Mol. Hum. Reprod. Advance Access originally published online on May 8, 2008
Molecular Human Reproduction 2008 14(6):347-355; doi:10.1093/molehr/gan025
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Differential expression of the embryo/cancer gene ECSA(DPPA2), the cancer/testis gene BORIS and the pluripotency structural gene OCT4, in human preimplantation development
1 Molecular Embryology Unit, Institute of Child Health, 30 Guilford Street, London WC1N 1EH, UK 2Integrated Cancer Research Group, St Vincent’s Faculty of Medicine, University of New South Wales, 384 Victoria Street, Darlinghurst, NSW 2010, Australia 3 Monash Institute for Medical Research, Monash University, 3rd Floor, STRIP Building 75, Clayton, 3800 VIC, Australia
4 Correspondence address. E-mail: mmonk{at}ich.ucl.ac.uk
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionFundingAcknowledgementsReferences |
|---|
In this paper, we examine the expression profiles of two new putative pluripotent stem cell genes, the embryo/cancer sequence A gene (ECSA) and the cancer/testis gene Brother Of the Regulator of Imprinted Sites (BORIS), in human oocytes, preimplantation embryos, primordial germ cells (PGCs) and embryo stem (ES) cells. Their expression profiles are compared with that of the well-known pluripotency gene, OCT4, using a primer design that avoids amplification of the multiple OCT4 pseudogenes. As expected, OCT4 is high in human oocytes, down-regulated in early cleavage stages and then expressed de novo in human blastocysts and PGCs. BORIS and ECSA show distinct profiles of expression in that BORIS is predominantly expressed in the early stages of preimplantation development, in oocytes and 4-cell embryos, whereas ECSA is predominantly expressed in the later stages, blastocysts and PGCs. BORIS is not detected in blastocysts, PGCs or other fetal and adult somatic tissue tested. Thus, BORIS and ECSA may be involved in two different aspects of reprogramming in development, viz., in late gametogenesis, and at the time of formation of the ES cells (inner cell mass (ICM) and PGC), respectively. However, in human ES cells, where a deprogrammed stem cell state is stably established in culture, an immunofluoresence study shows that all three genes are co-expressed at the protein level. Thus, following their derivation from ICM cells, ES cells may undergo further transformation in culture to express a number of embryo and germ line stem cell functions, which, in normal development, show different temporal and spatial specificity of expression.
Key words: BORIS/OCT4/ECSA(DPPA2)/human embryo/human ES cells
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionFundingAcknowledgementsReferences |
|---|
During preimplantation embryo and germ line development, epigenetic modifications, such as CpG methylation and other DNA and chromatin modifications, are reprogrammed on a genome wide level. This leads to the formation of the pluripotent undifferentiated embryonic stem cells of the inner cell mass (ICM) and the primordial germ cells (PGCs) capable of giving rise to all cells of the individual and, independently, of indefinite growth in vitro and the formation of tumours in vivo (Evans and Kaufman, 1981; Matsui et al., 1992). An erasure of epigenetic information was first shown as a global loss of CpG methylation from the sperm and oocyte genomes during preimplantation development and extending into the PGCs and was termed ‘deprogramming’ (Monk et al., 1987; Monk, 1990). Later, demethylation deprogramming was also shown at the level of loss of methylation, and activation, of specific gene sequences (Grant et al., 1992; Kafri et al., 1992; Hajkova et al., 2002; Szabó et al., 2002). Today, the term ‘reprogramming’ is widely used in the field to include erasure of prior epigenetic programmes and the establishment of the new epigenetic programmes of the pluripotent stem cell and of the derivative somatic lineages and germ line in the developing fetus. However, it could be argued that deprogramming (removal of pre-existing programmes governing differentiated cell function, e.g. erasure of spermatogenesis and oogenesis programmes in preimplantation embryos) and reprogramming (establishment of new programmes, e.g. of the pluripotent cell or its differentiated derivatives) will involve different processes governed by different genes. Deprogramming events may occur at a number of stages in development, e.g. in preimplantation embryos (Monk et al., 1987), in PGCs (Grant et al., 1992; Hajkova et al., 2002; Szabó et al., 2002), at female meiosis when X chromosome reactivation occurs (Monk, 1981; Monk and McLaren, 1981), and in preleptotene spermatocytes as they migrate across the blood testis barrier (Yan and Cheng, 2005). Different genes may be involved in the processes of deprogramming at different stages and in the maintenance of those programmes.
Cancer cells share many properties with embryonic and germ line stages of development. Global demethylation also occurs in precancerous somatic cells (Gama-Sosa et al., 1983; Goelz et al., 1985; Feinberg et al., 1988) suggesting a deprogramming event in the origin of cancer stem cells, which show an expression signature similar to that of embryonic stem (ES) cells (Schlesinger et al., 2007). Demethylation and activation of the cancer/germ line (CG) oncogenes, MAGE, GAGE and BAGE (De Smet et al., 1996), and numerous other CG genes (Koslowski et al., 2004) occur as a consequence of global demethylation in human tumour cells, as well as in human preimplantation embryos (De Plaen et al., 1999; Fulka et al., 2004), or following transfection into globally demethylated mouse ES cells (Loriot et al., 2008). Many cancers are associated with reactivation of embryonic and germ cell genes, e.g. the so-called cancer/testis (CT) genes or CG genes (Old, 2001; Scanlan et al., 2002; Koslowski et al., 2004).
One such CT gene of considerable recent interest is BORIS (Brother Of the Regulator of Imprinted Sites, Loukinov et al., 2002; Klenova et al., 2002). BORIS is a paralogue of CTCF, a multivalent 11-zinc finger protein with numerous roles in gene regulation mediating multiple sequence-specific interactions between DNA-bound CTCF molecules to form chromatin boundaries (reviewed in Ohlsson et al., 2001). Among these roles, CTCF interprets the allele-specific methylation marks that feature in genomic imprinting and X-inactivation in somatic cells (reviewed in Loukinov et al., 2002). BORIS shares the same 11-zinc finger domain but differs significantly in the amino and carboxy termini. Until now, BORIS was thought to be expressed only in primary spermatocytes where it is suggested to have a role in reprogramming of the male germ line. The expression of BORIS within the testis during male germ cell development is mutually exclusive to CTCF (Loukinov et al., 2002). Since the two paralogues have the ability to bind the same DNA sequence motifs via their zinc-finger domains, but are divergent at their termini and their expression is non-overlapping, the two proteins are likely to perform distinct functions at common DNA sites.
The other gene of interest here is the embryo/cancer sequence A gene, ECSA. Based on the hypothesis that there may be signals and functions associated with the initiation, and/or progress of deprogramming, and/or maintenance of the undifferentiated proliferative stem cell state, common to both embryogenesis and cancer, we isolated several new genes specifically expressed in human preimplantation embryos and PGCs and showed that they are also be expressed in cancer (Monk and Holding, 2001). One of these genes, ECSA, was also subsequently identified in the mouse by a bioinformatics approach and named Dppa2 (Bortvin et al., 2003; Maldonado-Saldivia et al., 2006). This gene is reported to have a DNA binding motif, SAP, and therefore a potential role in chromatin configuration and regulation of transcription (Aravind and Koonin, 2000). ECSA is expressed in a range of cancers including lung, liver, colon cancer and lymphoma (Monk and Holding, 2001; Monk et al., unpublished work; John et al., 2008).
In this paper, we examine the real-time PCR expression profiles in human early development of the embryo/cancer gene, ECSA, and the testis deprogramming gene BORIS, compared with the expression of the well-known pluripotency gene, OCT4 (Scholer et al., 1989; Rosner et al., 1990; Abdel-Rahman et al., 1995; Adjaye et al., 1999; Goto et al., 1999; Hansis et al., 2000; Niwa et al., 2000). Since we and others (Suo et al., 2005; Cantz et al., 2008; Liedtke et al., 2007) have suspected that multiple OCT4 pseudogenes may give false positive expression results, we design and use primers for OCT4 that detect only the original structural gene. Our results show that unlike OCT4, which is expressed throughout preimplantation development, BORIS and ECSA are predominantly expressed at early and late stages of preimplantation development, respectively, consistent with different roles in reprogramming in embryogenesis. Expression of ECSA, BORIS, OCT4 and NANOG (Chambers et al., 2003; Mitsui et al., 2003) at the protein level is also studied by fluorescence staining in human cultured ES cells. Both BORIS and ECSA are co-expressed at the protein level along with OCT4 and NANOG, implicating onset of BORIS expression with this further transformation from the in vivo embryonic stem cell to the stably proliferative stem cell state in vitro.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionFundingAcknowledgementsReferences |
|---|
cDNAs
The methods for cDNA preparation, from messenger RNA extracted from individual oocytes and embryos, PGCs and somatic tissues, are fully described in Holding et al. (2000) and Goto et al. (1999) as well as the origin and ethical approvals for the use of human oocytes and embryos and fetal tissues. The cDNAs used for this work are the same cDNAs that have been used in the earlier work and in the differential display isolation of the embryo/cancer genes in Monk and Holding (2001).
PCR primers
OCT4: 5'GAAGGTATTCAGCCAAAC3' and 5'CTTAATCCAAAAACCCTGG3'—These are pseudogene-free primers designed and verified in this work (see Results section).
BORIS: 5'TTCCGACAGAAGCAACTTCT3' and 5'CACGCCTTCATCCACTTCCT3'—Primers for the amplification of the BORIS cDNA are designed to the C-terminus of the protein (in a region also studied recently by Renaud et al., 2007) which differs from the CTCF sequence to rule out any possibility of cross-amplification. Another set of primers for BORIS—5'CTCACTTCAGGAAATACCACG3' and 5'CACTTATCCATCGTGTTGAGG3'—gave similar results. There are no pseudogenes for BORIS probably because it is not expressed in the later stages of preimplantation development and PGCs (when there is a lot of reverse transcriptase), and pseudogenes not formed so as to be heritable.
ECSA: 5'ATGACAGTAGAGAAGTAGCA3' and 5'CACTAGTCAACCATCTTCAC3' (Monk and Holding, 2001). There are two pseudogenes of ECSA and three other fragments of the gene with some homology (Monk and Holding, 2001). However, the primers used are specific for the true structural gene on chromosome 3q13 and there is no conflicting evidence for ECSA expression in somatic tissues as there is for OCT4.
GAPDH: 5'AGCCACATCGCTCAGACAC3' and 5'GAGGCATTGCTGATGATCTTG3'. These are the pseudogene-free primers of Lehmann et al. (2002).
Traditional PCR
PCR amplification is performed in 20 µl reactions using 1 µM each primer, 100 µM each dNTP, 1.5 mM MgCl2 in 1x AmpliTaq PCR buffer with 0.1 µl AmpliTaq enzyme, and 75 ng genomic DNA template or 2 µl amplified cDNA preparation. Amplifications are carried out with a hot start at 95°C for 5 min followed by 35 cycles of denaturation at 95°C for 1 min, annealing at given temperatures for 45 s and extension at 72°C for 1 min, with a final extension of 5 min at 72°C. A 10 µl aliquot of each PCR product is electrophoresed on a 1% agarose gel.
Real-time PCR
PCR products of each of the test transcripts and housekeeping GAPDH control cDNA are cloned in pGEMT-EASY and inserts confirmed by sequence analysis. Plasmid DNA is prepared, quantitated and serially diluted to serve as quantification standards in the real-time PCR analyses. The standard curve consists of eight points of 10-fold serial dilutions from 1 fg to 10 ng of each plasmid. Real-time PCR analyses are performed in 20 µl reactions. Each reaction mix contains 0.5 µM each primer, 1x SYBR Green reaction mix and 2 µl amplified cDNA preparation. Cycling is performed on an Opticon REAL-time machine and analysed using Opticon MONITOR Analysis software. Cycling conditions are 15 min at 95°C for enzyme activation, followed by 35 cycles of 95°C for 1 min, annealing for 45 s and extension at 72°C for 45 s, with a plate read following each cycle. OCT4 and BORIS primers are annealed at 59°C, and ECSA primers are annealed at 55°C. Amplification of GAPDH is performed alongside each test gene as a housekeeping control using pseudogene-free primers, with annealing at 59 or 55°C accordingly (Lehmann et al., 2002). A melt curve from 65 to 95°C is performed at the end of the reaction with temperature increases of 0.3°C held for 1 s to ensure product homogeneity.
Samples of cDNA from individual oocytes and embryos, PGCs and somatic tissues are subjected to real-time PCR using the reaction conditions described above. Each DNA sample is analysed for each gene in triplicate and results expressed as the mean + 1SD. A selection of amplification products is additionally electrophoresed on agarose gels to confirm that they are of the correct size (data not shown). The level of the expression of each gene in each cDNA sample is determined by reference to the relevant standard curve at the crossing point of the cycle threshold. In order to normalize for cDNA input, the relative level of expression of each test gene is determined as a ratio of test gene to GAPDH for each sample.
Immunofluorescence
Human ES cell lines, HES2 and HES4 (http://www.escellinternational.org) are cultured on mouse embryonic fibroblasts at two densities either in medium supplemented with 20% fetal calf serum (FCS; JRH Biosciences, KS, USA) or 20% Knock-out Serum replacement (Invitrogen, Australia) and fibroblast growth factor (bFGF) (4 ng/ml; R&D systems, Minneapolis, USA) as previously described (Amit et al., 2000; Reubinoff et al., 2000). ES cells are fixed in cold methanol for 10 min, air-dried, then incubated in a blocking buffer (1% goat serum in PBS) for 1 h at room temperature. Fixed cells are incubated with antibodies to BORIS (0.5 µg/ml; Novus Biologicals) and ECSA (1:200; Proteintech www.ptglab.com; Jonathan Cebon, Ludwig Institute for Cancer Research, Austin Health, Melbourne) overnight at 4°C, and NANOG (0.5 µg/ml, eBiosciences, San Diego, USA) and OCT4 (4 µg/ml; Santa Cruz Biotechnology; Santa Cruz, USA) for 1 h at room temperature. All primary antibodies are diluted in the blocking buffer (1% goat serum in PBS) after which cells are washed three times with PBS, and incubated for 1 h at room temperature with secondary antibodies. The secondary antibodies are all Alexaflour conjugated antibodies (Invitrogen, Molecular Probes, Australia) diluted 1:1000 in blocking buffer. The stained cells are washed three times with PBS, immersed in Vectorshield (Vector Laboratories, Burlingame, USA) and visualized on an Olympus inverted fluorescence microscope (Olympus BX51). Nuclei are counter-stained with DAPI (5 µg ml–1; Sigma–Aldrich, Australia).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionFundingAcknowledgementsReferences |
|---|
We hypothesized that if BORIS is associated with reprogramming in the primary spermatocytes in the testis (Loukinov et al., 2002), then BORIS might also be expressed at the time of initiation or progress of the major deprogramming in early preimplantation development. Previously, we identified ECSA as a shared function associated with the undifferentiated stem cell state in embryogenesis and cancer and we expect ECSA to show expression in the ICM of the blastocyst and in the PGCs (Monk and Holding, 2001). The patterns of expression of OCT4, BORIS and ECSA in the development are studied here by quantitative real-time PCR and immunofluorescence and compared with the expression of the pluripotent gene OCT4. However, early experiments indicated that there was a potential problem with the generally used primers for OCT4 in that they simultaneously detected a number of OCT4 pseudogenes. Therefore, in the first instance, the OCT4 pseudogenes and their sequences were identified in order to derive new primers and PCR parameters to detect only the product of the OCT4 structural gene.
Design and verification of OCT4 pseudogene-free primers for expression analyses
The human OCT4 structural gene on Chr6p21 encodes two mRNA isoforms, originally named OCT3A and OCT3B (Takeda et al., 1992), with differing amino termini due to alternative splicing. Several OCT4-related sequences demonstrating strong sequence homology to the original OCT4 (OCT3A) structural gene transcript also exist which, in the event of genomic DNA contamination of cDNA samples or transcription of pseudogenes, can complicate the analysis of expression of the genuine gene. Previously published primer sequences match more than one pseudogene sequence in addition to the OCT4 structural gene cDNA and so have the potential to co-amplify the pseudogenes. Using the BLAT Search Genome tool of the UCSC Genome Bioinformatics site (http://genome.ucsc.edu/cgi-bin/hgBlat), we verified the existence of at least five pseudogene sequences with 90–97% sequence identity to the OCT3A isoform (Fig. 1A). In order to design ‘pseudogene-free’ primers to avoid co-amplification of any related sequence, the OCT3A cDNA is aligned to its three most closely related pseudogene sequences and primers are designed within the segments of OCT4 exons 2 and 4 that differ most significantly from each of the pseudogenes (Fig. 1B). To assess the specificity for the amplification of the genuine OCT4 transcript, the primers are tested by PCR amplification of cDNAs from undifferentiated P19 embryonal carcinoma (EC) cells and genomic DNA at annealing temperatures ranging from 56 to 63°C. Strong amplification of the correct 655 bp product is detected in the EC cDNAs, in the absence of the 1.2 kb product from genomic templates, using annealing temperatures above 58.2°C (Fig. 1C). Direct sequence analysis of the EC cDNA amplification product following annealing at 59°C, as well as individual clones of the PCR product inserted in the plasmid pGEM-T Easy vector, verifies that the cDNA sequence is derived from the genuine OCT4 structural gene transcript. Fluorescent real-time PCR amplification of EC cDNAs followed by a melt curve shows a smooth melt curve with a consistent melting temperature of 85°C for the OCT4 product indicative of homogeneous amplification.
|
1.2 kb, product in genomic DNA contains introns 2 and 3.Comparative quantitative expression of OCT4, BORIS and ECSA in human preimplantation development
As in the past (Holding et al., 2000; Monk and Holding, 2001; Salpekar et al., 2001), we apply the strategy of investigating specific gene expression in cDNAs from a number of individual human oocytes and embryos rather than from pooled samples. The levels of mRNA for any particular gene sequence are inherently variable in human early embryos for several reasons. First, human embryos show very variable rates of development (some may be defective and dying despite ‘normal’ morphology). In addition, maternally inherited mRNA is degrading and embryo-coded mRNA is increasing during early development and these processes are not synchronous embryo to embryo, or even blastomere to blastomere. However, we have found that unequivocal results can be achieved by looking at sufficient numbers of individual embryos at each stage separately and this approach has the advantage of seeing the embryo to embryo variability directly.
It should also be noted that the measurement of expression ratios (expression of specific embryonic gene sequences against a standard gene expression) to control for variation in sample concentration or experimental variation is complicated in preimplantation embryos due to the variable expression of the standard gene (in our experiments, GAPDH) itself. This is because the transcription levels of all genes are varying as maternal mRNA is degraded and embryonic gene expression begins. Sometimes at mid cleavage stages there is no mRNA for a specific gene detected. Nevertheless, it is essential to express the results as a ratio of embryonic gene expression to standard gene expression to eliminate experimental error and sample size variation in these tiny single oocyte or single embryo samples. Examination of the actual values of each gene sequence (reflecting actual mRNA levels), as well as the ratios of embryonic gene expression to GAPDH gene expression, confirms that the results expressed as a ratio for each individual oocyte or embryo reflect the actual profile of expression of the embryonic gene (data not shown). We have eliminated all samples with undetectable GAPDH, even though these samples may have been valid, as we could not show the embryonic gene expression as a ratio in these cases.
Fig. 2A–C shows the ratios of the expression of OCT4, BORIS and ECSA to GAPDH determined by quantitative real-time PCR in cDNAs prepared from testis and ovary, and in amplified cDNA from several samples of human single oocytes and single preimplantation embryos at different stages up to the blastocyst stage. The figure also shows expression in cDNAs from male and female PGCs from 10 week human fetuses (samples are those prepared and described in Goto et al., 1999). Human fetal brain, muscle and gut cDNAs are also included to represent ectoderm, mesoderm and endoderm derived somatic tissues (samples are those prepared and described in Monk and Holding, 2001).
|
OCT4 expression
The overall pattern of OCT4 expression (expressed as a ratio of OCT4 to GAPDH) detected using the newly designed structural-gene-specific primers is shown in Fig. 2A. The expression profile is similar to that previously reported in human oocytes and embryos by ourselves and others (Abdel-Rahman et al., 1995; Adjaye et al., 1999; Hansis et al., 2000; Goto et al., 2002). OCT4 is detected in human oocytes then down regulated during early cleavage stages and expressed de novo in late cleavage stages, blastocysts and in the PGCs. In addition, OCT4 is detected in the ovary and in the testis where expression is restricted to developing germ cells. Using the pseudogene-free primers as described above, OCT4 is either not detected, or is present only in very low levels, in placenta and the somatic fetal tissues examined (representing ectoderm-derived (brain), mesoderm-derived (muscle) and endoderm-derived (gut) tissues (Fig. 2A).
BORIS expression
The expression of BORIS has previously been reported to be restricted to the spermatocytes within the adult testis (Loukinov et al., 2002). Expression has not previously been detected in ovary or other adult somatic tissues. Our results for BORIS expression are shown in Fig. 2B. As expected, we detect strong levels of the expression of BORIS in adult testis. There is also detectable expression in ovary. More strikingly, we detected the BORIS transcript in all four oocytes studied followed by down-regulation of expression in early cleavage stage embryos. In contrast to OCT4, no expression is detected subsequent to this, either in the blastocysts or in the PGCs. Also BORIS expression is not detectable in any other fetal and adult somatic tissue tested.
ECSA expression
Unlike OCT4 and BORIS, the expression of ECSA (Fig. 2C) is barely detectable in ovulated oocytes, but like OCT4, this gene shows onset of expression in late cleavage stage embryos and it is expressed at the blastocyst stage and in PGCs. Like OCT4, ECSA is also detectably expressed in testis presumably due to content of primitive germ cells. Subsequent to the report on the isolation of the novel embryo/cancer gene, ECSA (Monk and Holding, 2001), we have shown it to be expressed in colon, lung, liver and endometrial cancers, and lymphoma (Monk et al., unpublished work, John et al., 2008).
Both BORIS and ECSA are expressed in human ES cells
Having shown that BORIS and ECSA are predominantly expressed early and late (respectively) in preimplantation development, we expected only ECSA to be expressed in ES cells. We investigate expression at the protein level and localization of BORIS and ESCA in human ES cells, compared with the expression of OCT4 and NANOG, both key regulators of maintenance of pluripotency (Hay et al., 2004; Hart et al., 2004; Matin et al., 2004; Hyslop et al., 2005). Surprisingly, both BORIS and ESCA are expressed together within the nucleus of human ES cells and co-localize with OCT4 (Fig. 3C and K) and NANOG (Fig. 3G and O). Nuclear localization of BORIS has also been reported in teratocarcinoma cells by Hoffmann et al. (2006). BORIS localization appears to have a more punctate staining pattern within the nucleus (Fig. 3M), compared with ESCA which is more evenly distributed. Some evidence of hierarchy of expression is also detected, in that some human ES cells express BORIS without OCT4 and NANOG (note the areas of green staining of BORIS in the superimposed images in Fig. 3K and O).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionFundingAcknowledgementsReferences |
|---|
We are interested in the isolation and identification of genes involved in the initiation, progress and maintenance of genomic deprogramming to the proliferative stem cell state in human embryogenesis and cancer. Recently, several papers have reported that stem cells and cancer cells share a common subpopulation of genes, which repress differentiation, marked (and silenced) by heterochromatic modifications and methylation, respectively (Ohm et al., 2007; Schlesinger et al., 2007; Widschwendter et al., 2007). Although these observations have been interpreted to mean that cancer stem cells arise directly from pre-existing stem cells in the body, no causal relationship has been shown and it is possible that cancer stem cells also arise by deprogramming of more differentiated progenitor cells to the stem cell phenotype and hence retain some of the differentiated phenotype characteristic of their tissue of origin (Krivtsov et al., 2006). Previously, there has been much interest in the common expression of genes in the germ cells of the testis and cancer cells—the CT genes (Scanlan et al., 2002). It may be that some of these functions relate to carry-over of embryonic gene expression as well as to the more primitive germ cell which is still present in the testis.
Based on the hypothesis, that certain deprogramming and dedifferentiation events, and genetic programmes associated with the formation and maintenance of the stem cell state, may be common to embryogenesis and neoplastic transformation, we isolated several genes expressed only in human preimplantation development, and in PGCs, and tested for their expression in cancers (Monk and Holding, 2001). One of the new embryo/cancer genes, ECSA, is further investigated here along with another newly identified CT gene associated with reprogramming, BORIS. The expression of BORIS and ECSA in human preimplantation development and in PGCs is compared with the expression of OCT4, and the expression of their protein products in established cultured ES cells in comparison with OCT4 and NANOG.
We use newly designed primers for the OCT4 structural gene to avoid amplification of the multiple OCT4 pseudogenes (see also Suo et al., 2005; Liedtke et al., 2007) which may yield false positive results with this important marker of pluripotency. For example, previously, we have shown the expression of OCT4 in cancer cell lines (Monk and Holding, 2001) although subsequently we did not find expression in fresh tumour tissue samples (Monk et al., unpublished work). It is probable that cell lines may not be representative of cancer in vivo and, also, certain cancers may express some OCT4 pseudogenes, which would be amplified with the primers used previously. Indeed, several EST sequences corresponding to OCT4 pseudogene sequences may be found on the database (see Fig. 1). Consequently, data reporting OCT4 expression in somatic cells, or tissue-specific stem cells, and non-germ cell tumours need re-evaluation. Additionally, it is important to re-examine OCT4 expression in development using the pseudogene-free primers.
In line with previous reports, we find expression of the OCT4 structural gene in human ovary and ovulated oocytes, a decrease of expression in preimplantation cleavage stages and de novo expression in blastocysts and PGCs. The presence of OCT4 mRNA in oocytes followed by down-regulation in cleavage stages is generally agreed to be due to the presence and degradation of pre-existing maternal mRNAs in the unfertilized oocyte although there is no rigorous formal proof that this is the case. Evidence for the time of onset of embryo-coded transcription of this gene would require human embryos heterozygous for a polymorphism in the OCT4 gene and demonstration of paternal mRNA expression.
We confirm BORIS expression in testis. In addition, we show here for the first time that BORIS is also expressed in human oocytes and that oocyte BORIS mRNA is rapidly degraded in cleavage stage embryos. As for OCT4, we cannot say whether the expression of BORIS in oocytes is carryover of maternal mRNA or a brief burst of embryo-coded expression followed by mRNA degradation. We also detected the low-level BORIS expression in the ovary and it is possible that BORIS might have a function in meiosis during oogenesis, as well as in primary spermatocytes during spermatogenesis. Although BORIS is not detectably expressed by human blastocysts, ES cells, normally derived from the ICM of the blastocyst, do express BORIS. BORIS protein co-localizes with OCT4 and NANOG proteins in the nucleus of the majority of ES cells although it continues to be expressed by some of the ES cells in the culture that have lost the expression of these two genes. This might suggest a slower down-regulation of the BORIS expression in differentiating ES cells. BORIS protein displays a punctate staining pattern within ES cell nuclei, similar to that described in teratocarcinoma cells (Hoffmann et al., 2006). Nuclear localization of BORIS has also been observed in primary spermatocytes, compared with cytoplasmic expression in spermatogonia and Leydig cells (Loukinov et al., 2002; Hoffmann et al., 2006). Vatolin et al. (2005) have reported that BORIS is expressed in many cancers and, in this respect, BORIS is considered to be a CT gene. In addition, the expression of other CT genes, NY-ESO1 and MAGEA1 are correlated with, and induced by, expression of BORIS (Hong et al., 2005; Vatolin et al., 2005). Competition between BORIS and CTCF may contribute to the deregulation of CT genes.
A comparison of the expression of ECSA with OCT4 and BORIS shows a third and different profile of expression in human preimplantation development. In contrast to OCT4 and BORIS, ECSA expression is relatively very low in the ovulated oocyte but, similarly to OCT4, ECSA shows onset of embryo-coded expression at later cleavage stages, expression in blastocysts and PGCs. The mouse homologue to ECSA, Dppa2, is also expressed at earlier cleavage stages and in germinal vesicle GV oocytes (Bortvin et al., 2003; Maldonado-Saldivia et al., 2006). However, in human, the predominant expression of this gene occurs from late cleavage into the blastocyst stage and continues in PGCs, and we suggest that it may play a role in an aspect of epigenetic programming associated with the emergence and/or maintenance of the potentially immortal embryonic stem cell. Thus, ECSA is expressed at the time when the embryonic cells approach their ground state of undifferentiated totipotent cells (the ICM and the PGC) capable of indefinite growth when isolated in vitro. Consequently, ECSA protein is present in the nucleus of human cultured ES cells along with OCT4 and NANOG proteins.
ECSA has a shared function in embryos and cancers and is expressed in 25% of the cancers tested, and notably in lung, liver and colon cancers (Monk and Holding, 2001; John et al., 2008). This indicates that some function in embryogenesis specifically confined to this stage of the emergence and/or maintenance of the embryonic stem cell is commonly involved in the cancer stem cell phenotype. Interestingly, ECSA-positive lung cancers show expression in a minority of cells in the cancer and a high co-expression of other CT genes, although immunohistochemistry shows the expression of the CT genes studied so far (NY-ESO1, MAGE-A3 and MAGE-C1) extending further into other cells in the cancer (John et al., 2008). This suggests that ECSA may play a dominant role in the hierarchy of genes activated to form a cancer stem cell and its derivative cells in the tumour.
The molecular functions of BORIS and ECSA, as well as for OCT4 and NANOG, are still to be clarified. In the mouse, the DPPA2 protein is also located in the nucleus of pluripotent cells and the developing germ line (Maldonado-Saldivia et al., 2006) and the gene has binding sites for POU domain and SOX proteins thus implicating this gene in the regulatory pathways maintaining the pluripotent stem cell. The SAP domain of the ECSA/DPPA2 protein implies a role in chromatin organization and RNA processing (Aravind and Koonin, 2000). DPPA2 is related to a closely linked gene, DPPA4, on human chromosome 3. Using RNA interference studies in the mouse, Ivanova et al. (2006) have shown that Dppa4, like Oct4, Nanog and Sox2, is required for self renewal and expression of alkaline phosphatase. Similar experiments, not currently possible in human embryos, are needed to directly determine whether down-regulation of ECSA would inhibit formation or maintenance of ICM cells and, in human cultured cells, whether up-regulation of ECSA would enhance or maintain the undifferentiated stem cell state and also be oncogenic and transform somatic cells. The precise function of BORIS is also unknown; as BORIS protein binds to the same sites as CTCF it must be involved with a reorganization of chromatin boundaries and its expression in primary spermatocytes suggests a role in reprogramming of male germ cells in the testis (Loukinov et al., 2002). At this stage, it is clear that ECSA and BORIS are shared functions in embryogenesis and cancer but whether the shared function is one of deprogramming of the genome to the undifferentiated and immortal stem cell state or the maintenance of that state is not known.
In contrast to ECSA and BORIS, although increased OCT4 expression is associated with germ cell tumours (Gidekel et al., 2003; Looijenga et al., 2003), OCT4 expression is not elevated in somatic cell cancers (Gidekel et al., 2003; Looijenga et al., 2003) nor in somatic stem cells (Lengner et al., 2007). Previous reports of OCT4 expression in somatic cell cancers and stem cells (Jin et al., 1999; Monk and Holding, 2001; Ezeh et al., 2005; Tai et al., 2005; also see references cited in Hochedlinger et al., 2007) may be due to use of cell lines, or the expression of an OCT4 pseudogene (Suo et al., 2005). However, artificially induced expression of OCT4 may induce tumour formation in somatic cells (Gidekel et al., 2003; Hochedlinger et al., 2007). The fact that OCT4 rarely functions as an oncogene in vivo may be due to specific mechanisms of OCT4 repression in somatic cells laid down in development (Gidekel and Bergman, 2002; Feldman et al., 2006),
Although it appears that ECSA and BORIS show different spatial and temporal specificity and may play different roles in normal development, both genes become active, along with OCT4 and NANOG, in the ES cells. The ES cells differ from ICM cells in that they can be propagated indefinitely through loss of embryo differentiation cues and an adaptation to in vitro culture (Baker et al., 2007). The co-expression in the human cultured ES cells of the protein products of all four genes tested by fluorescence staining (BORIS, ECSA, OCT4 and NANOG) suggests that the establishment of the proliferative stem cell state in culture may involve further changes to the embryonic stem cell in vitro. Thus, to acquire the ability to self-renew indefinitely, human (ES), ICM and PGC cells may undergo an additional reprogramming event, facilitated by BORIS. It is noteworthy that, in lung cancer cells, BORIS and ECSA are often co-expressed; over 70% of lung tumours expressing ECSA also express BORIS (John et al., 2008).
ECSA is our first well-studied embryo/cancer sequence. Other embryo/cancer sequences, such as ECSE, also reported in Monk and Holding (2001) are currently under investigation. We suggest that embryo/cancer sequences be distinguished from CT antigens (Old, 2001) for the time being. We predict that some CT antigens themselves will prove to be, and better understood as embryonic antigens concerned with deprogramming in development and carried over with the mitotic germ cells into the testis. Ultimately, further work will clarify whether ECSA, or any of the other embryo/cancer genes we have isolated, will serve as a useful cancer antigen.
|
Funding |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionFundingAcknowledgementsReferences |
|---|
This work is supported by the BBSRC.
|
Acknowledgements |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionFundingAcknowledgementsReferences |
|---|
We thank James Diss and Mark Stevens for their assistance with real-time PCR and Cathy Holding for continuing discussion and her critical reading of the manuscript.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionFundingAcknowledgementsReferences |
|---|
Abdel-Rahman B, Fiddler M, Rappolee D, Pergament E. Expression of transcription regulating genes in human preimplantation embryos. Hum Reprod (1995) 10:2787–2792.
Adjaye J, Bolton V, Monk M. Developmental expression of specific genes detected in high-quality cDNA libraries from single human embryos. Gene (1999) 237:373–383.[CrossRef][Web of Science][Medline]
Amit M, Carpenter MK, Inokuma MS, Chiu CP, Harris CP, Waknitz MA, Itskovitz-Eldor J, Thomson JA. Clonally derived human embryonic stem cell lines maintain pluripotency and proliferative potential for prolonged periods of culture. Dev Biol (2000) 227:271–278.[CrossRef][Web of Science][Medline]
Aravind L, Koonin EV. SAP – a putative DNA-binding motif involved in chromosomal organisation. Trends Biochem Sci (2000) 25:112–114.[CrossRef][Web of Science][Medline]
Baker DEC, Harrison NJ, Maltby E, Smith K, Moore HD, Shaw PJ, Heath PR, Holden H, Andrews PW. Adaptation to culture of human embryonic stem cells and oncogenesis in vivo. Nat Biotechnol (2007) 25:207–215.[CrossRef][Web of Science][Medline]
Bortvin A, Eggan K, Skaletsky H, Akutsu H, Berry DL, Yanagimachi R, Page DC, Jaenisch R. Incomplete reactivation of OCT4-related genes in mouse embryos cloned from somatic nuclei. Development (2003) 130:1673–1680.
Cantz T, Key G, Bleidissel M, Gentile L, Han DW, Brenne A, Schöler HR. Absence of OCT4 expression in somatic tumor cell lines. Stem Cells (2008) 26:692–697.
Chambers I, Colby D, Robertson M, Nichols J, Lee S, Tweedie S, Smith A. Functional expression cloning of Nanog, a pluripotency gene sustaining factor in embryonic stem cells. Cell (2003) 113:643–655.[CrossRef][Web of Science][Medline]
De Plaen E, De Backer O, Arnaud D, Bonjean B, Chomez P, Martelange V, Avner P, Baldacci P, Babinet C, Hwang SY, et al. A new family of mouse genes homologous to the human MAGE genes. Genomics (1999) 55:176–184.[CrossRef][Web of Science][Medline]
De Smet C, De Backer O, Faraoni I, Lurquin C, Brasseur F, Boon T. The activation of human gene MAGE-1 in tumor cells is correlated with genome-wide demethylation. Proc Natl Acad Sci USA (1996) 93:7149–7153.
Evans M, Kaufman MH. Establishment in culture of pluripotential cells from mouse embryos. Nature (Lond) (1981) 292:154–155.[CrossRef][Medline]
Ezeh UI, Turek PJ, Reijo RA, Clark AT. Human embryonic stem cell genes OCT4, NANOG, STELLAR, and GDF3 are expressed in both seminoma and breast carcinoma. Cancer (2005) 104:2255–2265.[CrossRef][Web of Science][Medline]
Feinberg AP, Gehrke CW, Kuo KC, Ehrlich M. Reduced genomic 5-methylcytosine content in human colonic neoplasia. Cancer Res (1988) 48:1159–1161.
Feldman N, Gerson A, Fang J, Li E, Zhang Y, Shinkai Y, Cedar H, Bergman Y. G9a-mediated irreversible epigenetic inactivation of Oct-3/4 during early embryogenesis. Nat Cell Biol (2006) 8:188–194.[CrossRef][Web of Science][Medline]
Fulka H, Mrazek M, Tepla O, Fulka J Jr. DNA methylation pattern in human zygotes and developing embryos. Reproduction (2004) 128:703–708.
Gama-Sosa MA, Slagel VA, Trewyn RW, Oxenhandler R, Kuo KC, Gehrke CW, Ehrlich M. The 5-methylcytosine content of DNA from human tumors. Nucleic Acids Res (1983) 11:6883–6894.
Gidekel S, Bergman Y. A unique developmental pattern of Oct-3/4 DNA methylation is controlled by a cis-demodification element. J Biol Chem (2002) 277:34521–34530.
Gidekel S, Pizov G, Bergman Y, Pikarsky E. Oct-3/4 is a dose-dependent oncogenic fate determinant. Cancer Cell (2003) 4:361–370.[CrossRef][Web of Science][Medline]
Goelz SE, Vogelstein BM, Hamilton SP, Feinberg AP. Hypomethylation of DNA from benign and malignant human colon neoplasms. Science (1985) 228:187–190.
Goto T, Adjaye JA, Rodeck C, Monk M. Identification of genes expressed in human primordial germ cells at the time of entry of the female germ line into meiosis. Mol Hum Reprod (1999) 5:851–860.
Goto T, Jones GM, Lolatgis N, Pera M, Trounson AO, Monk M. Identification and characterisation of known and novel transcripts expressed during the final stages of human oocyte maturation. Mol Reprod Dev (2002) 62:13–28.[CrossRef][Web of Science][Medline]
Grant M, Zuccotti M, Monk M. Methylation of CpG sites of two X-linked genes coincides with X-inactivation in the female mouse embryos but not in the germ line. Nat Genet (1992) 2:161–166.[CrossRef][Web of Science][Medline]
Hajkova P, Erhardt S, Lane N, Haaf T, El-Maarri O, Reik W, Walter J, Surani MA. Epigenetic reprogramming in mouse primordial germ cells. Mech Dev (2002) 117:15–23.[CrossRef][Web of Science][Medline]
Hansis C, Grifo JA, Krey LC. Oct-4 expression in inner cell mass and trophectoderm of human blastocysts. Mol Hum Reprod (2000) 6:999–1004.
Hart AH, Hartley L, Ibrahim M, Robb L. Identification, cloning and expression analysis of the pluripotency promoting nanog genes in mouse and human. Dev Dynamics (2004) 230:187–198.[CrossRef][Web of Science][Medline]
Hay D, Sutherland L, Clark J. Oct4 knockdown induces similar patterns of endoderm and trophoblast differentiation markers in human and mouse embryonic stem cells. Stem Cells (2004) 22:225–235.
Hochedlinger K, Yasuhiro Y, Beard C, Jaenisch R. Ectopic expression of OCT4 blocks progenitor-cell differentiation and causes dyslasia in epithelial tissues. Cell (2007) 121:465–477.
Hoffmann MJ, Muller M, Engers R, Schulz WA. Epigenetic control of CTCFL/BORIS and OCT4 expression in urogenital malignancies. Biochem Pharmacol (2006) 72:1577–1588.[CrossRef][Web of Science][Medline]
Holding C, Bolton V, Monk M. Detection of human novel developmental genes in cDNA derived from replicate individual preimplantation embryos. Mol Hum Reprod (2000) 6:801–809.
Hong JA, Kang Y, Abdullaev Z, Flanagan PT, Pack SD, Fischette MR, Adnani MT, Loukinov DI, Vatolin S, Risinger JI, et al. Reciprocal binding of CTFC and BORIS to the NY-ESO-1 promoter coincides with depression of this cancer-testis gene in lung cancer cells. Cancer Res (2005) 65:7751–7762.
Hyslop L, Stojkovic M, Armstrong L, Walter T, Stojkovic P, Przyborski S, Herbert M, Murdoch A, Strachan T, Lako M. Downregulation of NANOG induces differentiation of human embryonic stem cells to extraembryonic lineages. Stem Cells (2005) 23:1035–1043.
Ivanova N, Dobrin R, Lu R, Kotenko I, Levorse J, DeCoste C, Schafer X, Lun Y, Lemischka IR. Dissecting self-renewal in stem cells with RNA interference. Nature (2006) 442:533–538.[CrossRef][Medline]
Jin T, Branch DR, Zhang X, Qi S, Youngson B, Goss PE. Examination of POU homeobox gene expression in human breast cancer cells. Int J Cancer (1999) 81:104–112.[CrossRef][Web of Science][Medline]
John T, Caballero OL, Svobodová SJ, Kong A, Chua R, Browning J, Fortunato S, Gedye CA, Davis ID, Altorki N, et al. ECSA/DPPA2 is an embryo-cancer antigen that is co-expressed with cancer-testis antigens in Non-Small-Cell Lung Cancer. Clin Canc Res (2008) 14:3291–3298.
Kafri T, Ariel M, Brandeis M, Shemer R, Urven L, McCarrey J, Cedar H, Razin A. Developmental pattern of gene-specific DNA methylation in the mouse embryo and germ line. Genes Dev (1992) 6:705–714.
Klenova EM, Morse HC III, Ohlsson R, Lobanenkov VV. The novel BORIS+CTCF gene family is uniquely involved in the epigenetics of normal biology and cancer. Cancer Biol (2002) 12:399–414.[CrossRef]
Koslowski M, Bell C, Seitz G, Lehr HA, Roemer K, Müntefering H, Huber C, Sahin U, Türeci O. Frequent nonrandom activation of germ-line genes in human cancer. Cancer Res (2004) 64:5988–5993.
Krivtsov AV, Twomey D, Feng Z, Stubbs MC, Wang Y, Faber J, Levine JE, Wang J, Hahn WC Gilliland DG, Golub TR, et al. Transformation from committed progenitor to leukaemia stem cell initiated by MLL-AF9. Nature (2006) 442:754–755.[CrossRef][Medline]
Lehmann MH, Weber J, Gastmann O, Sigush HH. Pseudogene-free amplification of human GAPDH cDNA. Biotechniques (2002) 33:766–770.[Web of Science][Medline]
Lengner CJ, Camargo FD, Hochedlinger K, Welstead GG, Zaidi S, Gokhale S, Scholer HR, Tomilin A, Jaenisch R. Oct4 expression is not required for mouse somatic stem cell self-renewal. Cell Stem Cell (2007) 1:403–415.[CrossRef][Web of Science][Medline]
Liedtke S, Enczmann J, Waclawcyzk S, Wernet P, Kogler G. Oct4 an its pseudognes confuse stem cell research. Cell Stem Cell (2007) 4:364–366.
Looijenga LH, Stoop H, de Leeuw HP, de Gouveia Brazao CA, Gillis AJ, van Roozendaal KE, van Zoelen EJ, Weber RF, Wolffenbuttel KP, van Dekken H, et al. POU5F1 (OCT3/4) identifies cells with pluripotent potential in human germ cell tumors. Cancer Res (2003) 63:2244–2250.
Loriot A, Sterpin C, De Backer O, De Smet C. Mouse embryonic stem cells induce targeted DNA demethylation within human MAGE-A1 transgenes. Epigenetics (2008) 3:38–42.[Web of Science][Medline]
Loukinov DI, Pugacheva E, Vatolin S, Pack SD, Moon H, Chernukhin I, Mannan P, Larsson E, Kanduri C, Vostrov AA, et al. BORIS, a novel male germ-line-specific protein associated with epigenetic reprogramming events, shares the same 11-zinc-finger domain with CTCF, the insulator protein involved in reading imprinting marks in the soma. Proc Natl Acad Sci USA (2002) 99:6806–6811.
Maldonado-Saldivia J, van den Bergen J, Krouskos M, Gilchrist M, Sinclair AH, Surani A, Western PS. Dppa2 and Dppa4 are closely linked SAP motif genes restricted to pluripotent cells and the germ line. Stem Cells Express (2006) 25:19–28.
Matin MM, Walsh JR, Gokhale PJ. Specific knockdown of Oct4 and β2-microglobulin expression by RNA interference in human embryonic stem cells and embryonic carcinoma cells. Stem Cells (2004) 22:659–668.
Matsui Y, Zsebo K, Hogan BLM. Derivation of pluripotential embryonic stem cells from murine primordial germ cells in culture. Cell (1992) 70:841–847.[CrossRef][Web of Science][Medline]
Mitsui K, Tokuzawa Y, Itoh H, Segawa K, Murakami M, Takahashi K, Maruyama M, Maeda M, Yamanaka S. The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell (2003) 113:631–642.[CrossRef][Web of Science][Medline]
Monk M. A stem line model for cellular and chromosomal differentiation in early mouse development. Differentiation (1981) 19:71–76.[CrossRef][Web of Science][Medline]
Monk M. Changes in DNA methylation during mouse embryonic development in relation to X-chromosome activity and imprinting. In: DNA Methylation and Gene Regulation.—Holliday R, Monk M, Pugh J, eds. (1990) 326:299–312. Phil Trans R Soc. Lond b326.
Monk M, Holding C. Human embryonic genes expressed in cancer cells. Oncogene (2001) 2:8085–8091.
Monk M, McLaren A. Random X-chromosome inactivation in female primordial germ cells in the mouse. J Embryo exp Morph (1981) 63:75–84.[Web of Science][Medline]
Monk M, Boubelik M, Lehnert S. Temporal and regional changes in DNA methylation in the embryonic, extraembryonic and germ cell lineages during mouse embryo development. Development (1987) 99:371–382.[Abstract]
Niwa H, Miyazaki J, Smith A. Quantitative expression of Oct3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nature (2000) 24:372–376.
Ohlsson R, Renkawitz R, Lobabebkov V. CTCF is a uniquely versatile transcription regulator linked to epigenetics and disease. Trends Genet (2001) 17:520–527.[CrossRef][Web of Science][Medline]
Ohm JE, McGarvey KM, Yu X, Cheng L, Schuebel KE, Cope L, Mohammad WC, Daniel VC, Yu W, Berman DM, et al. A stem cell-like chromatin pattern may predispose tumor suppressor genes to DNA hypermethylation and heritable silencing. Nat Genet (2007) 39:237–242.[CrossRef][Web of Science][Medline]
Old LJ. Cancer/testis antigens – a new link between gametogenesis and cancer. Cancer Immun (2001) 1:1–7.[Medline]
Renaud S, Pugacheva EM, Delgardo MD, Braunschweig R, Abdullaev Z, Loukinov D, Benhattar J, Lonanenkov V. Expression of the CTCF-paralogous cancer-testis gene, brother of the regulator of imprinted sites (BORIS), is regulated by three alternative promoters modulated by CpG methylation and by CTCF and p53 transcription factors. Nucl Acids Res (2007) 35:7372–7388.
Reubinoff BE, Pera MF, Fong CY, Trounson A, Bongso A. Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nat Biotechnol (2000) 18:399–404.[CrossRef][Web of Science][Medline]
Rosner MH, Vigano MA, Ozato K, Timmons PM, Poirier F, Rigby PW, Staudt LM. A POU-domain transcription factor in early stem cells and germ cells of the mammalian embryo. Nature (1990) 345:686–692.[CrossRef][Medline]
Salpekar A, Huntriss J, Bolton V, Monk M. The use of amplified cDNA to monitor the expression profiles of seven imprinted genes in human oocytes and preimplantation embryos. Mol Hum Reprod (2001) 7:101–106.
Scanlan MJ, Gure AO, Jungbluth AA, Old LJ, Chen YT. Cancer/testis antigens: an expanding family of targets for cancer immunotherapy. Immunol Rev (2002) 188:22–32.[CrossRef][Web of Science][Medline]
Schlesinger Y, Straussman R, Keshet I, Farkash S, Hecht M, Zimmerman J, Eden E, Yakhini Z, Ben-Shushan E, Reubinoff BE, et al. Polycomb-mediated methylation on Lys27 of histone H3 pre-marks genes for de novo methylation in cancer. Nat Genet (2007) 39:232–236.[CrossRef][Web of Science][Medline]
Scholer HR, Hatzopoulos AK, Balling R, Suzuki N, Gruss P. A family of octamer-specific proteins present during mouse embryogenesis: evidence for germline-specific expression of an Oct factor. EMBO J (1989) 8:2543–2550.[Web of Science][Medline]
Suo G, Han J, Wang X, et al. Oct4 pseudogenes are transcribed in cancers. Biochem Biophys Res Commun (2005) 337:1047–1051.[CrossRef][Web of Science][Medline]
Szabó PE, Hübner K, Schöler H, Mann JR. Allele-specific expression of imprinted genes in mouse migratory primordial germ cells. Mech Dev (2002) 115:157–160.[CrossRef][Web of Science][Medline]
Tai MH, Chang CC, Kiupel M, Webster JD, Olson LK, Trosko JE. Oct4 expression in adult human stem cells: evidence in support of the stem cell theory of carcinogenesis. Carcinogenesis (2005) 26:495–502.
Takeda J, Susumu S, Bell GI. Human Oct3 gene family: cDNA sequences, alternative splicing, gene organization, chromosomal location, and expression at low levels in adult tissues. Nucl Acids Res (1992) 20:4613–4620.
Vatolin S, Abdullaev Z, Pack SD, Flanagan PT, Custer M, Loukinov DI, Pugacheva E, Hong JA, Morse H 3rd, Schrump DS, et al. Conditional expression of the CTCF-paralogous transcriptional factor BORIS in normal cells results in demethylation and derepression of MAGE-A1 and reactivation of other cancer-testis genes. Cancer Res (2005) 65:7751–7762.
Widschwendter M, Fiegl H, Egle D, Mueller-Holzner E, Spizzo G, Marth C, Weisenberger DJ, Campan M, Young J, Jacobs I, et al. Epigenetic stem cell signature in cancer. Nat Genet (2007) 39:157–158.[CrossRef][Web of Science][Medline]
Yan HHN, Cheng CY. Blood barrier dynamics are regulated by an engagement/disengagement mechanism between tight and adherens junctions via peripheral adaptors. Proc Natl Acad Sci (2005) 102:11722–11727.
Submitted on January 2, 2008; resubmitted on April 23, 2008; accepted on May 2, 2008.
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||