PCNA and load it onto DNA (Ohta et al., 2002; Bermudez et al., 2003; Merkle et al., 2003; Shiomi et al., 2004), but its roles in DNA replication appear to different from those of RFC (Shiomi et al., 2004). In addition, CTF18-RLC has been shown to play a role in chromosome segregation during meiosis in yeast (Petronczki et al., 2004). In yeast, CTF18 is functionally redundant with RAD24 in the DNA replication checkpoint pathway, and double mutants become defective in the replication block checkpoint and sensitive to DNA damage (Naiki et al., 2001). DNA replication checkpoint pathways arrest the cell cycle when DNA replication is blocked or DNA is damaged, and they induce transcription of genes that facilitate DNA replication and/or repair (Elledge, 1996; Zhou and Elledge, 2000). Finally, DNA replication, recombination and repair are essential for the normal development and competency of germ cells during gametogenesis.

We cloned and characterized the cDNAs encoding human CTF18, called CHTF18, and mouse CTF18, called Chtf18, the orthologs of Drosophila cutlet, in order to study its expression and ultimately its role in mammalian reproduction. Here, we demonstrate RNA expression of CTF18 in human and mouse testis and ovary, and protein expression in the male and female germline of the mouse. We also show the striking conservation of the putative functional domains of the protein among the human, mouse and fly.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Funding
 Acknowledgements
 References
 
Cloning of the human and mouse CTF18 cDNAs
PCR primers (first round with 5' GAATTCGGCACGAGGACGAC and 5'AGGCCTGCTGCTTCAGCTGC and second round with 5'CGGTGCGAACTCGTCATTGC and 5'ACCTCCCCATTGCAGTGACG) were designed from a partial human CTF18 cDNA sequence given to us by Dr Philip Hieter of the University of British Columbia (unpublished). A 400 bp PCR product was amplified, subcloned into pGEM-T vector (Promega, Madison, WI, USA), and then utilized as a probe to screen a human ovarian cDNA library (Clontech Laboratories, Inc., Palo Alto, CA, USA). The full-length cDNA insert obtained was cloned into pBluescript SK (Stratagene, La Jolla, CA, USA) and the sequence was analyzed for an open reading frame (ORF) (MacVector software, Accelrys, San Diego, CA, USA). This sequence was compared with the ORF of Drosophila cutlet and it was also utilized to search for homologous genes using the BLAST tool (Altschul et al., 1990). Orthologs were identified by DNA and protein database searches, which revealed homologous amino acid sequences in Caenorhabditis elegans, Arabidopsis thaliana and S. cerevisiae. The human cDNA insert was digested with SmaI and StuI to generate a cDNA fragment encoding an amino acid sequence with high conservation among the human, fly, worm, plant and yeast. This human cDNA fragment was subcloned into pBluescript SK and used to screen a mouse testis cDNA library (Clontech Laboratories, Inc.). The mouse cDNA insert obtained was subcloned into pBluescript SK and sequenced from both directions.

RT–PCR and 5' and 3' RACE
RT–PCR and nested 5' and 3' rapid amplification of cDNA ends (RACE) were performed to obtain the full-length sequence of the mouse CTF18 cDNA. Initially, a pool of cDNAs was generated by reverse transcription of 5 µg of total RNA isolated from mixed germ cells from adult mouse testes (provided as a gift from Dr Stuart Moss, University of Pennsylvania) using the First Strand cDNA synthesis Superscript II kit (Invitrogen, Carlsbad, CA, USA). Primers were designed based on homology, by mapping the amino acid sequences of Drosophila cutlet and CHTF18 to an 18 kb portion of the translated mouse genomic database (Celera Genomics, San Francisco, CA, USA). To construct an ORF for Chtf18, PCR products were amplified from the cDNA pool, cloned into pGEM-T vector (Promega) and sequenced from both directions. To obtain the sequences of the 5' and 3' ends of the mouse CTF18 cDNA, nested 5' and 3' RACE were performed on mouse testis poly(A)+RNA with the Marathon cDNA amplification kit (Clontech Laboratories, Inc.). Primers were designed within the 5' and 3' ends of the sequence for the products obtained by RT–PCR. To generate the 5'RACE product, PCR was performed with primer 5'AGAATGGGAGCTCACATCGTCACTGAGC and the Marathon cDNA adaptor primer (first round) and primer 5'CTCATCCACCCAGAGGCAGTGCTG and the Marathon cDNA adaptor primer (second round). The 3'RACE product was amplified with primer 5'CAGACTCGGATGAGCCAGACAAGG and the Marathon cDNA adaptor primer (first round) followed by primer 5'AGCTGTACAGTGCCCATGAGAAGC and the Marathon cDNA adapter primer (second round). The RACE products were each cloned into pGEM-T vector (Promega), and sequenced from both directions to deduce the full-length cDNA.

Northern blot analysis
A human CTF18 cDNA fragment containing 1.6 kb of the coding region was radioactively labeled using Rad Prime labeling system (Invitrogen) and utilized to probe a poly A RNA multiple human tissue blot (Clontech Laboratories, Inc.). A 1.6 kb mouse CTF18 cDNA fragment was radiolabeled and used to probe a poly A RNA multiple mouse tissue blot (Ambion, Inc., Austin, TX, USA). Each blot was stripped and probed with a human beta actin cDNA (Clontech Laboratories, Inc.) or a beta actin mouse DECAprobe template (Ambion, Inc.) to control for RNA loading.

Generation of a mouse CTF18 antibody
A cDNA fragment encoding the C-terminal portion of mouse CTF18 (amino acid residues 790–968) was amplified from a CTF18 cDNA clone with the following primers: 5'GATCGGATCCATGCTTGCCTACAGTCTCACC and 5'GATCCTCGAGCAGGTCCCTGATGTACAG. The cDNA fragment was subcloned into the BamHI/XhoI sites of the pET-28a vector (Novagen of EMD Biosciences, Inc., San Diego, CA, USA) to generate a histidine-tagged fusion construct. The resulting fusion construct was transformed into BL21(DE3)RP cells (Stratagene) after confirming the correct sequence, and protein synthesis was induced with 1 mM (final concentration) isopropyl-β-D-thiogalactopyranoside (IPTG) at 30°C for 5 h. The cell pellets were purified on a nickel-nitrilotriacetic acid (Ni-NTA) matrix (Qiagen, Inc., Valencia, CA, USA) under denaturing conditions according to the manufacturer's instructions. After analyzing the eluates by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS–PAGE), fractions with the highest concentration of protein were combined and purified on a Sephacryl S-100 column (Amersham Biosciences, Piscataway, NJ, USA) followed by reversed-phase HPLC. The protein appeared to be >95% pure on Coomassie-stained SDS–PAGE gels. Six separate injections totaling 850 µg of purified protein were administered to each of two rabbits to generate the rabbit polyclonal antibody (Covance, Inc., Denver, PA, USA). A portion of each of the pre-immune and immune sera was IgG- purified using the Nab Protein A Spin Purification Kit (Pierce, Rockford, IL, USA).

Western blot analysis
For protein analyses of mouse testes and ovaries, 25 µg of extracted protein from total testis or 50 µg of extracted protein from total ovaries were electrophoretically separated by 4–12% SDS–PAGE, and transferred to polyvinylidene difluoride membranes (Millipore Co., Bedford, MA, USA). Membranes were blocked (Tris-buffered saline solution containing 5% nonfat dry milk and 0.1% Tween 20 [TBST]) and then incubated with IgG-purified mouse CTF18 antibody alone (0.31 µg/ml) or antibody pre-absorbed with 5x molar excess CTF18 recombinant protein, or with IgG-purified pre-immune serum (0.31 ug/ml) at 4°C overnight. The blots were washed in TBST and incubated with a goat anti-rabbit immunoglobulin conjugated to horse-radish peroxidase (0.2 µg/ml, Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA) for 1 h at room temperature. After washing, the CTF18 protein was detected with Super Signal chemiluminescent substrate (Pierce).

RT–PCR of mouse ovary and testis
RT–PCR was performed to determine the transcript size of Chtf18 mRNA in mouse ovary. Initially a pool of cDNAs was generated by reverse transcription of 5 µg of total RNA isolated from adult mouse ovaries or testes using the First Strand cDNA synthesis Superscript III kit (Invitrogen). PCR primer pairs spanning the DNA sequence of the Chtf18 gene were designed, and PCR was amplified from mouse ovary or testis cDNA samples (repeated in triplicate on samples from several different mice). To verify the sequence, a PCR product spanning exon 4 to exon 22 was amplified from the cDNA pool, subcloned into pCR 2.1-TOPO cloning vector (Invitrogen) and sequenced from both directions.

RNA interference
Human endometrial carcinoma (HEC) cells (provided as a gift from Dr Carmen Williams, University of Pennsylvania) were cultured in McCoy's 5A modified medium (Invitrogen). CHTF18 SMARTpool siRNAs (Dharmacon, Lafayette, CO, USA) were delivered into 70% confluent cells with DharmaFECT transfection reagent according to the manufacturer's protocol. Non-targeting siRNA pool (Dharmacon) at the same concentration as well as untreated HEC cells were used as controls. After 72 h transfection, cell lysates were collected with M-PER Mammalian Protein Extraction Reagent (Pierce) for western blot analysis. Western blot analysis was performed as described above on 25 µg of extracted protein per sample with 0.52 µg/ml IgG-purified mouse CTF18 antibody.

Immunohistochemistry
Testes from adult male and ovaries from adult female CD1 mice were fixed in 4% paraformaldehyde and embedded in paraffin blocks. Sectioned slides were blocked in PBS containing goat serum (20 min at 37°C) and incubated in IgG-purified immune serum (1.6 µg/ml) at 4°C overnight. CTF18 protein staining was detected with the Vectastain Elite ABC kit (Vector Laboratories, Burlingame, CA, USA). Sections were counterstained with hematoxylin following detection. IgG-purified pre-immune serum (1.7 µg/ml) was used in control sections.

Fetal germ cell preparations and immunofluorescence
Ovaries and testes from mouse fetuses at 13.5, 14.5 and 15.5 days post-coitum (dpc) were dissected. Germ cells were dissociated in a saline/EDTA buffer as described (Nagy, 2003) and then fixed in a solution of 2% paraformaldehyde, 0.15% Triton X-100 onto slides. For immunofluorescence, slides containing germ cells were incubated in a blocking solution of 10% donkey serum, 3% BSA, 0.1% Triton X-100 in 1X PBS for 1 h at room temperature. Then slides were incubated in mouse CTF18 IgG-purified immune serum (6.2 µg/ml) or anti-mouse vasa homolog (MVH) protein (1 µg/ml) (Abcam Inc., Cambridge, MA, USA) and purified anti-mouse CD 31/platelet endothelial cell adhesion molecule (PECAM-1) (1 µg/ml) diluted in blocking solution overnight at 4°C (anti-PECAM-1 from BD Pharmingen, San Diego, CA, USA). Slides were washed in 1% donkey serum, 3% BSA, 0.1% Triton X-100 diluted in 1x PBS three times, and then incubated in donkey anti-rabbit IgG cyanine-3 and donkey anti-rat IgG cyanine-2 (Jackson ImmunoResearch Laboratories, Inc.) at 1:1200 for 2 h at room temperature. Slides were washed as described above, and then mounted with coverslips. Imaging was performed with a Nikon Eclipse E600 wide-field microscope equipped with fluorescence. IPLab Scientific Imaging software for Macintosh (BioVision Technologies, Exton, PA, USA) was used to process images and to optically section slides of germ cell preparations.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Funding
 Acknowledgements
 References
 
Cloning and characterization of the human and mouse CTF18 cDNAs
Overlapping cDNA fragments that encode the human and mouse orthologs of the D. melanogaster gene, cutlet were isolated, cloned and the DNA sequences conceptually translated. The sequences match those present in NCBI GenBank with accession numbers NM_022092 for CHTF18 and NM_145409 for Chtf18. The cDNAs of human CHTF18 and mouse Chtf18 are each ~3 kb in length, similar to the 3.1 kb cDNA present in Drosophila cutlet. The longest ORFs of the human and mouse cDNAs span 975 and 969 amino acids, respectively, similar to the 993 ORF of the fly. The mouse CTF18 amino acid sequence is 84% similar with 75% identity to the human CTF18 amino acid sequence. In addition, the mammalian proteins are 51% similar to 31% identity for human and 53% similar with 31% identity for mouse to that of the fly (Fig. 1A). This degree of amino acid similarity of CTF18 among the human, mouse and fly suggests conserved functions for the three proteins. The gene structures of human and mouse CTF18 were deduced by aligning the ORFs to the translated human and mouse CTF18 mRNA sequences to the genomic sequences obtained from the GenBank (NIH, Bethesda, MD, USA) and Celera databases. The human and mouse CTF18 genes consist of 22 exons each, spanning ~9 and 8 kb of genomic DNA, respectively (Fig. 1B).


Figure 1
View larger version (80K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1: (A) Amino acid alignment of mouse(top) and human (middle) CTF18 and Drosophila cutlet (bottom). Darkly shaded areas correspond to identical amino acids and lighter gray areas correspond to similar amino acids. The putative functional domains (depicted in yellow) encoded by the CTF18 protein are highly conserved among the mouse, human and fly. These are RFC boxes II, III, IV, V and VII including a nucleotide binding domain or P loop and an AAA+ ATPase domain. The position of the internal methionine in exon 10 that likely produces the 58 kD version of the CTF18 protein is indicated by a star. (B) Murine Chtf18 gene structure. The gene structures of mouse and human CTF18 are strikingly similar and consist of 22 exons each spanning ~8 and 9 kb of genomic DNA, respectively. The 5' and 3' untranslated regions of the murine gene structure are depicted by open boxes. The position of the internal methionine in exon 10 that likely produces the 58 kD version of the CTF18 protein is indicated by a star. (C)RT–PCR of mouse ovary and testis. Primer pairs spanning the Chtf18 gene were used to amplify DNA from exon 1 to exon 4 (ex1–ex4), exon 5 to exon 8 (ex5–ex8), exon 9 to exon 12 (ex9–ex12) and exon 4 to exon 22 (ex4–ex22) in mouse ovary (Ov) and testis (T)

 
CTF18 is homologous to RFC as determined by protein family and domain database searches (ExPASy of the Swiss Institute of Bioinformatics, Switzerland and Pfam of the Wellcome Trust Sanger Institute, Cambridge, UK) with the deduced amino acid sequences of each of the mouse and human proteins. The homology between CTF18 and RFC exists in evolutionarily conserved sequence motifs called RFC boxes (Cullmann et al., 1995). Mammalian CTF18 contains five of the eight RFC boxes including II, III, IV, V and VII. In addition, a phosphate-binding loop (P loop) and an AAA+ ATPase domain are present (Fig. 1A).

The CHTF18 and Chtf18 genes are expressed in human and mouse testis and ovary
To determine the expression pattern of CTF18 in human and mouse tissues northern blot analysis was performed. Two transcripts of ~4 and 3 kb with expression in testis, ovary and thymus were detected in the human. This pattern of expression is consistent with multiple human tissue gene expression profiling by microarray analysis, electronic Northerns and SAGE revealed by database searches (http://www.genecards.org/cgi-bin/carddisp.pl?gene=CHTF18). These data also reveal that CTF18 mRNA is expressed in bone marrow, thymus, brain, heart, spinal cord, skeletal muscle, liver, lung, kidney, pancreas and prostate. RNA blot analysis in the mouse detected one transcript of ~3 kb with expression in testis, ovary, thymus, spleen and the 14 day embryo (Fig. 2). This transcript size is consistent with that revealed by overlapping cDNA sequences from RT–PCR amplification of mouse testis RNA, followed by 5' and 3' RACE. CTF18 mRNA appears to be highly abundant in mouse testis; however, CTF18 mRNA was also detected in somatic tissues (Fig. 2). The expression in somatic tissues confirms what has been found by microarray analysis. These microarray data reveal only slightly elevated transcript levels in testis and none in ovary (http://genome.ucsc.edu/cgi-bin/hgGene?hgsid=93629103&db=mm8&hgg_gene=NM_145409&hgg_chrom=chr17&hgg_start=25446630&hgg_end=25455002#links). Thus, the high expression in testis and expression in ovary documented here has not been previously recognized.


Figure 2
View larger version (64K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2: Northern blot analysis of CTF18 mRNA extracted from indicated tissues

(A) Northern blot analysis of human CTF18 mRNA expression. sm. intes., small intestine; pbl, peripheral blood leukocyte. (B) Northern blot analysis of mouse CTF18 mRNA expression. 14d embryo, 14 day embryo. The blots were reprobed with beta actin cDNA or DNA (human and mouse, respectively)

 
CTF18 protein is expressed in mouse testis and ovary
Western blot analysis was performed on protein extracts from mouse testis and ovary with a rabbit polyclonal antibody that was generated to the carboxy terminus of the mouse CTF18 protein (see Materials and Methods). A 108 kD protein in mouse testis and an ~58 kD protein in mouse ovary were detected by IgG-purified mouse CTF18 antibody (Fig. 3A). The 58 kD band is also detected on western blots of protein extracts from mouse somatic tissues (data not shown). The 108 kD protein present in testis is consistent with the size predicted to be encoded by the longest ORF contained in the 3 kb transcript. RT–PCR was performed to determine how the 58 kD protein in ovary arises. PCR products amplified from mouse ovary or testis cDNA samples (repeated in triplicate on samples from several different mice) were the same in size and consistent with only one transcript in ovary and testis (Fig. 1C). In addition, expression of the same transcript in mouse ovary and testis was confirmed by sequencing of PCR products spanning exon 4 to exon 22 for each tissue (data not shown). The specificity of the antibody was demonstrated by presence of a single band of expected size on western blot using the purified recombinant CTF18 protein (data not shown), as well as by neutralization of the antiserum with the purified recombinant antigen, which blocks detection of the 108 kD band observed in testis and the 58 kD band seen in ovary (Fig. 3B). The additional 70 kD band detected in testis (Fig. 3A) is non-specific since it is present in pre-immune serum (Fig. 3C) and it is not blocked by neutralization of the antiserum with the purified recombinant CTF18 protein (Fig. 3B). We also demonstrated specificity of the mouse CTF18 antibody for human CTF18 protein with RNAi. RNAi-mediated suppression of CTF18 in a HEC cell line resulted in reduction of the immunoreactive bands compared with HEC cells treated with non-targeting siRNA pool and untreated HEC cells (Fig. 3D).


Figure 3
View larger version (45K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 3: Western blot analysis of CTF18 protein expression in mouse testis and ovary, and in HEC cells

Testis and ovary protein extracts were incubated with (A) IgG-purified CTF18 antibody alone, (B) antibody pre-absorbed with recombinant mouse CTF18 protein or (C) IgG-purified pre-immune serum as a control (D) CTF18 protein expression was significantly decreased in HEC cells treated with CHTF18 SMARTpool siRNAs (si), which resulted in reduction of the immunoreactive bands compared with HEC cells treated with non-targeting siRNA pool (non) and untreated HEC cells (un)

 
CTF18 protein expression and localization in mouse gonads was further analyzed by immunohistochemistry (Fig. 4). In adult mouse testis, CTF18 protein is expressed in all stages of developing germ cells (Fig. 4B and C). Expression of CTF18 is very prominent in the nuclei of spermatocytes, and less prominent in the cytoplasm of spermatogonia (Fig. 4C). CTF18 protein is also expressed in Sertoli cells and Leydig cells (Fig. 4C). In adult mouse ovary, CTF18 protein is localized to the oocyte cytoplasm of all stages of developing follicles (Fig. 4F and G). It is also expressed in a heterogeneous pattern in theca cells of corpora lutea, granulosa and theca cells of pre-antral follicles, and in ovarian stromal cells (Fig. 4F and G). Sections of mouse testis and ovary were incubated with IgG-purified pre-immune serum as a control and no signal was detected (Fig. 4A and E); likewise, no signal was obtained in testis (Fig. 4D) or ovary (Fig. 4H) of Chtf18-null mice (to be discussed elsewhere), confirming the specificity of the antibody. We also examined expression of CTF18 protein in fetal germ cells. We examined expression of CTF18 protein in female fetal germ cells since the orthologous Cutlet protein is crucial during the mitotic stages of amplification in the ovary of the fruitfly (Jaffe and Jongens, 2001). Since CTF18 protein is also expressed in somatic cells, we used an antibody to PECAM-1, an accepted marker of germ cells (Schmahl et al., 2000; Ross et al., 2007), to label these cells in our preparations. In addition, we co-localized PECAM-1 and MVH protein to demonstrate the reliability of anti-PECAM-1 as a germ cell marker in our hands (Supplementary Fig. 1). In the fetal ovary, CTF18 protein is expressed in the nuclei of developing germ cells from the onset of meiosis at 13.5 dpc through 15.5 dpc (Fig. 5A–I). Male fetal germ cells also express CTF18 protein in the nuclei from 13.5 through 15.5 dpc (Fig. 6A–I). Nuclear localization of CTF18 protein in fetal germ cells was confirmed by optical sectioning (Supplementary Fig. 2).


Figure 4
View larger version (137K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 4: Localization of CTF18 protein in mouse testis and ovary

Immunohistochemistry with diaminobenzidene localized CTF18 in sections of mouse testis incubated with (A) pre-immune and (B and C) immune sera. (C) CTF18 protein is seen as a brown precipitate in spermatogonia (Sg), spermatocytes (Sc), Sertoli cells (Se) and Leydig cells (L) of testis. Sections of ovary were incubated with (E) preimmune and (F and G) immune sera. (F) CTF18 protein is shown localized to the oocyte cytoplasm of primary (P) and secondary (S) follicles and in corpora lutea (CL) and stromal cells (ST) (seen as a brown precipitate). (G) CTF18 protein is shown localized to the oocyte cytoplasm, and granulosa (G) and theca (Th) cells of a pre-antral follicle. No immunoreactivity was detected in testis (D) or ovary (H) of Chtf18-null mice. Hematoxylin was used as a counterstain (blue color). Magnification: A, B, E and F x200; C, D, G and H x400

 

Figure 5
View larger version (69K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 5: Localization of CTF18 protein in female fetal germ cells

Immunofluorescence localized CTF18 protein (red color) to the nuclei of female germ cells at 13.5 dpc (AC), 14.5 dpc (DF) and 15.5 dpc (GI). PECAM-1 antibody (green color) was used as a germ cell marker. Somatic cells express CTF18 but not PECAM-1 (arrows in panel I). Magnification: x600

 

Figure 6
View larger version (58K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 6: Localization of CTF18 protein in male fetal germ cells

Immunofluorescence localized CTF18 protein (red color) to the nuclei of male germ cells at 13.5 dpc (AC) and 14.5 dpc (DF) and 15.5 dpc (GI). PECAM-1 antibody (green color) was used as a germ cell marker. Somatic cells express CTF18 but not PECAM-1 (arrows in panels F and I). Magnification: x600

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Funding
 Acknowledgements
 References
 
We cloned and characterized the cDNAs encoding both CHTF18 and Chtf18, the orthologs of Drosophila cutlet and Saccharomyces CTF18 in order to study the pattern of expression of this gene in mammalian germ cell development. Although several reports have demonstrated a role for CTF18 in DNA replication and chromosomal cohesion of yeast (Kouprina et al., 1994; Hanna et al., 2001; Mayer et al., 2001; Petronczki et al., 2004), and others have suggested a role for CTF18 in human DNA replication (Ohta et al., 2002; Bermudez et al., 2003; Merkle et al., 2003; Shiomi et al., 2004), this is the first report to demonstrate the expression pattern of CTF18 in the germline of the human and mouse. The gene is widely expressed throughout the mammalian germline, which requires fidelity of DNA replication during both mitosis and meiosis. The expression pattern of the mammalian CTF18 gene is thus consistent with its proposed role in germline development. The CTF18 protein is evolutionarily conserved with features similar to proteins essential for different aspects of DNA metabolism including replication, recombination and repair.

CTF18 shows significant homology to RFC in conserved motifs within RFC, known as RFC boxes. These RFC boxes demonstrate a high degree of amino acid similarity among the five subunits of RFC across species. The boxes appear to be biochemically distinct, and although their exact functions are not known, these domains appear to be required for DNA replication in yeast and in human cells. RFC box II is critical for the function of human RFC (Uhlmann et al., 1997a,b). RFC box III, the most conserved domain of the RFC subunits, contains a P loop which is a portion of a nucleotide binding pocket belonging to a diverse group of GTP and ATP hydrolyzing proteins, some of which are involved in DNA recombination or repair (Cullmann et al., 1995). This ATP-binding consensus has been shown to play a critical role in chromosomal DNA metabolism in yeast (Schmidt et al., 2001). In addition, an AAA+ ATPase domain is present, which is also found in a family of proteins that perform chaperone-like functions that assist in protein complex formation, operation or disassembly (Fig. 1). Specifically, in Escherichia coli, these include the Ruv proteins that are involved in DNA recombination and repair (Iwasaki et al., 2000). Thus, these data and the high degree of amino acid conservation in these boxes among the mouse, human and fly strongly suggest that the five RFC boxes present in the encoded mammalian CTF18 protein represent functional domains.

Our studies show that CTF18 protein is expressed in all stages of germ cell development in the mouse. CTF18 is expressed in the nuclei of female fetal germ cells during meiosis, while interestingly a majority of CTF18 protein is localized to the cytoplasm of oocytes in the adult mouse ovary. CTF18 expression in the cytoplasm of oocytes is consistent with protein storage, an essential feature of oogenesis to provide for the needs of the early developing embryo. It is also of interest that CTF18 protein appears to be very prominent in the nuclei of spermatocytes, and less prominent in the cytoplasm of spermatogonia, whereas it is expressed in the nuclei of male fetal germ cells at 13.5, 14.5 and 15.5 dpc, during a time of cellular proliferation (de Rooij, 1998; Monk and McLaren, 1981). Nuclear expression of CTF18 is consistent with its known roles in DNA replication and establishment of sister chromatid cohesion in lower eukaryotes (Kouprina et al., 1994; Hanna et al., 2001; Mayer et al., 2001; Petronczki et al., 2004). Expression of CTF18 in the cytoplasm of spermatogonia is a novel finding and may suggest a different function during this stage of germ cell development. It is also possible that CTF18 protein may be utilized by male fetal germ cells early in development, and then stored in the cytoplasm until later use during meiosis. Thus, differences in CTF18 expression may reflect changes in the stages of development in both male and female germ cells. Since CTF18 associates with chromatin during the S phase of DNA replication in HeLa cells (Merkle et al., 2003), the apparent localization of CTF18 protein to specific regions in the nuclei of fetal germ cells may correspond to an association with chromatin. In addition, significant changes occur in the structure and composition of chromatin in the nuclei of spermatogenic cells during the transition from spermatogonia to spermatocytes to subsequent post-meiotic haploid spermatids (Fauser, 1999). Therefore, CTF18 protein may be involved in chromatin rearrangement in haploid spermatogenic cells. Our data support a role for CTF18 in mammalian gametogenesis, and the protein expression observed in oocytes, as well as in spermatocytes, suggests a role in meiosis. In addition, CTF18 RNA is expressed in human and mouse testis, ovary, thymus and in mouse spleen. DNA recombination occurs in all of these tissues, and thus this expression pattern is consistent with a role for CTF18 in chromosomal biology. The lack of mRNA expression in human spleen may be due to inherent differences in this tissue between young adult mice and adult humans. The 4 kb transcript present in human tissues may arise from differences in the untranslated regions of the gene or by alternative splicing as suggested by human EST databases (Thierry-Mieg and Thierry-Mieg, 2006). The 108 kD protein present in testis is consistent with the size predicted to be encoded by the 3 kb transcript. The 58 kD protein detected in ovary most likely arises by alternative initiation codon usage by the ribosome (i.e. a different initiation codon is used in ovary than in testis) or by post-translational modification (e.g. proteolytic cleavage), since the same transcript is expressed in both mouse ovary and in mouse testis. In addition, the 58 kD protein isoform is detected by our antibody because it was raised against a C-terminal recombinant protein of CTF18. Hence, the termini of the 108 and 58 kD proteins are likely identical. Existence of a 58 kD band is also detected on western blots of protein extracts from mouse somatic tissues (data not shown). The 58 kD isoform most likely corresponds to an internal Methionine at 414, which is encoded in exon 10 of Chtf18, resulting in an ORF of 556 amino acids (Fig. 1A and B). RFC boxes V and VII, two of the five functional domains that appear in the CTF18 protein, are also likely present within this shorter ORF. In addition, while localization of CTF18 protein differs in adult male and female mice (discussed above), the protein localizes to the nuclei of both male and female embryonic germ cells. Although there may be common characteristics in the roles of the 108 and 58 kD proteins, further experiments are required to determine the exact functions of the isoforms.

Although our work does not provide evidence for a germ cell-specific function in mammals, CTF18 protein is expressed ubiquitously in the nuclei of cells in Drosophila, yet adult tissues in Cutlet/CTF18 mutant flies are affected differently, and sterility is the most severe phenotype (Jaffe and Jongens, 2001). The intriguing fly mutant phenotype in conjunction with the high degree of evolutionary conservation of the protein and the mammalian germline expression we show here strongly suggest a role for CTF18 in mammalian germ cell development. Thus, the work presented here provides the basis for studying the function of CTF18 in mammalian germ cell development.


    Funding
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Funding
 Acknowledgements
 References
 
NIH (HD 01256 and HD 34449); generous awards from the American Society for Reproductive Medicine through Organon Pharmaceuticals USA, Inc. and from the Berlex Foundation. NIH P30 DK 50306 supports the Center for the Molecular Studies of Liver and Digestive Diseases, Morphology Core at the University of Pennsylvania.


    Acknowledgements
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Funding
 Acknowledgements
 References
 
We thank Lydia Koenig, Edward Carlin and Mohammad Hashmi for technical assistance. We are grateful to Drs Jerome Strauss, Glenn Radice, Carmen Williams, Salli Tazuke and Anita Pepper for critical reading of the manuscript. We also acknowledge Dr Hillary Nelson and Laura Conlin for help with HPLC protein purification, and the assistance of Dr Gary Swain and the members of the Center for the Molecular Studies of Liver and Digestive Diseases, Morphology Core at the University of Pennsylvania.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Funding
 Acknowledgements
 References
 
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol (1990) 215:403–410.[CrossRef][Web of Science][Medline]

Bermudez VP, Maniwa Y, Tappin I, Ozato K, Yokomori K, Hurwitz J. The alternative Ctf18-Dcc1-Ctf8-replication factor C complex required for sister chromatid cohesion loads proliferating cell nuclear antigen onto DNA. Proc Natl Acad Sci USA (2003) 100:10237–10242.[Abstract/Free Full Text]

Cullmann G, Fien K, Kobayashi R, Stillman B. Characterization of the five replication factor C genes of Saccharomyces cerevisiae. Mol Cell Biol (1995) 15:4661–4671.[Abstract]

de Rooij DG. Stem cells in the testis. Int J Exp Pathol (1998) 79:67–80.[CrossRef][Web of Science][Medline]

Elledge SJ. Cell cycle checkpoints: preventing an identity crisis. Science (1996) 274:1664–1672.[Abstract/Free Full Text]

Fauser BCJM. Molecular biology in reproductive medicine. In: New York: (1999) Parthenon Pub. Group.

Hanna JS, Kroll ES, Lundblad V, Spencer FA. Saccharomyces cerevisiae CTF18 and CTF4 are required for sister chromatid cohesion. Mol Cell Biol (2001) 21:3144–3158.[Abstract/Free Full Text]

Iwasaki H, Han YW, Okamoto T, Ohnishi T, Yoshikawa M, Yamada K, Toh H, Daiyasu H, Ogura T, Shinagawa H. Mutational analysis of the functional motifs of RuvB, an AAA+ class helicase and motor protein for holliday junction branch migration. Mol Microbiol (2000) 36:528–538.[CrossRef][Web of Science][Medline]

Jaffe AB, Jongens TA. Structure-specific abnormalities associated with mutations in a DNA replication accessory factor in Drosophila. Dev Biol (2001) 230:161–176.[CrossRef][Web of Science][Medline]

Kim J, MacNeill SA. Genome stability: a new member of the RFC family. Curr Biol (2003) 13:R873–R875.[CrossRef][Web of Science][Medline]

Kouprina N, Kroll E, Kirillov A, Bannikov V, Zakharyev V, Larionov V. CHL12, a gene essential for the fidelity of chromosome transmission in the yeast Saccharomyces cerevisiae. Genetics (1994) 138:1067–1079.[Abstract]

Mayer ML, Gygi SP, Aebersold R, Hieter P. Identification of RFC(Ctf18p, Ctf8p, Dcc1p): an alternative RFC complex required for sister chromatid cohesion in S. cerevisiae. Mol Cell (2001) 7:959–970.[CrossRef][Web of Science][Medline]

McAlear MA, Tuffo KM, Holm C. The large subunit of replication factor C (Rfc1p/Cdc44p) is required for DNA replication and DNA repair in Saccharomyces cerevisiae. Genetics (1996) 142:65–78.[Abstract]

Merkle CJ, Karnitz LM, Henry-Sanchez JT, Chen J. Cloning and characterization of hCTF18, hCTF8, and hDCC1. Human homologs of a Saccharomyces cerevisiae complex involved in sister chromatid cohesion establishment. J Biol Chem (2003) 278:30051–30056.[Abstract/Free Full Text]

Monk M, McLaren A. X-chromosome activity in foetal germ cells of the mouse. J Embryol Exp Morphol (1981) 63:75–84.[Web of Science][Medline]

Mossi R, Hubscher U. Clamping down on clamps and clamp loaders–the eukaryotic replication factor C. Eur J Biochem (1998) 254:209–216.[Web of Science][Medline]

Nagy A. Manipulating the Mouse Embryo: a Laboratory Manual, In: Cold Spring Harbor, NY (2003) 3rd edn. Cold Spring Harbor Laboratory Press.

Naiki T, Kondo T, Nakada D, Matsumoto K, Sugimoto K. Chl12 (Ctf18) forms a novel replication factor C-related complex and functions redundantly with Rad24 in the DNA replication checkpoint pathway. Mol Cell Biol (2001) 21:5838–5845.[Abstract/Free Full Text]

Ohta S, Shiomi Y, Sugimoto K, Obuse C, Tsurimoto T. A proteomics approach to identify proliferating cell nuclear antigen (PCNA)-binding proteins in human cell lysates. Identification of the human CHL12/RFCs2-5 complex as a novel PCNA-binding protein. J Biol Chem (2002) 277:40362–40367.[Abstract/Free Full Text]

Petronczki M, Chwalla B, Siomos MF, Yokobayashi S, Helmhart W, Deutschbauer AM, Davis RW, Watanabe Y, Nasmyth K. Sister-chromatid cohesion mediated by the alternative RF-CCtf18/Dcc1/Ctf8, the helicase Chl1 and the polymerase-alpha-associated protein Ctf4 is essential for chromatid disjunction during meiosis II. J Cell Sci (2004) 117:3547–3559.[Abstract/Free Full Text]

Ross A, Munger S, Capel B. Bmp7 regulates germ cell proliferation in mouse fetal gonads. Sex Dev (2007) 1:127–137.[CrossRef]

Schmahl J, Eicher EM, Washburn LL, Capel B. Sry induces cell proliferation in the mouse gonad. Development (2000) 127:65–73.[Abstract]

Schmidt SL, Pautz AL, Burgers PM. ATP utilization by yeast replication factor C. IV. RFC ATP-binding mutants show defects in DNA replication, DNA repair, and checkpoint regulation. J Biol Chem (2001) 276:34792–34800.[Abstract/Free Full Text]

Shiomi Y, Shinozaki A, Sugimoto K, Usukura J, Obuse C, Tsurimoto T. The reconstituted human Chl12-RFC complex functions as a second PCNA loader. Genes Cells (2004) 9:279–290.[Abstract/Free Full Text]

Thierry-Mieg D, Thierry-Mieg J. AceView: a comprehensive cDNA-supported gene and transcripts annotation. Genome Biol (2006) 7(Suppl_1):S12.11–S12.14.

Uhlmann F, Cai J, Gibbs E, O'Donnell M, Hurwitz J. Deletion analysis of the large subunit p140 in human replication factor C reveals regions required for complex formation and replication activities. J Biol Chem (1997) a272:10058–10064.[Abstract/Free Full Text]

Uhlmann F, Gibbs E, Cai J, O'Donnell M, Hurwitz J. Identification of regions within the four small subunits of human replication factor C required for complex formation and DNA replication. J Biol Chem (1997) b272:10065–10071.[Abstract/Free Full Text]

Waga S, Stillman B. The DNA replication fork in eukaryotic cells. Annu Rev Biochem (1998) 67:721–751.[CrossRef][Web of Science][Medline]

Zhou BB, Elledge SJ. The DNA damage response: putting checkpoints in perspective. Nature (2000) 408:433–439.[CrossRef][Medline]

Submitted on June 20, 2007; resubmitted on January 17, 2008; accepted on January 22, 2008.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
14/3/143    most recent
gan005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Berkowitz, K. M.
Right arrow Articles by Jongens, T. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Berkowitz, K. M.
Right arrow Articles by Jongens, T. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?