Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (18)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Cataldo, L.
Right arrow Articles by Kleene, K. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cataldo, L.
Right arrow Articles by Kleene, K. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Human Reproduction, Vol. 5, No. 3, 206-213, March 1999
© 1999 European Society of Human Reproduction and Embryology

A quantitative sucrose gradient analysis of the translational activity of 18 mRNA species in testes from adult mice

Leah Cataldo, Mary-Ann Mastrangelo and Kenneth C. Kleene1

Department of Biology, University of Massachusetts Boston, 100 Morrissey Blvd, Boston, MA 02125–3393, USA


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Sucrose gradients have been widely used to study the translational activity of mRNA species in meiotic and haploid spermatogenic cells in mammals. Unfortunately, the results of these studies have been very inconsistent. The purpose of the present study was to obtain accurate and reproducible measurements of the translational activity of a large number of testicular mRNA in sucrose gradients. Extracts of adult testes and cultured seminiferous tubules were sedimented on sucrose gradients, and the distribution of 18 mRNA species was quantified by phosphoimaging. The proportions of various mRNA species sedimenting with polysomes in meiotic and haploid cells (~6–74%) is less than typical of efficiently translated mRNAs (85–90%), demonstrating that the initiation of translation of virtually all mRNA species is at least partially inhibited and that the extent of inhibition is mRNA-specific. Most mRNA species in meiotic and early haploid spermatogenic cells are translated on polysomes in which the ribosome spacing is somewhat wider than in somatic cells, 100–150 verses 80–100 bases. However, the ribosome spacing on protamine mRNAs is unusually close (40–50 bases), and the spacing on poly(A) binding protein mRNA is unusually wide (212–272 bases), thus suggesting that the rate of translational initiation, termination and/or elongation is regulated on translationally active forms of certain mRNA.

spermatids/spermatocytes/translational regulation


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Developing male germ cells in mammals are a striking example of translational regulation of gene expression comparable to invertebrate and amphibian eggs and embryos (reviewed in Kleene, 1996Go). The general patterns of translation in pachytene spermatocytes (meiotic cells), round spermatids (early haploid cells) and elongated spermatids (late haploid cells) have been deduced from analyses of the distribution of more than 40 mRNA in sucrose gradients. Unfortunately, the relative translational activities of many mRNA species are confused due to variable results. This variability is seen in numerous studies that have analysed protamine 1 and 2 mRNAs as the sole criterion to identify the positions of translationally inactive free messenger ribonucleoprotein particles (mRNP) and translationally active mRNA in gradients (examples cited in Kleene, 1996Go). Careful inspection of the results in these studies indicates that the proportions of protamine mRNA in polysomes vary from almost none to approximately one-half, presumably due to differential recovery of RNA during extraction.

In addition, the vast majority of these studies either lack absorbance tracings or the tracings differ greatly from tracings reported by our laboratory (Kleene, 1993Go). Absorbance tracings are valuable because they reveal much about the gradient conditions and the physiological state of the cell population used in the extract. Absorbance tracings are also useful in measuring the spacing of ribosomes on the polysomes translating individual mRNAs, an indicator of a variety of forms of translational regulation affecting the relative rates of initiation, elongation and termination of translationally active mRNA (Mathews et al., 1996Go). Unexpectedly, an earlier study revealed that the ribosome spacings on five mRNA species translated in elongated spermatids were very variable and that the mRNAs encoding protamines 1 and 2 and transition protein 1 are translated on polysomes in which the ribosome spacing is much closer, 30–40 bases (Kleene, 1993Go), than is typical of somatic mammalian cells, 80–100 bases (Mathews et al., 1996Go). This observation raises questions about the ribosome-spacing in earlier stages of spermatogenesis.

The objective of the experiments reported here was to measure the ribosome spacing and translationally active portions of a large number of mRNA species in adult mouse testis. These experiments include controls for the differential recovery of RNA from sucrose gradient fractions.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Sucrose gradient analysis of cytoplasmic extracts of testes and cultured seminiferous tubules
Adult CD-1 mice were killed by CO2 asphyxiation, and the testes were removed and decapsulated. In some experiments, the testes were cultured as seminiferous tubules for 60 min at 32°C as described previously (Kleene, 1993Go). To minimize polysome breakdown due to slow cooling (Vazquez, 1974Go), the testes were dissected and homogenized as rapidly as possible, and cultures were chilled by the addition of a 10–20-fold excess of ice-cold medium. Cytoplasmic extracts were prepared by lysis of two testes or cultured seminiferous tubules from two to four testes in 0.5 ml HNM buffer (0.1 M NaCl, 3 mM MgCl2, 20 mM HEPES, pH 7.4) containing 0.5% Triton N-101 with 10 strokes of a motor driven glass–teflon homogenizer, and centrifugation at 13 000 g for 2 min. The supernatants were layered on a 12.5 ml 15–40% (w/w) linear sucrose gradient in HNM buffer, centrifuged at 28 000 r.p.m. for 150–175 min in the Beckman SW40 rotor, decelerated with the brake to 8000 r.p.m. To distinguish between free-mRNP and polysomal mRNA, cytoplasmic extracts were prepared in HNM buffer incubated at 4°C for 10 min with 0.02 M EDTA (pH 7.4), and sedimented on gradients containing HNM. The gradients were withdrawn through a capillary pipette at 4°C, the absorbance was recorded at 254 nm, and collected as 13 1 ml fractions.

RNA extraction and controls for RNA recovery
RNA were extracted by adding 100 ng of E.coli ribosomal RNA (Sigma R7628), 2 µl Pellet Paint (Novagen), proteinase K (200 µg/ml) and sodium dodecyl sulphate (SDS) (1%) to each fraction. The fractions were incubated for 30 min at 50°C, deproteinized with an equal volume of phenol:chloroform (1:1), and precipitated with ethanol. The three fractions at the top of the gradient were re-extracted 2–3 times with phenol:chloroform and purified by a second round of digestion with proteinase K and extraction with phenol:chloroform, while the remaining fractions were extracted once. The pellets in the ultracentrifuge tubes were resuspended in HNM containing 1% SDS and 200 µg/ml proteinase K and extracted as above. The RNA from each fraction were dissolved in 75 µl diethyl pyrocarbonate (DEPC)-treated H2O. The recovery of E.coli ribosomal RNA was quantified by Slot blots as described below. In early experiments, the recoveries of the E.coli ribosomal RNA from the post-monosomal fractions were ~50% lower than the recoveries from the polysomal fractions, presumably caused by difficulties in separating RNA from the large amounts of protein in these fractions. In later experiments, smaller amounts of cytoplasmic extract were loaded on the gradients, the RNA was purified as described above, and essentially equal amounts of control RNA were recovered from all fractions.

Quantitation of RNA by phosphoimaging Northern blots and slot blots
For slot blots, 4–6 µl of the RNA extracted from each gradient fraction, containing 0.5–2 µg RNA, was heated at 60°C for 15 min in 200 µl of 6x standard saline citrate (SSC), 2.5 M formaldehyde, and applied to nitrocellulose filters using a manifold (BioRad). For Northern blots of actin mRNA, 7.5 µl of each gradient fraction was denatured with formaldehyde and formamide, separated by electrophoresis for 26 h at 35 V in 0.8% agarose gels as described previously (Kleene, 1993Go).

Blots using cDNA and polymerase chain reaction (PCR) probes were hybridized under stringent conditions (Kleene, 1993Go). Blots were hybridized to [32P]poly(U) overnight in 5x SSPE, 0.2% SDS, 10x Denhardt's and 100 µg/ml denatured, sonicated salmon sperm DNA at 50°C, and washed five times for 10 min in 1.25x SSPE, 0.2% SDS at 50°C. Blots were quantified using a Molecular Dynamics Storm Model 840 phosphoimager.

Probes
cDNA inserts and PCR products were purified by agarose electrophoresis, GeneClean (Bio101) and labelled by random primer extension (Feinberg and Volgelstein, 1983Go). The mouse cardiac {alpha}-actin probe is a 1.6 kb EcoRI cDNA insert in Bluscript SK (Hammond et al., 1991Go). The rat histone H1t probe is a 0.62 kb Pst I–Sal I insert of genomic DNA (Cole et al., 1986Go). The mouse {alpha}-inhibin probe is a 1.6 kb cDNA insert in the Eco RI site of pGEM3 (Woodruff et al., 1988Go). The mouse lactate dehydrogenase C cDNA probe was isolated as a ~400 bp Hae III fragment (Tanaka and Fujimoto, 1986Go). The probe for the mouse 27 kDa outer dense fibre protein was generated by reverse transcriptase-PCR amplification of mouse testis RNA using conditions described previously (Hoyer-Fender et al., 1995Go). The mouse protamine 1 and 2 probes are, respectively, ~0.4 and 0.5 kb inserts in the Eco RI site of pGEM-3 (M.Cutler and K.C.Kleene, unpublished). The mouse P21 and laminin receptor P40 probes are, respectively, 0.81 and 1.0 kb inserts in the Bam HI site of the Okayama-Berg vector (Chitptima et al., 1988; Makrides et al., 1988Go). The mouse poly(A) binding protein 1 probe is a 2.1 kb insert in the Eco RI site of pGEM-3 (Wang et al., 1992Go). The mouse proacrosin probe is a 1.3 kb Eco RI insert in pGEM-3 that was isolated from a mouse testis cDNA library (A.Thomas and K.C.Kleene, unpublished) using a boar proacrosin cDNA (Adham et al., 1989Go). The phosphoglyerate kinase 2 probe was isolated by PCR amplification of the 3' non-translated region of mouse genomic DNA using conditions and primers described by McCarrey et al. (1992). The mouse pyruvate dehydrogenase E1{alpha}2 subunit probe is a 0.9 kb cDNA fragment in the Eco RI site of pUC9 (Fitzgerald et al., 1994Go). The mouse ribosomal protein S16 and L32 probes are both 0.55 kb inserts in the Eco RI site of BlueScript SK (Meyuhas et al., 1980). The probe for rat 18S ribosomal RNA is a 1070 base fragment in the Eco RI site of prrr118 (Chan et al., 1984Go). The mouse sperm mitochondrion cysteine-rich protein is a ~800 base insert in the Eco RI site of pGEM-3 (Cataldo et al., 1997Go). The mouse Y-box protein 1 insert is a ~1.0 kb Eco RI fragment Bluescript pSK(+) (Tafuri et al., 1993Go). A probe for bases 939–1507 of E.coli 16S ribosomal RNA was prepared by reverse transcriptase–PCR amplification of E.coli ribosomal RNA (Sigma R7628) using the primers 5'GGTGGAGCATGTGGTTTAATTC and 5'-TTACCTTGTTACGACTTCACCC (93°C for 1 min, 52°C for 45 s, and 72°C for 45 s, for 28 cycles). The probe for total poly(A)+ mRNA was prepared by dephosphorylating polyuridylic acid (Sigma P-9528) with calf intestinal phosphatase, incubation with 100 µg/ml proteinase K in 1% SDS at 60°C for 60 min, phenol extraction, ethanol precipitation and labelling with T4 polynucleotide kinase and [g-32P]ATP.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Proportions of translationally active mRNA
The ribosome spacing and proportions of translationally active forms of 18 testicular mRNAs were measured by sedimenting cytoplasmic extracts of cultured seminiferous tubules or total testes on sucrose gradients, and quantifying the distribution of each mRNA species by phosphoimaging. Quantification of the recovery of E.coli ribosomal RNA that was added to each fraction before extraction demonstrates that equivalent amounts of RNA were recovered from each fraction. The distribution of each mRNA was quantified in 2–7 gradients, and 6–18 mRNA species were analysed in each gradient to facilitate detecting differences between mRNA species. In addition, every mRNA was analysed in 2–5 additional gradients from cycloheximide-treated cultured seminiferous tubules with results that were virtually identical to control gradients (data not shown).

The levels of 14 of the mRNAs studied here in the various cell types in the germinal epithelium have been elucidated previously (references cited in Kleene, 1996Go). The cell types that contain high levels of each mRNA, and therefore represent the source of most of the mRNA in the cytoplasmic extracts, have been summarized in Table IGo. Northern blots of RNA extracted from the testes of staged prepubertal mice and purified spermatogenic cell types indicate that a single size of the four remaining mRNA (the P21, Y-box protein 1, and ribosomal protein S16 and L32 mRNA) is expressed at high levels in meiotic and haploid cells (M.-A.Mastrangelo and K.C.Kleene, unpublished). Sixteen mRNA were quantified from slot blots, because the probes hybridize primarily to transcripts of a single gene (McCarrey et al., 1992Go; Fulcher et al., 1993Go; Tafuri et al., 1993Go; references cited in Kleene, 1996Go). The actin mRNA were quantified from Northern blots (data not shown), since the {alpha}-actin probe hybridized to 2.1 kb cytoplasmic ß- and {gamma}-actin mRNA in pachytene spermatocytes and round spermatids and a ~1.5 kb enteric {gamma}-actin mRNA in round and elongated spermatids (Kim et al., 1989Go). The distribution of each mRNA has been depicted in histograms in Figure 2Go and the proportions and ribosome spacing of polysomal mRNA, calculated as described below, have been summarized in Table IGo.


View this table:
[in this window]
[in a new window]
 
Table I. Proportion and ribosome-spacing of various mRNA species in the polysomes of adult testis
 


View larger version (49K):
[in this window]
[in a new window]
 
Figure 2. Distribution of various testicular mRNA in sucrose gradients. The amount of each mRNA species in each sucrose gradient fraction was quantified by phosphoimage analysis of slot blots or Northern blots. The histograms show the percentage of total mRNA in the gradient in each fraction and are typical of the results for each mRNA. Fraction 14 contains the RNA extracted from the pellets on the bottom of the ultracentrifuge tubes. Solid bars, control gradient, scale, 0–60%; open bars, EDTA gradient, scale, 0–60%; control: EDTA, scale, 0–15%.

 
The absorbance tracing at 254 nm of a typical control gradient is shown in Figure 1AGo and displays a prominent peak of 80S single ribosomes, and a series of peaks with maximum absorbance in polysomes containing 6–10 ribosomes. This profile is virtually identical to the profiles of numerous gradients of extracts of total testes and cultured seminiferous tubules that were analysed in this and previous studies (Kleene 1993Go; Fajardo et al., 1997Go). The profile of an EDTA-treated extract in Figure 1BGo shows absorbance peaks of ribosomal subunits, but no peaks of single ribosomes or polysomes.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 1. Optical density profiles of cytoplasmic extracts of total testes sedimented on sucrose gradients. Cytoplasmic extracts of total adult testes were sedimented on sucrose gradients, the optical density profile of the gradients was determined at 254 nm using a 2 mm flow cell, and the gradient was collected as 13 fractions. The fractions have been numbered in the reverse order in which they were collected to be consistent with previous sucrose gradient analyses of testicular mRNA. The absorbance peaks of 60S ribosomal subunits, 80S single ribosomes, and polysomes containing 2 to 6 ribosomes are indicated. (A) The extract was prepared with Mg2+ to preserve polysomes; (B), the cytoplasmic extract was treated with 0.02 M EDTA to dissociate polyribosomes.

 
The histograms in Figure 2Go exhibit striking differences in the proportions of translationally active mRNAs in the control gradients. Twelve mRNAs exhibited obvious bimodal distributions with a prominent peak of free mRNP sedimenting <=80S in fractions 2 or 3, and peaks at various positions in the polysome region in fractions 4–13 (the mRNA encoding both actins, lactate dehydrogenase C, laminin receptor P40, phosphoglycerate kinase 2, both protamine, pyruvate dehydrogenase E1{alpha}2, outer dense fibre 27 kDa, both ribosomal proteins, and sperm mitochondria cysteine-rich protein). The histone H1t and {alpha}-inhibin mRNA are primarily polysomal, while the P21, proacrosin and Y-box protein 1 mRNA exhibit low levels of mRNA in the polysomal region. The peaks of free mRNP corresponding to the smallest and largest mRNA, protamine 1 mRNA (430–550 bases) and poly(A) binding protein mRNA (~3000 bases) (Kleene, 1989Go; Kleene et al., 1994Go) sediment at about 20S and 60S, respectively (data not shown). The P21 and laminin receptor P40 free mRNP are consistently asymmetric and spread into small polysomes. The unpaired t-test reveals that the difference between the proportions of ribosomal protein S16 and L32 mRNA associated with polysomes is significant at the 0.0001 level.

Several findings indicate that EDTA is a useful, but imperfect, agent in distinguishing polysomal mRNA from free mRNP contaminants in the polysomal region. EDTA treatment of the extracts resulted in the disappearance of the peaks of polysomal mRNA, and a large decrease in the proportions of mRNA sedimenting in the polysome region, indicating that a substantial proportion of the mRNA sedimenting more rapidly than single ribosomes is translationally active. EDTA treatment also demonstrates that the variable, and sometimes substantial, proportion of every mRNA species sedimenting in the pellet (~25% of the {alpha}-inhibin mRNA in some experiments) is translationally active. However, careful inspection of the histograms in Figure 2Go reveals that EDTA does not completely eliminate mRNA from the polysomal region, especially the lactate dehydrogenase C, pyruvate dehydrogenase E1{alpha}2, histone H1t and {alpha}-inhibin mRNAs, the mRNA species with the highest proportions of polysomal mRNAs. Previous studies have also shown that protamine mRNAs persist in the polysomal region after EDTA treatment (Kleene et al., 1984Go; Kleene, 1989Go; Fajardo et al., 1997Go). It follows that estimates of the proportions of translationally active mRNA based on the levels in the polysomal region in control gradients are too high due to contamination by free mRNPs, and that estimates based on the difference between control and EDTA gradients are too low due to contamination by polysomal mRNA. Since we cannot rigorously correct for either error, Table IGo includes both the sum of the percentage of mRNA present in the polysome region (fractions 4–13 and pellet of control gradients), and the sum of the differences in the percentage of mRNA in the same fractions in control and EDTA gradients. However, assuming that the magnitude of errors from each source is correlated with the translational activity of a particular mRNA species, we suggest that the best approximation of the true proportions of translationally active mRNA can be calculated as follows: the difference between the levels of polysomal mRNA in control and EDTA-treated extracts for mRNA species with high levels of free mRNPs, and the total levels of polysomal mRNA in control gradients for mRNA species with low levels of free mRNP (indicated by bold face type in Table IGo).

Finally, in agreement with Gold and Hecht (1981), the amount of total poly(A)+ mRNA as estimated by hybridization to poly(U) is about 2-fold greater in the free-mRNP than in the polysomes 65 verses 35%. In contrast, the majority of 18S ribosomal RNA sediments with polysomes, ~67%.

Ribosome spacing
The ribosome spacing was calculated by dividing the number of nucleotides in the coding region by the average number of ribosomes in the peak polysomal fractions in the optical density profile. A range of ribosome spacings is given for each mRNA, since the number of ribosomes in the peak fractions for individual mRNA species could usually be determined to an accuracy of ~2 ribosomes due to variability between gradients and the presence of two sizes of polysomes in most fractions. In general, the mRNA that are expressed in primary spermatocytes, round spermatids and Sertoli cells exhibit ribosome spacings in the range of 100–150 bases, and only the poly(A) binding protein mRNA exhibits a spacing outside this range, ~212–272 bases. The ribosome spacings for mRNA that are translated in elongated spermatids were more variable, ranging from unusually close, 40–50 bases for protamine 1 and 2 mRNA, to ~143 bases for the sperm mitochondria cysteine-rich protein mRNA. The ribosome spacing of six mRNAs could not be determined because the mRNA sedimented with polysomes that were too large to be resolved in the absorbance tracings (actin and phosphoglycerate kinase 2 mRNA), or the positions of the very small peaks in the polysome region were not reproducible (P21, proacrosin, and Y-box protein 1 mRNA).


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The experiments reported here have measured the size and polysome loading of 18 testicular mRNA species in sucrose gradients. The observed patterns were reproducible; internal controls verify that equal amounts of RNA were recovered from all fractions; analyses of 6–18 mRNAs in each gradient revealed consistent differences between many mRNAs; and the results have been quantified to facilitate comparison with results in other laboratories.

Two limitations of the measurements reported here should be noted. First, the failure of EDTA to completely eliminate translationally active mRNA from the polysomal region precludes exact estimates of the proportions of translationally active mRNA. Second, the proportions of translationally active mRNA in Table IGo are averages of the levels and translational activity of each mRNA in the various spermatogenic cell types in which it is expressed. For example, the ~20% of protamine mRNA loaded on polysomes in total testis is the average of the proportion in round and elongating spermatids in which little or no mRNA is translated, and the proportion in elongated spermatids in which translation is activated incrementally (Kleene, 1996Go). In contrast, the proportions of polysomal proacrosin, lactate dehydrogenase C and pyruvate dehydrogenase E1{alpha}2 mRNA in total testis in Table IGo should be reasonably accurate estimates of the proportions in both pachytene spermatocytes and round spermatids, because both cell types contain high levels and equal proportions of translationally active mRNAs (Fujimoto et al., 1988Go; Kim et al., 1989Go; Kashiwabara et al., 1990Go; Fitzgerald et al., 1994Go). Another group of mRNAs including the P21, laminin receptor P40, ß{gamma}-actin, Y-box protein 1, poly(A) binding protein 1 and ribosomal protein L32 and S16 mRNA, is expected to be present in most cell types in the testis. We suggest that the polysome loading of these mRNA in total testis reflects the average of the loading in pachytene spermatocytes and spermatids, because these cell types contain the vast majority of RNA in the testis (Bellve et al., 1977Go). Similarly, the polysomal loading of phosphoglycerate kinase 2 mRNA in total testis primarily reflects that in round spermatids, because the levels of this mRNA are ~6-fold higher in round spermatids than in pachytene spermatocytes (Gold et al., 1983Go; McCarrey et al., 1992Go). Table IGo identifies the cell types that represent the principal source of each mRNA, and which mRNA species are known or suspected to undergo, or not to undergo, developmental changes in translational activity.

The present findings generally support notions that the levels of free mRNP in meiotic and haploid spermatogenic cells are extremely variable and that most, if not all, mRNA exhibit higher levels of free mRNP, >=26%, than is typical of translationally active mRNA in somatic cells, 10–15% (Mathews et al., 1996Go). The {alpha}-inhibin mRNA is the only mRNA studied here that does not exhibit elevated free mRNPs (~14%). The {alpha}-inhibin mRNA is expressed in Sertoli cells (Millar et al., 1994Go), a somatic cell type in which most mRNA species appear to be translated efficiently (Kleene, 1996Go).

However, the present study also contains discrepancies with sucrose gradient analyses of a fair number of mRNA. We report here that ~20% of protamine 1 and 2 mRNA is associated with polysomes, midway between the 0–50% in various reports pointed out in the Introduction, and greater than the 10–15% reported by Kleene et al. (1984). In addition, we observed obvious differences in the proportions of translationally active lactate dehydrogenase C, cytoplasmic ß{gamma}-actin, enteric {gamma}-actin and proacrosin mRNA that were not evident previously (Kim et al., 1989Go; Kashiwabara et al., 1990Go). We suspect that an estimate that the proportion of translationally active phosphoglycerate kinase 2 mRNA is >2-fold higher than reported here, 60–80 verses 26% (Gold et al., 1983Go), is caused by a common problem: low recovery of RNA from the post-monosomal fractions.

The levels of translational active histone H1t and ribosomal protein mRNA merit brief comment. It is intriguing that the histone H1t mRNA exhibited the highest proportion of polysomal mRNA in spermatogenic cells. The histone H1t mRNA might be translated efficiently because it is expressed earlier, in middle and late pachytene spermatocytes (Kremer and Kistler, 1991Go), than the other mRNA species which are expressed in pachytene spermatocytes and/or spermatids, or because its 3' end contains features found only in histone mRNAs, the absence of a poly(A) tract and a stem-loop (Cole et al., 1986Go).

The 2-fold difference in the proportions of translationally active ribosomal protein S16 and L32 mRNA in adult testis is unexpected. Equivalent proportions of these mRNA are loaded on polysomes in cultured muscle and lymphosarcoma cells and the testes of 8 day prepubertal mice (Agrawal et al., 1987; Meyuhas et al., 1987Go; K.Kleene, unpublished), presumably because equal numbers of each protein are utilized in constructing a ribosome (Meyuhas, 1996Go). Conceivably, the difference in translational efficiency compensates for differences in transcription of the ribosomal protein S16 and L32 mRNA in adult testis.

The ribosome spacing is a marker for translational controls affecting the relative rates of initiation and elongation of translationally active mRNA (Mathews et al., 1996Go). The number of ribosomes translating various mRNA in somatic cells is thought to be proportional to the length of the coding region of most mRNAs corresponding to a constant spacing of 80–100 bases (Mathews et al., 1996Go). This survey indicated that mRNA species which are translated in meiotic and early haploid spermatogenic cells consistently exhibit wider ribosome spacings, 100–150 bases, than those in somatic cells. The poly(A) binding protein mRNA shows an unusually wide spacing, 212–272 bases, and the ribosome spacings on mRNA species that are translated in elongated spermatids are quite variable, ranging from 40–50 bases for protamine 1 and 2 mRNA to 143 bases for the sperm mitochondria cysteine-rich protein mRNA. We do not know whether the wide ribosome spacing on the {alpha}-inhibin mRNA (137–156 bases) is a general attribute of mRNA that are translated in Sertoli cells or a peculiarity of this mRNA.

It is difficult to assess the difference in ribosome spacing between spermatogenic and somatic cells because studies in somatic cells are biased towards abundant, efficiently translated mRNA and did not discuss the accuracy of their measurements. Wide spacing on mRNAs such as the poly(A) binding protein mRNA is usually thought to indicate a slow rate of initiation, while the unusually close spacing on protamine mRNA could be explained by rapid initiation, slow termination, ribosome pausing near the end of the coding region, or ribosomes cycling between the 3' and 5' non-translated regions (Jacobson, 1996Go; Mathews et al., 1996Go). We expected that the ribosome spacing on the proacrosin mRNA would be wide because the 5'UTR contains upstream reading frames in a strong context for the initiation of translation (Kremling et al., 1991Go), a feature that inhibits the translation of downstream reading frames of most, but probably not all, mRNA (Geballe, 1996Go). However, we found that the vast majority of the proacrosin mRNA is stored as free mRNPs, and that the levels of polysomal mRNA were too low to measure the ribosome spacing.

The patterns of translational regulation in spermatogenic cells raise two important questions. First, the mechanisms that generate the widespread and mRNA-specific inhibition of translational initiation have not been elucidated, although several candidates for sequence-specific and non-specific translational repressors have been identified (Kwon et al., 1993Go; Tafuri et al., 1993Go; Lee et al., 1996Go; Wu et al., 1997Go). Second, the reasons why nearly all mRNA species in meiotic and haploid spermatogenic cells are translationally repressed are not fully understood. It makes excellent biological sense that translation of protamine 1 mRNA is delayed because premature translation arrests development of round spermatids (Lee et al., 1995Go), and elongated spermatids, the cells that normally synthesize protamine 1, are transcriptionally inert (Kierszenbaum and Tres, 1975Go). In contrast, it is puzzling why most, if not all, mRNAs in pachytene spermatocytes and round spermatids are at least partially translationally repressed. The vast majority of mRNA species including the lactate dehydrogenase C, pyruvate dehydrogenase E1{alpha}2, proacrosin and cytoplasmic actin mRNAs exhibit nearly constant proportions of free mRNPs in pachytene spermatocytes and round spermatids (reviewed in Kleene, 1996Go). The purpose of storing these mRNAs in free mRNPs is puzzling because both cell types are transcriptionally active, and translational activity does not increase in round spermatids. It is possible that the translational repression also functions to prevent deleterious effects of mRNAs such as Y-box protein 1 and poly(A) binding protein 1 mRNA that are grossly overexpressed in pachytene spermatocytes and round spermatids compared with somatic cells (Tafuri et al., 1993Go; Kleene et al., 1994Go).

Finally, we wish to emphasize the importance of sucrose gradient analyses in elucidating gene expression in spermatogenic cells. In-situ hybridization and immunocytochemistry reveal that many mRNA species appear earlier than their corresponding proteins in spermatogenic cells. Sucrose gradients are necessary to distinguish whether the delayed detection of proteins is due to a change in the translational activity of the mRNA or inefficient translation, resulting in slow accumulation of the protein, with no change in the rate of translation of the mRNA.


    Acknowledgments
 
We are grateful to Drs L.Bowman, G.Brawerman, H.H.Dahl, W.Engel, R.P.Erickson, H.Fujimoto, W.S.Kistler, J.R.McCarrey, O.E.Meyuhas and A.P.Wolffe for generously donating plasmids. This work was supported by NSF Grants DCB-90128486 and IBN-9418285.


    Notes
 
1 To whom correspondence should be addressed Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Adham, I.M., Klemm, U., Maier, W.-M. et al. (1989) Molecular cloning of preproacrosin and analysis of its expression pattern in spermatogenesis. Eur. J. Biochem., 182, 563–568.[Web of Science][Medline]

Agrawal, M.G. and Bowman, L.H. (1987) Transcriptional and translational regulation of ribosomal protein formation during mouse myoblast differentiation. J. Biol. Chem., 262, 4868–4875.[Abstract/Free Full Text]

Bellve, A.R., Cavicchia, J,C., Millette, C.F. et al. (1977) Spermatogenic cells of the prepuberal mouse: isolation and morphological characterization. J. Cell Biol., 74, 68–85.[Abstract/Free Full Text]

Cataldo, L., Baig, K., Oko, R. et al. (1997) Developmental expression, intracellular localization and selenium content of the cysteine-rich protein associated with the mitochondrial capsules of mouse sperm. Mol. Reprod. Dev., 45, 320–331.

Chan, Y.L., Gutell, R., Noller, H.F. and Wool, I.G. (1984) The nucleotide sequence of a rat 18 S ribosomal ribonucleic acid gene and a proposal for the secondary structure of 18S ribosomal ribonucleic acid. J. Biol. Chem., 259, 224–230.[Abstract/Free Full Text]

Chitpatima, S.T., Makrides, S., Bandyopadhyay, R. and Brawerman, G. (1988) Nucleotide sequence of a major messenger RNA for a 21 kilodalton polypeptide that is under translational control in mouse tumor cells. Nucl. Acids Res., 16, 2350.[Free Full Text]

Cole, K.D., Kandala, J. and Kistler, W.S. (1986) Isolation of the gene for the testis-specific H1 histone variant H1t. J. Biol. Chem., 261, 7178–7183.[Abstract/Free Full Text]

Fajardo, M.A., Haugen, H.S., Clegg, C.H. and Braun, R.E. (1997) Separate elements in the 3' untranslated region of mouse protamine 1 mRNA regulate translation repression and activation during murine spermatogenesis. Dev. Biol., 191, 42–52.[Web of Science][Medline]

Feinberg, A.P. and Vogelstein, B. (1983) A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem., 132, 6–13.[Web of Science][Medline]

Fitzgerald, J., Dahl, H.-H.M. and Ianello, R.C. (1994) Differential expression of two testis-specific transcripts of the mouse Pdha-2 gene during spermatogenesis. DNA Cell. Biol., 13, 531–537.[Web of Science][Medline]

Fujimoto, H., Erickson, R.P. and Tone, S. (1988) Changes in polyadenylation of lactate dehydrogenase-X mRNA during spermatogenesis in mice. Mol. Reprod. Dev., 1, 27–34.[Medline]

Fulcher, K.D., Welch, J.E., Davis, C.M. et al. (1993) Characterization of laminin receptor messenger ribonucleic acid and protein expression in mouse spermatogenic cells. Biol. Reprod., 48, 674–682.[Abstract]

Geballe, A.P. (1996) Translational control mediated by upstream AUG codons. In Hershey, J.W.B., Mathews, M.B. and Sonenberg, N. (eds), Translational Control. Cold Spring Harbor Press, Cold Spring Harbor, New York, pp. 173–197.

Gold, B. and Hecht, N.B. (1981) Differential compartmentalization of messenger ribonucleic acid in murine testis. Biochemistry, 20, 4871–4877.[Medline]

Gold, B., Fujimoto, H., Kramer, J.M. et al. (1983) Haploid accumulation and translational control of phosphoglycerate kinase-2 messenger RNA during mouse spermatogenesis. Dev. Biol., 98, 392–399.[Web of Science][Medline]

Hammond, M.L., Merrick, W. and Bowman L.H. (1991) Sequences mediating the translation of mouse S16 ribosomal protein mRNA during myoblast differentiation in vitro and possible control points for the in vitro translation. Genes Dev., 5, 1723–1736.[Abstract/Free Full Text]

Hoyer-Fender, S., Burfeind, P. and Hameister, H. (1995) Sequence of mouse Odf1 cDNA and its chromosomal localization: extension of the linkage group between human chromosome 8 and mouse chromosome 15. Cytogenet. Cell Genet., 70, 200–204.[Web of Science][Medline]

Jacobson, A. (1996) Poly(A) metabolism and translation: The closed loop model. In Hershey, J.W.B., Mathews, M.B. and Sonenberg, N. (eds), Translational Control. Cold Spring Harbor Press, Cold Spring Harbor, New York, pp. 173–197.

Kashiwabara, S.-I., Arabi, Y., Kodaira, K. and Baba, T. (1990) Acrosin biosynthesis in meiotic and postmeiotic spermatogenic cells. Biochem. Biophys. Res. Commun., 173, 240–245.[Web of Science][Medline]

Kierszenbaum, A.L. and Tres, L.L. (1975) Structural and transcriptional features of the spermatid genome. J. Cell Biol., 65, 258–270.[Abstract/Free Full Text]

Kim, E., Waters, S.H., Hake, L.E. and Hecht, N.B. (1989) Identification and developmental expression of a smooth-muscle ({gamma}-actin in postmeiotic male germ cells of mice. Mol. Cell. Biol., 9, 1875–1881.[Abstract/Free Full Text]

Kleene, K.C. (1989) Poly(A) shortening accompanies the activation of translation of five mRNAs during spermiogenesis in the mouse. Development, 106, 367–373.[Abstract]

Kleene, K.C. (1993) Multiple controls over the efficiency of translation of the mRNAs encoding transition proteins, protamines, and the mitochondrial capsule selenoprotein in late spermatids in mice. Dev. Biol., 159, 720–731.[Web of Science][Medline]

Kleene, K.C. (1996) Patterns of translational regulation in the mammalian testis. Mol. Reprod. Dev., 43, 268–281.[Web of Science][Medline]

Kleene, K.C., Distel, R.J. and Hecht, N.B. (1984) Translational regulation and deadenylation of a protamine mRNA during spermatogenesis in the mouse. Dev. Biol., 105, 71–79.[Web of Science][Medline]

Kleene, K.C., Wang, M.-Y., Cutler, M. et al. (1994) Developmental expression of poly(A) binding protein mRNAs during spermatogenesis in the mouse. Mol. Reprod. Dev., 39, 355–364.[Web of Science][Medline]

Kremer, E.J. and Kistler, W.S. (1991) Localization of mRNA for testis-specific histone H1t by in situ hybridization. Exp. Cell Res., 197, 330–332.[Web of Science][Medline]

Kremling, H., Keime, S., Wilhelm, K. et al. (1991) Mouse proacrosin gene: nucleotide sequence, diploid expression, and chromosomal localization. Genomics, 11, 828–834.[Web of Science][Medline]

Kwon, Y.K., Murray, M.T. and Hecht, N.B. (1993) Proteins homologous to the Xenopus germ cell-specific RNA-binding proteins p54/p56 are temporally expressed in mouse male germ cells. Dev. Biol., 158, 90–100.[Web of Science]

Lee, K., Haugen, H.S., Clegg, C.H. and Braun, R.E. (1995) Premature translation of protamine 1 mRNA causes precocious nuclear condensation and arrests spermatid differentiation in mice. Proc. Nat. Acad. Sci. USA, 92, 12451–12455.[Abstract/Free Full Text]

Lee, K., Fajardo, M.A., Edelhoff, S. and Braun, R.E. (1996) A testis cytoplasmic RNA-binding protein that has the properties of a translational repressor. Mol. Cell. Biol., 16, 3023–3034.[Abstract/Free Full Text]

Makrides, S., Chitpatima, S.T., Bandyopadhyay, R. and Brawerman, G. (1988) Nucleotide sequence for a major messenger RNA for a 40 kilodalton polypeptide that is under translational control in mouse tumor cells. Nucl. Acids Res., 16, 2349.[Free Full Text]

Mathews, M.B., Sonenberg, N. and Hershey, J.W.B. (1996) Origins and targets of translational control. In Hershey, J.W.B., Mathews, M.B. and Sonenberg, N. (eds), Translational Control. Cold Spring Harbor Press, Cold Spring Harbor, New York, pp. 1–21.

McCarrey, J.R. and Thomas, K. (1987) Human testis-specific PGK gene lacks introns and possesses characteristics of a processed gene. Nature (London), 326, 501–505.[Medline]

McCarrey, J.R., Berg, W.M., Paragioudakis, S.J. et al. (1992) Differential transcription of Pgk genes during spermatogenesis in the mouse. Dev. Biol., 154, 160–168.[Web of Science][Medline]

Meyuhas, O. (1996) Translational control of ribosomal protein mRNAs. In Hershey, J.W.B., Mathews, M.B. and Sonenberg, N. (eds), Translational Control. Cold Spring Harbor Press, Cold Spring Harbor, New York, pp. 363–388.

Meyuhas, O. and Perry, R.P. (1980) Construction and identification of cDNA clones for mouse ribosomal proteins: applications for the study of r-protein expression. Gene, 10, 113–129.[Web of Science][Medline]

Meyuhas, O., Thompson, E.A. and Perry, R.P. (1987) Glucocorticoids selectively inhibit translation of ribosomal protein mRNAs in P1798 lymphosarcoma cells. Mol. Cell Biol., 7, 2691–2699.[Abstract/Free Full Text]

Millar, M.R., Sharpe, R.M., Maguire, S.M. et al. (1994) Localization of mRNAs by in-situ hybridization to the residual body at stages IX–X of the cycle of the rat seminiferous epithelium: fact or artefact? Int. J. Androl., 17, 149–160.[Web of Science][Medline]

Tafuri, S.R., Familiari, M. and Wolffe, A.P. (1993) A mouse Y-box protein, MSY1, is associated with paternal mRNA in spermatocytes. J. Biol. Chem., 268, 12213–12220.[Abstract/Free Full Text]

Tanaka, S. and Fujimoto, H. (1986) A postmeiotically expressed clone encodes lactate dehydrogenase isozyme X. Biochem. Biophys. Res. Commun., 136, 760–766.[Web of Science][Medline]

Vazquez, D. (1974) Inhibitors of Protein Synthesis. Springer-Verlag, New York.

Wang, M.-Y., Cutler, M., Karimpour, I. and Kleene, K.C. (1992) Nucleotide sequence of a mouse testis poly(A) binding protein cDNA. Nucl. Acids Res., 20, 3519.[Free Full Text]

Woodruff, T.K., D'Agostino, J., Schwartz, N.B. and Mayo, K.E. (1988) Dynamic changes in inhibin messenger RNAs in rat ovarian follicles during the reproductive cycle. Science, 239, 1296–1299.[Abstract/Free Full Text]

Wu, X.Q., Gu, W., Meng, X. and Hecht, N.B. (1997). The RNA-binding protein, TB-RBP, is the mouse homologue of translin, a recombination protein associated with chromosomal translocation. Proc. Natl. Acad. Sci. USA, 94, 5640–5645.[Abstract/Free Full Text]

Submitted on September 1, 1998; accepted on December 2, 1998.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol. Biol. CellHome page
M. P. Paronetto, F. Zalfa, F. Botti, R. Geremia, C. Bagni, and C. Sette
The Nuclear RNA-binding Protein Sam68 Translocates to the Cytoplasm and Associates with the Polysomes in Mouse Spermatocytes
Mol. Biol. Cell, January 1, 2006; 17(1): 14 - 24.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Y. Arava, Y. Wang, J. D. Storey, C. L. Liu, P. O. Brown, and D. Herschlag
Genome-wide analysis of mRNA translation profiles in Saccharomycescerevisiae
PNAS, April 1, 2003; 100(7): 3889 - 3894.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
Y. Iuchi, T. Kaneko, S. Matsuki, I. Sasagawa, and J. Fujii
Concerted Changes in the YB2/RYB-a Protein and Protamine 2 Messenger RNA in the Mouse Testis under Heat Stress
Biol Reprod, January 1, 2003; 68(1): 129 - 135.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
J. P. Siffroi, A. Pawlak, M. F. Alfonsi, F. Troalen, G. Guellaen, and J. P. Dadoune
Expression of the TAR RNA binding protein in human testis
Mol. Hum. Reprod., March 1, 2001; 7(3): 219 - 225.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
M.-A. Mastrangelo and K. C. Kleene
Developmental expression of Y-box protein 1 mRNA and alternatively spliced Y-box protein 3 mRNAs in spermatogenic cells in mice
Mol. Hum. Reprod., September 1, 2000; 6(9): 779 - 788.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (18)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Cataldo, L.
Right arrow Articles by Kleene, K. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cataldo, L.
Right arrow Articles by Kleene, K. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?