Mol. Hum. Reprod. Advance Access originally published online on May 20, 2008
Molecular Human Reproduction 2008 14(6):331-336; doi:10.1093/molehr/gan024
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Identification of target messenger RNA substrates for mouse RBMY
1Department of Medical Genetics, West China Hospital, Sichuan University, Renmin Nanlu, Section 3 #17, Chengdu 610041, PR China 2 Division of Human Morbid Genomics, State Key Laboratory of Biotherapy, Sichuan University, Chengdu 610041, PR China 3 Key laboratory of Bio-resources and Eco-environments, Ministry of Education, PR China
4 Correspondence address. Tel/Fax: +86-28-85164009; E-mail: mayongxing{at}263.net or mayongxin{at}gmail.com
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionFundingReferences |
|---|
Rbmy gene encodes a RNA-binding protein and its expression is limited to the nuclei of germ cells. Previous studies indicate that RBMY may function in pre-mRNA processing during spermatogenesis, although its precise target mRNAs remain unclear. By using specific nucleic acids associated with proteins and immunoprecipitation techniques, we have identified 12 potential target mRNAs bound by mouse RBMY protein from testis. We detect that both mRbmy-1 and mRbmy-2 transcripts co-exist in mouse testis and they differ mainly in the 5'UTR. Importantly, our result shows that mRBMY protein can bind to one of its own transcripts, mRbmy-2, suggesting that mRBMY may affect alternative splicing or regulate the expression of its own gene. Using electrophoretic mobility shift assay, we demonstrated that mRBMY protein can bind to the testis and sperm-specific spa17 mRNA and that the binding domain contains rich oligo(A), suggesting that mRBMY protein may have high affinity to oligo(A) rich sequences. In conclusion, the identification of RBMY target mRNAs will be helpful to further explore the biological function of RBMY in spermatogenesis.
Key words: RBMY/target mRNAs/spermatogenesis/mouse
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionFundingReferences |
|---|
Spermatogenesis is a complex process of mitotic and meiotic divisions of germ cells finally resulting in the formation of haploid spermatozoa. A highly coordinated expression of genes is therefore crucial for normal germ cell development. RBMY was identified as a Y-chromosome-encoded human gene family absent in some azoospermic men (Reijo et al., 1995). The RBM gene family comprises at least 30 genes and pseudogenes, found on both arms of the Y chromosome (Chai et al., 1988). But only the genes in deletion region AZFb (and possibly just one of these) produce detectable levels of protein. There is now substantial evidence supporting the importance of RBMY for spermatogenesis (Elliott, 2000).
It has been shown that there is an X chromosome homologue of RBMY, termed RBMX, which encodes the widely expressed protein hnRNPG. Whereas RBMY, RBM(Y chromosome), encodes a germ cell specific nuclear protein and evolves a male-specific function in spermatogenesis (Mazeyrat et al., 1999; Elliott, 2004). RBMX contains an N-terminal RNA recognition motif (RRM) with 88% similarity to RBMY, followed by only one serine–arginine–glycine–tyrosine (SRGY) box. There is also another retrogene called hnRNPG-T that belongs to the same family as RBMY and RBMX, which is also specifically expressed in testis. hnRNPG-T contains an N-terminal RRM with 84% similarity to mRBMY but no SRGY box (Elliott et al., 2000).
Both the sequence and distribution of RBMY protein are consistent with a function in nuclear RNA processing during spermatogenesis. It has an RNA-binding domain (RRM) and the SRGY domain, a 37-residue repeat of an SRGY or similar tetrapeptide twice in each repeat. This characteristic is similar to the SR proteins rich in SR/RS dipeptides (Birney et al., 1993), which are involved in constitutive and alternative splicing. As far as the distribution of RBMY protein is concerned, it is exclusively expressed in germline cells in the testis, where it is abundant in spermatogonia and spermatocytes (Elliott et al., 1998). In addition, protein interaction experiments have shown that RBMY interacts with Tra2β protein. Tra2β is a ubiquitous activator of pre-mRNA splicing and most highly expressed in testis, suggesting a role for RBMY in Tra2β-dependent splicing in spermatocytes (Venables et al., 2000).
Besides splicing regulators, RBMY also interacts with the STAR (Signal Transduction and RNA processing) proteins called SAM68 (Src associated in mitosis) and T-STAR. SAM68 is expressed widespreadly, whereas T-STAR is expressed mainly in the adult testis. Both proteins can bind to RNA through their KH domain and are implicated in cellular signaling pathways, pre-mRNA processing and cell cycle control (Venables et al., 1999). Detailed protein interaction experiments have been carried out to identify some proteins that interact with RBMY, but its RNA targets are still unclear. The current study was undertaken to explore the biological functions of RBMY during spermatogenesis by identification of the target mRNAs. The results showed that 12 mRNAs could be bound by mRBMY protein through specific nucleic acids associated with proteins (SNAAP) technique and immunoprecipitation experiments.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionFundingReferences |
|---|
Preparation of total testis extract
Testes were extracted from 3-week-old Balb/C mice, washed twice in phosphate-buffered saline (PBS) and placed into lysis buffer (100 mM NaCl, 10 mM MgCl2, 30 mM Tris–HCl, 1 mM dithiothreitol (DTT), protease inhibitor cocktail, 40 U/ml RNase OUT and 0.5% Triton X-100) (Maria et al., 2007). The tissue was diced with a razor blade followed by sonication. Insoluble matter was removed with a 5-min spin at 15 000 x g at 4°C and supernatant was collected.
Generation of glutathione S-transferase fusion proteins
The pGEX-mRBMY and pGEX-mNRBD plasmids, respectively, encoding the glutathione S-transferase (GST)-mRBMY and (GST)-mNRBD fusion proteins were constructed by placing the mRBMY coding region and mNRBDcoding region (without RNA-binding domain, amino acids 83–380) into the pGEX-5X-3 vector. The coding region was reverse transcribed and amplified from Balb/C mouse testes RNA with the following primers: pGEX-mRBMY primer, 5' CCCGGGAAATGGCAGAAACTAATCAGC 3' (SmaI site in italic) and 5' GCGGCCGCTTATATCTGCTTTCTCCACGAC 3' (Notl site in italic); pGEX-mNRBD primer, 5' GTCGAC CAAGCCAGGAGACCATCATCAC 3' (SalI site in italic) and 5' GCGGCCGC TTATATCTGCTTTCTCCACGACCT 3' (NotI site in italic). The GST-mRBMY and GST-mNRBD expression plasmids were confirmed by analysis of restriction digestion and DNA sequencing. GST, GST-mNRBD and GST-mRBMY were expressed in Escherichia coli BL21 cells, and extracts were prepared.
SNAAP screen
Jiao et al. (2002) have described the SNAAP screen technique. Briefly, after GST, GST-mRBD and GST-mRBMY proteins were bound to glutathione beads and unbound proteins removed by washing, the washed beads including the fusion proteins were incubated with 300 µg of total testis extract pre-cleared with 20 µl of glutathione Sepharose beads (GE Health care, Waukesha (suburb of Milwaukee), WI, USA). After binding at 4°C for 1 h, a wash was carried out with RNA-binding buffer RBB/0.25% Triton X-100 followed by a 10-min wash in RBB/0.25% Triton X-100 containing 1 mg/ml heparin. The beads were subsequently washed four times in RBB/0.25% Triton X-100 and bound RNA was then extracted by standard procedure. Co-purifying RNAs were identified by the differential display technique.
Detection of two mRbmy transcripts in the testis through RT–PCR with specific primers
Co-purifying RNAs were used as template to synthesize cDNA. We amplified two mRbmy transcripts by PCR with the following primers: mRbmy-1: forward primer: 5' ATCAAGAAAAGGCTACAACAAC 3', reverse primer: 5' TGGTCCAAATCTCCCAAATAT 3'; mRbmy-2: forward primer: 5' TAGAAAATCAAGAAAAGAAAAATGG 3', reverse primer: 5' AAGGAAAGCAAAGCCTCTAGAC 3'. Through sequence alignments, we found that in mRbmy-2 there was a lack of second exon of mRbmy-1, the two forward primers were designed to target the sequence which lied in the first exon and second exon.
Immunoprecipitation experiments
Testis soluble extracts were pre-cleared for 2 h on protein A-Sepharose beads (Sigma, St Louis, USA) in the presence of 2 µg rabbit IgGs, 0.05% BSA and 0.1 µg/ml yeast tRNA (Roche, Salt Lake City, Germany). After centrifugation for 1 min at 1000 x g, supernatants were incubated with 2 µg anti-mRBMY antibody (Santa Cruz Biotechnology, sc28728, CA, USA) or rabbit IgGs for 3 h at 4°C under constant rotation. Mouse RBMY antibody is a rabbit polyclonal antibody raised against amino acids 301–380 mapping at the C-terminus of mRBMY protein. Beads were washed three times with lysis buffer, and an aliquot was eluted in SDS sample buffer for western blotting analysis. The remaining beads were incubated with lysis buffer in the presence of (RNase-free) DNase (Takara, Dalian, China) for 15 min at 37°C and washed three times with lysis buffer before incubation with 50 µg proteinase K (Takara) for an additional 15 min at 37°C. Co-precipitated RNA was then extracted by standard procedure and used for RT–PCR using specific primers.
Western blotting analysis
Testis tissue extracts or immunoprecipitation proteins were diluted in SDS sample buffer and boiled for 6 min. Proteins were separated on 10% SDS–PAGE gels and transferred to PVDF-membrane (Roche, Germany). Rabbit anti-RBMY and IgGs (1:1000 dilution) were used (overnight at 4°C) as primary antibodies. Secondary anti-rabbit antibodies conjugated to horseradish peroxidase (ZSGB-BIO, Beijing, China) were incubated with membranes for 1 h at room temperature at 1:5000 dilution in PBS containing 0.1% Tween 20. Immunostained bands were detected by chemiluminescent method.
RNA extraction and semi-quantitative RT–PCR
Total RNA was extracted from Balb/C mouse testis aged between Days 1 and 14, and Weeks 3, 6 and 7 using Trizol reagent (Invitrogen, Commonwealth of Virginia, USA) according to the manufacturer’s instructions. Five micrograms of total RNA extracted from mouse testis was used as template to synthesize cDNA in 25 µl reaction mixture with 2.5 mM oligo d(T)16 primers and M-MLV Reverse Transcriptase (Takara) at 42°C for 1 h before heating to 70°C for 5 min. 100 ng cDNA was used as PCR template together with the specific primers.
The reaction products were visualized by electrophoresis of 5 µl reaction mixture at 120 V for 40 min in 2% agarose gel containing 0.5 µg/ml ethidium bromide and quantitated by densitometry using a dual-intensity transilluminator equipped with Gel-Pro Analyzer version 3.1. β-Actin was used as a positive internal control.
Electrophoretic mobility shift assay (EMSA)
Electromobility shift protocol was according to King (2000). RNA synthesis and labeling were performed according to SP6/T7 Transcription and DIG RNA Labeling Kit (Roche, Germany). The binding buffer for protein and RNA probe were buffer A (50 mM Tris–HCl, pH 7.0, 150 mM NaCl, 67 µg/µl yeast tRNA, 0.25 mg/ml bovine serum albumin and 1.5 µg/µl heparin) + 2% 2-mercaptoethanol. All RNAs used in our EMSAs were heat-treated at 90°C for 3 min, followed by rapid cooling on ice. Potential protein–RNA complexes were allowed to form at 37°C for 10 min. Following incubation, 2.5 µl of 6x loading buffer was added, and the samples were immediately loaded on to a 1% agarose gel in 1x TBE buffer. The gel was subjected to electrophoresis on ice until separation was achieved. The RNA was then electroblotted to a positively charged nylon membrane and subsequently cross-linked to the membrane by short-wave ultraviolet radiation. Detection of the RNA on the membrane was performed by washing the blot with a detergent solution, followed by a block solution. The membrane was then probed with anti-digoxigenin-AP conjugate to bind digoxigenin-labeled RNA. The blot was washed again, and substrate (CDP-Star) added to initiate the chemiluminescent reaction. The membrane was wrapped with a plastic wrap and then exposed to an X-ray film.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionFundingReferences |
|---|
Identification of mRBMY target mRNAs by SNAAP technique
Using the SNAAP technique, 15 target mRNAs bound by the fused protein GST- mRBMY were identified (Table I). Because target mRNAs of many RNA-binding proteins have not been identified and RNA-binding proteins may have similar target mRNAs, we did not use other RNA-binding proteins as control in our study. Instead, the GST and GST-mNRBD proteins acted as control proteins and gave no enrichment in any of these target mRNAs. The 15 target mRNAs can be divided into three classes according to their expression pattern. The first class is exclusively expressed in testis and plays important roles during spermatogenesis, e.g. Tcfl5 and Tex15. Tcfl5 is exclusively expressed in cell nuclei of primary spermatocytes at the pachytene stage and functions in a crucial role as a transcription factor by regulating cell proliferation or differentiation through binding to specific DNA sequence in spermatogenesis (Maruyama et al., 1998). The second class is expressed widely, but markedly highly in testis, for instance, Usp1 and Laptm4a. Usp1 encodes a ubiquitin-specific protease and may be a candidate for either the tumor-suppressive or the oncogenic activities (Tsutomu et al., 1998). Previous studies show that USP1 regulates the Fanconi Anemia pathway (Sebastian et al., 2005), but its function remains unclear during spermatogenesis and needs to further studied. The third class is also expressed widely, but expression level in testis is almost equal to that of other tissues. For example, Nek1, encoding a mammalian dual specificity protein kinase, is highly expressed in meiotic germ cells and may be related to cell cycle regulation. Interestingly, Nek1 is expressed to low levels in proliferating spermatogonia compared with meiotic spermatocytes, but precise explanation for this expression pattern remains unclear (Letwin et al., 1992; Eli et al., 1998).
|
The mRbmy pre-mRNA is alternatively spliced
Using a bioinformatic approach, we identified two alternatively spliced mRNAs that originate from the mRbmy pre-mRNA in mouse and that differ mainly in the 5'UTR (Fig. 1). We detected the presence of two mRbmy transcripts in mouse testis through RT–PCR using specifically designed primers targeting the sequence between the first and second exon (Fig. 2). So we concluded that both mRbmy-1 and mRbmy-2 mRNAs co-existed in mouse testis, and they differed mainly in the 5'UTR. Previous study showed that only a single band was detected for the mRBMY protein through western blot (Jungmin et al., 2004). Our results also show that a single band of
30 kDa in size is detected for the mRBMY protein with mouse testis through western blotting (Fig. 3A). Taken together, these data suggest that even if two transcripts of the mRbmy gene exist, a single mRBMY protein is produced. However, the biological function of the existence of the two mRbmy transcripts needs further study.
|
|
|
Mouse RBMY protein could bind to 12 endogenous transcripts in testis
Although some mRNA substrates were identified through SNAAP technique, the SNAAP technique has its own disadvantages and cannot reflect the natural interaction between protein and mRNAs. So we further confirmed whether mRBMY protein could bind to these mRNAs through immunoprecipitation experiments and RT–PCR analysis. Endogenous mRBMY was immunoprecipitated with an anti-mRBMY antibody from mouse testis tissue extracts (Fig. 3A) prepared under conditions that preserve RNA and ribonucleoproteins. RNA was extracted from immunoprecipitates and analyzed by RT–PCR with specific primers (Table II). Sltm transcript variant 1 and Sltm transcript variant 2 were, respectively, termed as Sltm-1 and Sltm-2. The result showed that mRBMY protein could bind to the endogenous Lin9, Nek1, Acbd6, Laptm4a, Spa17, Tcfl5, Tex15, Tssk2, Qser1, Usp1, mRbmy-2 and Sltm-2 mRNAs, but not to Tpx-1, Axl, Nbn, Slc25a1, Col9a3, mRbmy-1 and Sltm-1 mRNAs. Control immunoprecipitations with preimmune IgGs gave no enrichment in any of the mRNAs analyzed (Fig. 3B–D).
|
Semi-quantitative RT–PCR analysis on Lin9, Acbd6, Laptm4a, Qser1, Usp1, mRbmy and Sltm during testis development
Experiments have been carried out to show the mRNA expression patterns of Nek1, Spa17, Tcfl5, Tex15 and mRbmy in the developmental stages of mouse testis (Min et al., 1995; Eli et al., 1998; Maruyama et al., 1998; Jeremy et al., 2005; Sheba et al., 2005), but expression patterns of Lin9, Acbd6, Laptm4a, Qser1, Sltm and Usp1 have not been reported. In order to explore the expression profiles of these targets, semi-quantitative RT–PCR analysis was performed on total RNA from the testis in the neonatal period, during later development and in adults of various ages (Fig. 4). The result showed that all the targets were expressed throughout development. Expression levels of Lin9, Qser1, Usp1 and Sltm-1 seem to be almost identical from 1 day to 7 weeks of age. Laptm4a expression maintains a stable level from 1 day to 4 weeks of age but they appear to be reduced between 4 and 7 weeks of age. Expression patterns of mRbmy-1, mRbmy-2, Sltm-2 and Acbd6 RNA during testis development are similar. They are low in the early neonate, increasing gradually throughout postnatal development. The highest levels were seen about 4 weeks, and their levels appeared to be reduced between 4 and 7 weeks of age.
|
The mRNAs of spa17 can be bound by the mRBMY protein
Spa17 encodes a mammalian testis- and sperm-specific protein which may be associated with some phases of germinal cell differentiation (Min et al., 1995).Using EMSA, our results show that the mRBMY protein can bind to spa17 mRNAs, but the GST and GST-mNRBD proteins can not bind to (Fig. 5). We performed competitive binding assays through EMSA to further confirm that spa17 mRNA could be bound by the mRBMY protein (Fig. 6).
|
|
Identification of mRBMY protein binding domain in the spa17 mRNAs
The approaches employed above demonstrate that mRBMY protein can bind to spa17 mRNAs but do not provide information regarding the binding domain. The binding domain bound by mRBMY protein was further identified using smaller segments of spa17 mRNAs. The spa17 mRNAs was divided into seven small segments (Fig. 7A). The result shows that mRBMY-binding domain is in the 1–70 nt of spa17 mRNAs (Fig. 7B).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionFundingReferences |
|---|
Rbmy was the first of the candidate genes identified in AZF regions of the Y chromosome (Ma et al., 1993). Subnuclear localization of mRBMY shows that mRBMY is located in regions of pachytene nuclei in which it contains high concentrations of pre-mRNA splicing components (Elliott et al.,1998), and RBMY is interacted with splicing factors such as Tra2β and SR proteins (Venables et al., 2000). These fundings suggest that RBMY may be involved in pre-mRNA alternative splicing in testis. In the present study, we identified some target mRNAs of mRBMY. Among the targets, some are exclusively expressed in testis and have alternatively spliced transcripts. Mouse Rbmy pre-mRNA is alternatively spliced to generate two transcripts that differ mainly in the 5'UTR, and importantly, our result show that mRBMY protein can only bind to one transcript of its own, suggesting that mRBMY may affect alternative splicing or regulate expression of mRbmy-2. Besides, Sltm also has two transcripts, and they differ mainly in the inclusion of exon 1, 7 and 21. Exon 1 and 21, respectively, belong to 5'UTR and 5'UTR of Sltm mRNA. However, our results showed that mRBMY protein could only bind to Sltm-2. These show that mRBMY may affect alternative splicing of its own and Sltm.
Previous studies have shown that mRbmy gene was expressed in male germ cells in early developmental stages, from spermatogonia to early pachytene spermatocytes. So candidate genes downstream of mRbmy producing testis-specific transcripts at very early phase of germ cell development would be logical starting-points for analysis (Jungmin et al., 2004). Among our identified target mRNAs of mRBMY, semi-quantitative RT–PCR results show that most targets including mRbmy-2 begin to express from the neonatal period in testis. It further elucidates that some targets may be regulated by mRbmy gene.
Besides alternative splicing, various studies suggested a possible role for RBMY in the storage, metabolic stability or transport, of mRNA from the nucleus during spermatogenesis (Hecht, 1998). According to current studies, most targets have only one transcript among the targets of mRBMY, e.g. Tex15. Our result shows that mRBMY can bind to Tex15 which is an autosomal germ-cell-specific gene. At present, little is known about its function, experiments have been carried out to demonstrate whether Tex15 is subject to meiotic inactivation. Interestingly, Tex15 becomes repressed during meiosis, but shows post-meiotic reactivation (Jeremy et al., 2005). RBMY may be involved in this regulative process.
Using EMSA, we further demonstrated that mRBMY protein can bind to spa17 mRNAs, so mRBMY may affect the expression of spa17. The binding domain is in the 1–70 nt of spa17 mRNA and the sequence is rich in oligo(A); this suggests that mRBMY protein may have high affinity to oligo(A) rich sequence. Mouse RBMY is highly evolutionarily conserved as it is found on the Y chromosome of humans, mouse and marsupial (Elliott et al., 1996; Delbridge et al., 1997; Mahadevaiah et al., 1998). The mouse RBMY contains an RRM with 74% similarity to hRBMY, followed by only one SRGY box. So both proteins might have homologous mRNA targets. Further work is necessary to analyze whether these RNA targets are evolutionarily conserved in mammals and whether they are functionally relevant.
|
Funding |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionFundingReferences |
|---|
This work was supported by the grant of National Natural Science Foundation of China (No. 90408025, No. 30770812 and No. 30500186) and National High-Tech Research and Development Program of China (2007AA02Z127).
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionFundingReferences |
|---|
Birney E, Kumar S, Krainer AR. Analysis of the RNA-recognition motif and RS and RGG domains: conservation in metazoan pre-mRNA splicing factors. Nucleic Acids Res (1993) 21:5803–5816.
Chai NN, Zhou H, Hernandez J, Najmabadi H, Bhasin S, Yen PH. Structure and organization of the RBMY genes on the human Y chromosome: transposition and amplification of an ancestral autosomal hnRNPG gene. Genomics (1988) 49:283–289.[CrossRef]
Delbridge ML, Toder RO, Chandley AC, Graves JA. A human candidate spermatogenesis gene, RBM1, is conserved and amplified on the marsupial Y chromosome. Nat Genet (1997) 15:131–136.[CrossRef][Web of Science][Medline]
Eli A, Amiel Y, Gillar K, Alan B, Benny. NIMA-related kinases are expressed in patterns suggesting distinct functions in gametogenesis and a role in the nervous system. Oncogene (1998) 16:1813–1823.[CrossRef][Web of Science][Medline]
Elliott DJ. RBMY genes and AZFb deletions. J Endocrinol Invest (2000) 23:652–668.[Web of Science][Medline]
Elliott DJ. The role of potential splicing factors including RBMY, RBMX, hnRNPG-T and STAR proteins in spermatogenesis. Int J Androl (2004) 27:328–334.[CrossRef][Web of Science][Medline]
Elliott DJ, Ma K, Kerr SM, Thakrar R, Speed R, Chandley AC, Cooke H. An RBM homologue maps to the mouse Y chromosome and is expressed in germ cell. Hum Mol Genet (1996) 5:869–874.
Elliott DJ, Oghene K, Makarov G, Makarova O, Hargreave TB, Chandley AC, Eperon IC, Cooke HJ. Dynamic changes in the subnuclear organisation of pre-mRNA splicing proteins and RBM during human germ cell development. J Cell Sci (1998) 111:1255–1265.[Abstract]
Elliott DJ, Venables JP, Newton CS, Lawson D, Boyle S, Eperon IC, Cooke HJ. An evolutionarily conserved germ cell-specific hnRNP is encoded by a retrotransposed gene. Hum Mol Genet (2000) 9:2117–2124.
Hecht NB. Molecular mechanisms of male germ cell differentiation. BioEssays (1998) 20:555–561.[CrossRef][Web of Science][Medline]
Jeremy PW, David CP, John RM. Differential expression of sex-linked and autosomal germ-cell-specific genes during spermatogenesis in the mouse. Hum Mol Genet (2005) 19:2911–2918.
Jiao X, Triffilis P, Kiledjian M. Identification of target messenger RNA substrates for the murine deleted in azoospermia-like RNA-binding protein. Biol Reprod (2002) 66:475–485.
Jungmin L, Jinpyo H, Euisu K, Kyungjin K, Soo WK. Developmental stage-specific expression of Rbm suggests its involvement in early phase of spermatogenesis. Mol Hum Reprod (2004) 4:259–264.
King PH. RNA-binding analyses of Huc and HuD with the VEGF and c-myc 3-untranslated regions using a novel ELISA-based assay. Nucleic Acids Res (2000) 28:E20.[CrossRef][Medline]
Letwin K, Mizzen L, Motro B, Ben-David Y, Bernstein A, Pawson TA. Mammalian dual specificity protein kinase, Nek1, is related to the NIMA cell cycle regulator and highly expressed in meiotic germ cells. EMBO J (1992) 11:3521–3531.[Web of Science][Medline]
Ma K, Inglis JD, Sharkey A, Bickmore WA, Hill RE, Prosser EJ, Speed RM, Homson EJ, Jobling M, Taylor K. A Y chromosome gene family with RNA-binding protein homology: candidates for the azoospermia factor AZF controlling human spermatogenesis. Cell (1993) 75:1287–1295.[CrossRef][Web of Science][Medline]
Mahadevaiah SK, Odorisio T, Elliott DJ, Rattigan A, Szot M, Laval SH. Mouse homologues of the human AZF candidate gene RBM are expressed in spermatogonia and spermatids, and map to a Y chromosome deletion interval associated with a high incidence of sperm abnormalities. Hum Mol Genet (1998) 7:715–727.
Maria PP, Tilman A, Autumn M, Charles EC, Claudio S. The RNA-binding protein Sam68 modulates the alternative splicing of Bcl-x. J Cell Biol (2007) 7:929–939.
Maruyama O, Nishimori H, Kataqiri T, Miki Y, Ueno A, Nakamura Y. Cloning of TCFL5 encoding a novel human basic helix-loop-helix motif protein that is specifically expressed in primary spermatocytes at the pachytene stage. Cytogenet Cell Genet (1998) 82:41–45.[CrossRef][Web of Science][Medline]
Mazeyrat S, Saut N, Mattei MG, Mitchell MJ. RBMY evolved on the Y chromosome from a ubiquitously transcribed X-Y identical gene. Nat Genet (1999) 22:224–226.[CrossRef][Web of Science][Medline]
Min K, Richard TR, Esther EW, Michael GO. Sequence and Localization of the mouse sperm autoantigenic protein, Spa17. Biol Reprod (1995) 53:579–590.[Abstract]
Reijo R, Lee TY, Salo P, Alagappan R, Brown LG, Rosenberg M, Rozen S, Jaffe T, Straus D, Hovatta O. Diverse spermatogenic defects in humans caused by Y-chromosome deletions encompassing a novel RNA-binding protein gene. Nat Genet (1995) 10:383–393.[CrossRef][Web of Science][Medline]
Sebastian MB, Tony TH, Annette MGD, Thijn RB, Ron MK, Alan DD, René B. The deubiquitinating enzyme Usp1 regulates the Fanconi Anemia pathway. Mol Cell (2005) 17:331–339.[CrossRef][Web of Science][Medline]
Sheba J, Elliott DJ, Delyth M, Robert W, Carol R. Molecular markers for the assessment of postnatal male germ cell development in the mouse. Hum Reprod (2005) 1:108–116.
Tsutomu F, Akihiko S, Mikio S, Hiroichi S, Toshiaki S, Ei-ichi T, Akira T, Arata I, Chin HC, Yusuke N, et al. Identification and chromosomal assignment of Usp1, a novel gene encoding a human ubiquitin-specific protease. Genomics (1998) 54:155–158.[CrossRef][Web of Science][Medline]
Venables JP, Vernet C, Chew SL, Ellioott DJ, Cowmeadow RB, Wu J, Cooke HJ, Artzt K, Eperon IC. T-STAR/ETOILE: a novel relative of SAM68 that interacts with an RNA-binding protein implicated in spermatogenesis. Hum Mol Genet (1999) 8:959–969.
Venables JP, Elliott DJ, Makarova OV, Makarov EM, Cooke HJ, Eperon IC. RBMY, a probable human spermatogenesis factor, and other hnRNP G proteins interact with Tra2beta and affect splicing. Hum Mol Genet (2000) 9:685–694.
Submitted on December 18, 2007; resubmitted on April 4, 2008; accepted on May 2, 2008.
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||