Molecular Human Reproduction, Vol. 5, No. 3, 199-205,
March 1999
© 1999 European Society of Human Reproduction and Embryology
Novel transcripts of carbonic anhydrase II in mouse and human testis
Laboratori de Genètica Molecular, Institut d'Investigacions Biomèdiques August Pi i Sunyer, Facultat de Medicina, Universitat de Barcelona, Casanova 143, 08036 Barcelona, Spain.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Intracellular and extracellular sources of bicarbonate are essential for sperm motility, sperm binding to the zona pellucida and the acrosome reaction. Carbonic anhydrase II, catalysing the synthesis of bicarbonate within spermatozoa, must play a significant role in these mechanisms. We report here the expression of carbonic anhydrase II during mouse spermatogenesis and the primary structure of testicular transcripts coding for carbonic anhydrase II isolated from adult mouse and human testes. The mouse carbonic anhydrase II (Car2) mRNA displays a 5' untranslated region (UTR) larger than the corresponding somatic sequence. The additional 5' sequence contains the `TATA box' used in somatic tissues and other promoter sequences, suggesting the use of testis-specific promoters further upstream with read-through of downstream promoters. The 3'UTR of the Car2 mRNA is shorter in mature testicular cells than in somatic cells. Polysomal gradient analysis of carbonic anhydrase II transcripts isolated from adult mouse testis and kidney revealed different translation potential: most of the testicular transcripts were present in the non-polysomal fractions, whereas a considerable fraction of kidney transcripts were polysome-associated. These results suggest that specific transcriptional and post-transcriptional mechanisms regulate the expression of carbonic anhydrase II during mammalian spermatogenesis.
polysomes/spermatogenesis/TATA box/5' untranslated mRNA
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Carbonic anhydrases (CA; EC 4.2.1.1.) are a class of zinc metalloenzymes that catalyse the reversible hydration of carbon dioxide. CA have many different physiological functions and seven distinct isozymes have been characterized in mammals (Hewett-Emmett and Tashian, 1991
, 1996). Carbonic anhydrase II is abundant in spermatozoa (Parkkila and Kaunisto, 1991) and its presence is probably linked to the maintenance of an adequate intraspermatozoal bicarbonate concentration necessary for the control of sperm motility and the acrosome reaction (Tajima et al., 1987; Brook et al., 1996; Aitken et al., 1998). A significant positive correlation has been found between carbonic anhydrase activity in fowl testes and semen production (Harris and Goto, 1984).
We have previously reported that a testis specific transcript of carbonic anhydrase II is highly expressed in adult chicken testis, while it was not detectable in prepuberal testis (Mezquita et al., 1994). The main objectives of the present work were: (i) to characterize carbonic anhydrase II (Car2) transcripts isolated from mouse and human testis (CA2); (ii) to study the expression of Car2 during mouse spermatogenesis; (iii) to investigate a possible mechanism for the TATA-less directed initiation of Car2; and (iv) to find a potential correlation between the structure of Car2 the 5' untranslated region (UTR) and the polysomal distribution of the transcripts.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Rapid amplification of cDNA ends (RACE)
To amplify the 5' region of the mouse testis cDNA, the target primers from the coding region GCCGGTCTCCATTGGCAATG and CTCAACGTTAAAGGAGTGGC and the AmpliFinder anchor primer (Clontech, Palo Alto, CA, USA) were used. For the 3' region, we used the target primers AACTGGCGTCCAGCTCAGCCGCT and GATGTCTCATTTCCGTACGC, and the Not d(T)18 bifunctional primer (Pharmacia, Uppsala, Sweden). The conditions were as recommended in the 5'-AmpliFINDER RACE method from Clontech. Briefly, 2 µg of poly(A) RNA were reverse transcribed with AMV reverse transcriptase, then RNA was hydrolysed with 6 N NaOH and the cDNA purified with Geno-bind (Clontech, Palo Alto, CA, USA) and ethanol precipitated. The AmpliFINDER anchor was ligated with T4 RNA ligase, the reaction diluted 1:10 and used for polymerase chain reaction (PCR) amplification.
PCR conditions were: 3 min at 94°C; 30 cycles of 1 min at 94°C, 1 min at 60°C and 3 min at 72°C; 7 min at 72°C. The PCR reaction contained 0.8 µM of each primer, 200 µM of each dNTP, 1.5 mM Mg2+ and 2.5 IU of High Fidelity Polymerase (Boehringer, Mannheim, Germany). For characterization of the human 5' end, first strand cDNA was obtained from Clontech (Marathon-ready cDNA from the testis of Caucasian males aged 22–31 years). A primer complementary to the anchor sequence at the 5' end of the cDNA (Clontech, AP2) and a specific primer (MWG Biotech Synthesis Laboratories, Ebersberg, Germany) (GGTCGGGGCAGG GCAGGAATCG) were used for 5' RACE analysis.
Sequencing and cloning
Direct sequencing was done after Exonuclease l/Shrimp Alkaline Phosphatase treatment of the mouse Car2 RACE product, by the sequenase dideoxy method (USB-Amersham, Buckinghamshire, UK). Sequences were also obtained from recombinant clones, after ligation of the PCR products to the vector PGEM-T. Several clones were analysed to confirm the sequence. To sequence the 5' human CA2 cDNA, the 5' RACE product was polished with Pfu DNA polymerase, then ligated to pCR-Script SK+ (Stratagene, La Jolla, CA, USA), and used to electroporate JM109 Escherichia coli cells. Human CA2 sequences were obtained with the Licor MWG Biotech GmbH automatic sequencer, using the Thermo Sequenase cocktail from Amersham, the vector's forward and reverse primers labelled with IRD41, and a cycle sequencing programme.
Polysomal gradients
Fractionation of post-mitochondrial extracts over sucrose gradients was performed as previously described (Kleene et al., 1984) with certain modifications to minimize the extreme instability of the kidney Car2 mRNA. The tissue, 250–1500 mg, was homogenized at 4°C in 1–6 ml of buffer containing 100 mM KCl, 10 mM MgCl2, 20 mM HEPES pH 7.5, 1 mg/ml heparin, 0.2 µl/ml diethyl pyrocarbonate and 90 µg/ml cycloheximide with 10 strokes of a Dounce homogenizer. The homogenate was centrifuged (5000 g) for 5 min at 4°C and the supernatant was centrifuged again (12 000 g) for 10 min at 4°C in the presence of Triton N101 0.5% v/v. The final supernatant (1 ml), with or without EDTA (100 mM), was layered onto a 8 ml 15–40% linear sucrose gradient containing 100 mM KCl, 1 mM MgCl2, 20 mM HEPES pH 7.5, 1 mg/ml heparin and 0.2 µl/ml diethyl pyrocarbonate and then centrifuged for 110 min at 4°C in a Beckman SW40 rotor at 36 000 rpm. EDTA dissociates the polysomes and shifts the mRNA towards the top of the gradient, confirming proper resolution of polysomal and non-polysomal mRNA in the sucrose gradient. Six fractions of 1.5 ml were collected and precipitated with ethanol overnight at –20°C.
RNA isolation and analysis
Total RNA from mouse (strain C57BL/6NHsd) kidneys and testes (12, 18, 24-day-old and adult) was prepared by the RNA Isolator (Genosys Biotechnologies, Cambridge, UK) and the Quickprep mRNA purification method from Pharmacia. Gradient fraction pellets were also extracted by a guanidine thiocyanate method (TriPure, Boehringer). Samples of total RNA (20 µg) or 50–66.6% of each sucrose gradient fraction, were electrophoresed in 1.6% agarose/2 M formaldehyde gels and transferred to positively charged nylon membranes (Schleicher and Shuell, Keene, NH, USA). Blots were baked, prehybridized and hybridized using stringent conditions, with a non-radioactive digoxigenin-labelled specific probe prepared from the coding region. A chemiluminiscence-based detection procedure was used, following the manufacturer's conditions, as well as the protocol described in Engler-Blum et al. (1993). Mice deficient in p53 (TSG-p53 `p53–/–') were obtained from GenPharm International (Bommice, Denmark). The Car2 probe, nonradioactively labelled, was prepared from the coding region using an upstream (GGATACAGCAAGCACAACGG) and a downstream (CTCAACGTTAAAGGAGTGGC) primer. The mouse testis-specific lactate dehydrogenase (LDH-C) probe was a 41-mer oligonucleotide (GGTGGACATGTTGAGCCTTACTGCTGACTCCGCAGCACAGG) labelled at the 5' end with digoxigenin. This probe is complementary to nucleotides 23–63 of LDH-C mRNA (Sakai et al., 1987).
Western blot analysis
Mature spermatozoa were obtained by dissection of the epididymis. The tissue was cut into small fragments with scissors and spermatozoa were dispersed by gently pipetting with minimum essential medium (Life Technologies, Inchinnan, UK). After removing tissue fragments by passage through sterile gauze, spermatozoa were centrifuged for 15 min at 500 g at room temperature. Cell purity was determined by phase contrast microscopy. Decapsulated testis and spermatozoa were homogenized in 400 µl of 60 mM Tris–HCl (pH 6.8), 2% sodium dodecyl sulphate (SDS), 1%-mercaptoethanol, and 0.5% Bromophenol Blue. Homogenates were clarified by centrifugation at 12 000 rpm for 15 min. Protein concentrations were determined by the Bicinchoninic Acid-Protein Assay (BCA-Protein; Pierce, Rockford, IL, USA). Total protein from each sample (20 µg) was loaded onto 14% SDS–polyacrylamide gels. After electrophoresis, proteins were transferred to polyvinyldifluoride membranes (Millipore, Bedford, MA, USA). Membranes were incubated with primary antibodies, a 1:1000 dilution of sheep anti-human carbonic anhydrase II cross-reacting with mouse carbonic anhydrase II (The Binding Site, Birmingham, UK), followed by peroxidase-labelled anti-sheep secondary antibodies, and detected according to the directions of the manufacturer (enhanced chemiluminiscence; Amersham, Arlington Heights, IL, USA).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Characterization of novel carbonic anhydrase II transcripts from adult mouse and human testes
Mouse carbonic anhydrase II (Car2) mRNA isolated from adult testis has a 5'UTR that contains a leader sequence of 239 nucleotides, beyond that present in Car2 mRNA from kidney somatic cells (Figure 1
). Alternative transcription initiation sites were found in different testis clones (Figure 1). The additional 5'UTR sequence contains the `TATA box', a putative CCAAT box (CCACT), three tandem-repeat elements located 15 pairs upstream from the CCAAT box, G+C-rich boxes and similar sequences to those found in the 5' region of the human carbonic anhydrase II gene that have been reported as important for regulation of transcription (Venta et al., 1985; Shapiro et al., 1987; Marino, 1993). Computer analysis shows a prediction of a possible secondary structure (Figure 2). The lengthened 5'UTR sequence may allow the formation of hairpin structures absent in the shorter 5'UTR initiated from a downstream start site in somatic cells. Formation of these potential hairpin structures could hinder translation of the Car2 mRNA during mouse spermatogenesis.
|
|
To know whether the alternative initiation of transcription, with read-through of downstream promoters, such as TATA-box, was also a characteristic of carbonic anhydrase II transcripts from adult human testis, we have sequenced the 5'UTR of carbonic anhydrase II isolated from a human adult testis cDNA library. The 5'UTR of the human carbonic anhydrase II expressed in adult testis also contains a `TATA box' and a G+C-rich sequence (Figure 3
). These sequences, present in mouse and human carbonic anhydrase II transcripts, are very well conserved in the 5' region of human, rat (McGowan et al., 1997), mouse and chicken carbonic anhydrase II genes (Mezquita et al., 1994). The homology for the anhydrase II gene in the 5' region between the mouse and rat, human and chicken is 93% (279/300), 89% (75/84) and 95% (23/24) respectively. Considering just the 24 nucleotides containing the TATA box (Figure 3), the homology is 100% for mouse, rat and human, and 95% for chicken.
|
Since it has been reported that testis-specific mRNAs with extended 5'UTR are translationally less active (Yiu et al., 1994
; Gu et al., 1995) we have determined the relative translational utilisation of the Car2 mRNA isolated from mouse adult testis and kidney. Post-mitochondrial extracts were fractionated by sucrose gradient sedimentation, and purified RNAs were hybridized to Car2 specific probe prepared from the coding region. The majority of the 1.3 kb Car2 transcripts from adult testis, containing the leader sequence at the 5'UTR, was present in the non-polysomal fraction (Figure 4, lanes 2, 3), whereas a substantial amount of the 1.7 kb Car2 transcripts from kidney, without the leader sequence at the 5'UTR, was present in the polysomal fraction (Figure 4, lanes 5, 6). This observation suggests that the testis specific carbonic anhydrase II transcripts with extended 5'UTR are translationally less active than the corresponding somatic forms.
|
Several testis-specific transcripts with extended 5'UTR, e.g. carbonic anhydrase II, use alternative promoters to `TATA box' (Mezquita et al., 1993
, 1994, 1997, 1998). The mechanism that inhibits the `TATA box' directed initiation and selects an alternative promoter is unknown at present. A number of TATA-containing promoters are repressed by the tumour suppressor protein p53 (Mack et al., 1993) while TATA-less promoters are generally believed to be refractive to p53 repression. To determine the possible involvement of this protein, abundantly expressed during spermatogenesis (Almon et al., 1993), in the mechanism that represses the TATA-directed initiation of transcription in mature testes, we have studied the expression of Car2 in p53-deficient mice. No qualitative changes were observed in the Car2 transcripts expressed in mature testes of p53 deficient mice. The electrophoretic mobility of the Car2 mRNA (Figure 5) and the sequences of the 5'UTR and 3'UTR of the Car2 mRNA were unchanged in p53 deficient mice. These results indicate that the p53 protein is not involved or it is not the only protein involved in the repression of the TATA-directed initiation observed in mature testes.
|
Testis-specific carbonic anhydrase II transcripts, in addition to lengthened 5'UTR, also display shorter 3'UTR than the corresponding somatic transcripts. The 3'UTR of Car2 mRNA expressed in mouse kidney is 685 bp long. The polyadenylation sequence AATAAA is at position 668–673 (Figure 1
). AT-rich sequences (Shaw and Kamen, 1986) are present at positions 325 to 332, 480 to 486, and 517 to 522. The 3'UTR of Car2 mRNA expressed in adult mouse testes are 33 and 158 bp long. An alternative polyadenylation signal, AAGTAAA, is at position 1–7 (Figure 1). This polyadenylation signal has been described as having 30% of the efficiency of the canonical polyadenylation signal AATAAA (Wickens, 1990). The shorter 3'UTR of the Car2 mRNA expressed in mature testes does not contain AT-rich sequences.
Expression of Car2 during spermatogenesis
We have compared the expression of Car2 mRNA in adult mouse testis and kidney (Figure 6). Northern blot analysis reveals that a 1.3 kb Car2 mRNA is abundantly expressed in mature mouse testes, while a lower amount of a 1.7 kb Car2 (the main band) was detected in mouse kidney. The sizes determined by Northern analysis are in good agreement with the number of nucleotides obtained by sequencing. We have also determined the temporal appearance of Car2 mRNA in germ cells during development of the mouse seminiferous epithelium (Figure 7). Car2 mRNA and the translated protein were not detectable by postnatal days 12 and 18. Testis from 12 day old mouse contains Sertoli cells, spermatogonia and leptotene and zygotene spermatocytes (Bellvé et al., 1977). By post-natal day 18, testis contains, in addition, pachytene spermatocytes (Bellvé et al., 1977). Both Car2 mRNA and the translated protein were first detectable by day 24, when early spermatids (steps 1–8) become abundant within the seminiferous epithelium. The mRNA and the protein accumulated in adult testis enriched in elongating and elongated spermatids. The presence of carbonic anhydrase II in adult testis and mouse spermatozoa obtained from the epididymis was demonstrated by immunoblotting (Figure 7).
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Temporal specific expression of many genes during spermatogenesis is accomplished by transcriptional and translational regulation (Penttila et al., 1995
; Schafer et al., 1995; Kleene, 1996; Miller, 1997; Sassone-Corsi, 1997; Eddy and O'Brien, 1998). We have studied the expression of several genes during chicken spermatogenesis that utilize alternative promoters to `TATA box' in meiotic and post-meiotic cells. Two main TATA-less initiation sites were detected for the polyubiquitin gene Ub2, one found upstream, and the other downstream of the `TATA box'-directed initiator (Mezquita et al., 1993). Transcription of the chicken heat shock polyubiquitin gene Ub1 also starts in mature testis from an alternative initiation site, placed upstream the `TATA box', in a position closer to the heat shock promoters (Mezquita et al., 1997). Alternative initiation to `TATA box' and alternative splicings in the 5' region of the pre-mRNA results in at least six different transcripts of glyceraldehyde 3-phosphate dehydrogenase expressed in adult chicken testis (Mezquita et al., 1998). The carbonic anhydrase II gene initiates transcription upstream of the `TATA box' in chicken meiotic and post-meiotic cells (Mezquita et al., 1994) and in adult mouse and human testis (this paper). The same phenomenon has been reported in other genes expressed during spermatogenesis (Yiu et al., 1994; Gu et al., 1995). The use of testis-specific alternative promoters located upstream of the `TATA box' produces extended 5'UTR, with the `TATA box' and other promoter elements incorporated in the additional leader sequence. One of these promoter elements is a vitamin D response element (Quelo et al., 1998) present in the 5'UTR of the carbonic anhydrase II transcript expressed in adult chicken testis (Mezquita et al., 1994).
We do not know the mechanism that selects an alternative initiation site for transcription of Car2 and other genes in mouse adult testis. One possibility is repression of the `TATA box' directed initiation. One reported mechanism that represses transcription from `TATA box' is the presence of the nuclear protein p53 (Mack et al., 1993). As p53 is abundantly expressed in testis in relation to somatic tissues (Almon et al., 1993) we wanted to know whether or not the protein could be involved in the inhibition of TATA-box directed transcription during spermatogenesis. To test this possibility we have characterized Car2 transcripts from mature testis of p53 deficient and normal mice. No differences were observed in Car2 transcripts obtained in the absence of p53. Our results indicate that the p53 protein is not involved or it is not the only protein involved in the repression of the TATA-directed initiation observed in mature testes. Other proteins with a redundant function could be responsible for the inhibition.
Testes-specific mRNA that contain extended 5'UTR are translationally less active in vitro and in vivo (Yiu et al., 1994; Gu et al., 1995). The characteristics of the 5' and 3'UTR of Car2 expressed in mature mouse testes suggest possible mechanisms for delayed translation such as: (i) presence of hairpin structures in the lengthened 5'UTR; (ii) potential binding of transcriptional regulators that may recognize sequences on the testis-specific 5'UTR (Kaunisto et al., 1990), and (iii) absence of possible destabilizing sequences in the shortened 3'UTR. Polysomal gradient analysis of Car2 transcripts obtained from a somatic tissue, kidney, and from adult testis indicates that the two size classes of mRNAs possess different translation potential, in agreement with the previous proposal. The Car2 transcript from mature testis is mainly non-polysomal, while a substantial fraction of the corresponding mRNA from kidney is associated with polysomes. In common with transcripts of other haploid-expressed genes, which are stored and regulated at the translational level (Penttila et al., 1995), most of the Car2 mRNA would be sequestered in the non-polysomal fraction to ensure its availability for translation at the end of spermiogenesis when transcription is no longer active. The presence of testis-specific 5'UTR and 3'UTR in Car2 mRNA could reflect the unusual requirements during spermiogenesis. Translational repression also can be an efficient way to localize and concentrate proteins in subcellular domains. Transport of mRNA in a translationally repressed state, followed by activation of translation when the mRNA reaches its destination has been reported during oogenesis in Drosophila (Gunkel et al., 1998). The precise localization of carbonic anhydrase II in a specific domain of mammalian spermatozoa (Parkkila et al., 1991) may require similar mechanisms.
In numerous animal species the acrosome reaction of spermatozoa has been linked to elevations in intracellular pH. In human spermatozoa the rise in pH takes place in the post-acrosomal cytoplasm (Brook et al., 1996), where the CA2 is immunologically located (Parkkila et al., 1991). The maintenance of an adequate intraspermatozoal bicarbonate concentration could be crucial for the control of sperm motility and the acrosome reaction (Tajima et al., 1987; Brook et al., 1996; Aitken et al., 1998). Our present results and further studies on the specific transcriptional and post-transcriptional mechanisms responsible for carbonic anhydrase II expression during spermatogenesis, may contribute to the understanding of the processes that provide an adequate amount and a proper location of the enzyme in the male gamete.
|
Acknowledgments |
|---|
We are grateful to Dr Ricardo Pérez, Faculty of Medicine, University of Barcelona, for providing the anti-carbonic anhydrase II antibody. This research was supported by Marató TV3 grant 37/95.
|
Notes |
|---|
1 To whom correspondence should be addressed
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Aitken, R.J., Harkiss, D., Knox, W. et al. (1998) On the cellular mechanisms by which the bicarbonate ion mediates the extragenomic action of progesterone on human spermatozoa. Biol. Reprod., 58, 186–196.
Almon, E., Goldfinger, N., Kapon, A. et al. (1993) Testicular tissue-specific expression of the p53 suppressor gene. Dev. Biol., 156, 107–116.[ISI][Medline]
Bellvé, A.R., Cavicchia, J.C., Millette, C.F. et al. (1977) Spermatogenic cells of the prepuberal mouse. Isolation and morphological characterization. J. Cell. Biol., 74, 68–85.
Brook, P.F., Lawry J., Cooke I.D. et al. (1996) Measurement of intracellular pH in human spermatozoa by flow cytometry with benzo[c]xanthene dye SNAFL-1: a novel, single excitation, dual emission, molecular probe. Mol. Hum. Reprod., 2, 218–225.
Eddy, E.M. and O'Brien, D.A. (1998) Gene expression during mammalian meiosis. Curr. Top. Dev. Biol., 37, 141–200.[ISI][Medline]
Engler-Blum, G., Meier M., Frank J. et al. (1993) Reduction of background problems in nonradiactive northern and southern blot analyses enables higher sensitivity than 32P-based hybridizations. Anal. Biochem., 210, 235–244.[ISI][Medline]
Gu, W., Morales, C. and Hecht, N.B. (1995) In male mouse germ cells, copper-zinc superoxide dismutase utilizes alternative promoters that produce multiple transcripts with different translation potential. J. Biol. Chem., 270, 236–243.
Gunkel, N., Yano T., Markussen, F.H. et al. (1998) Localization-dependent translation requires a functional interaction between the 5' and 3' ends of oskar mRNA. Genes Dev., 12, 1652–1664.
Harris, G.C. Jr and Goto, K. (1984) Carbonic anhydrase activity of the reproductive tract tissues of aged male fowls and its relationship to semen production. J. Reprod. Fertil., 70, 25–30.[Abstract]
Hewett-Emmett, D. and Tashian, R.E. (1991) Structure and evolutionary origins of the carbonic anhydrase multigene family. In: Dodgson, S.J., Tashian, R.E., Gros, G. and Carter, N.D. (Eds.), The Carbonic Anhydrases. Plenum Press, New York, USA, pp. 15–32.
Hewett-Emmett, D. and Tashian, R.E. (1996) Functional diversity, conservation, and convergence in the evolution of the alpha-, beta-, and gamma-carbonic anhydrase gene families. Mol. Phylogenet. Evol., 5, 50–77.[ISI][Medline]
Kaunisto, K., Parkkila, S., Tammela, T. et al. (1990) Immunohistochemical localization of carbonic anhydrase isoenzymes in the human male reproductive tract. Histochemistry, 94, 381–386.[ISI][Medline]
Kleene, K.C. (1996) Patterns of translational regulation in the mammalian testis. Mol. Reprod. Dev., 43, 268–281.[ISI][Medline]
Kleene, K.C., Distel R.J. and Hecht N.B. (1984) Translational regulation and deadenylation of a protamine mRNA during spermiogenesis in the mouse. Dev. Biol., 105, 71–79.[ISI][Medline]
Mack, D.H., Vartikar, J., Pipas, J.M. et al. (1993) Specific repression of TATA-mediated but not initiator-mediated transcription by wild-type p53. Nature, 363, 281–283.[Medline]
Marino, L.R. (1993) Characterization of the mouse carbonic anhydrase II gene promoter. J. Biol. Chem., 268, 7081–7089.
Matzura,O. and Wennborg,A. (1996) RNAdraw: an integrated program for RNA secondary structure calculation and analysis is under 32-bit Microsoft Windows. Comput. Appl Biosci., 12, 247–249.
McGowan,M.H., Neubauer, J.A. and Stolle, C.A. (1997) Characterization of the rat carbonic anhydrase II gene structure: sequence analysis of the 5' flanking region and 3' UTR. Gene, 186, 181–188.[ISI][Medline]
Mezquita, J., López-lbor, B., Pau, M. et al. (1993) Intron and intronless transcription of the chicken polyubiquitin gene UBII. FEBS Lett., 3, 244–248.
Mezquita, J., Pau, M. and Mezquita, C. (1994) A novel carbonic anhydrase II mRNA isolated from mature chicken testis displays a TATA box and other promoter sequences in a leader 5' untranslated region not present in somatic tissues. Gene, 147, 231–235.[ISI][Medline]
Mezquita, J., Pau, M. and Mezquita, C. (1997) Heat-shock inducible polyubiquitin gene UbI undergoes alternative initiation and alternative splicing in mature chicken testes. Mol. Reprod. Dev., 46, 471–475.[ISI][Medline]
Mezquita, J., Pau, M., Mezquita, C. (1998) Several novel transcripts of glyceraldehyde-3-phosphate dehydrogenase expressed in adult chicken testis. J. Cell. Biochem., 71, 127–39[ISI][Medline]
Miller, D. (1997) RNA in the ejaculate spermatozoon: a window into molecular events in spermatogenesis and a record of the unusual requirements of haploid gene expression and post-meiotic equilibration. Mol. Hum. Reprod., 3, 669–676.
Parkkila, S., Kaunisto, K., Kellokumpu, S. et al. (1991) A high activity carbonic anhydrase isoenzyme (CA II) is present in mammalian spermatozoa. Histochemistry, 95, 477–482.[ISI][Medline]
Penttila, T.L., Yuan, L., Mali, P. et al. (1995) Haploid gene expression: temporal onset and storage patterns of 13 novel transcripts during rat and mouse spermiogenesis. Biol. Reprod., 53, 499–510.[Abstract]
Quelo, I., Machuca, I. and Jurdic, P. (1998) Identification of a vitamin D response element in the proximal promoter of the chicken carbonic anhydrase II gene. J. Biol. Chem., 273, 10638–10646.
Sakai, I., Sharief, F.S. and Li, S.S. (1987) Molecular cloning and nucleotide sequence of the cDNA for sperm-specific lactate dehydrogenase-C from mouse. Biochem J., 242, 619–622.[ISI][Medline]
Sassone-Corsi, P. (1997) Transcriptional checkpoints determining the fate of male germ cells. Cell, 88, 163–166.[ISI][Medline]
Schafer, M., Nayernia, K., Engel, W. et al. (1995) Translational control in spermatogenesis. Dev. Biol., 172, 344–352.[ISI][Medline]
Shapiro, L.H., Venta, P.J. and Tashian, R.E. (1987) Molecular analysis of G+C-rich upstream sequences regulating transcription of the human carbonic anhydrase II gene. Mol. Cell Biol., 7, 4589–4593.
Shaw, G. and Kamen, R. (1986) A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell, 46, 659–67.[ISI][Medline]
Tajima, Y., Okamura, N. and Sugita, Y. (1987) The activating effects of bicarbonate on sperm motility and respiration at ejaculation. Biochim. Biophys. Acta, 924, 519–529.[Medline]
Venta, P.J., Montgomery, J.C., Hewett-Emmett, D. et al. (1985) Comparison of the 5' regions of human and mouse carbonic anhydrase II genes and identification of possible regulatory elements. Biochim. Biophys. Acta, 826, 195–201.[Medline]
Wickens, M. (1990) In the beginning is the end: regulation of poly(A) addition and removal during early development. Trends Biochem. Sci., 15, 320–324.[ISI][Medline]
Yiu, G.K., Gu, W. and Hecht, N.B. (1994) Heterogeneity in the 5' untranslated region of mouse cytochrome cT mRNAs leads to altered translational status of the mRNAs. Nucleic Acids. Res., 22, 4599–4606.
Submitted on August 3, 1998; accepted on November 25, 1998.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  N. Osada, M. Hirata, R. Tanuma, J. Kusuda, M. Hida, Y. Suzuki, S. Sugano, T. Gojobori, C.-K. J. Shen, C.-I Wu, et al. Substitution Rate and Structural Divergence of 5'UTR Evolution: Comparative Analysis Between Human and Cynomolgus Monkey cDNAs Mol. Biol. Evol., October 1, 2005; 22(10): 1976 - 1982. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. S. Jaiswal and M. Conti Identification and Functional Analysis of Splice Variants of the Germ Cell Soluble Adenylyl Cyclase J. Biol. Chem., August 17, 2001; 276(34): 31698 - 31708. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||