Molecular Human Reproduction, Vol. 5, No. 3, 287-290,
March 1999
© 1999 European Society of Human Reproduction and Embryology
Mutations in the promoter region of the androgen receptor gene are not common in males with idiopathic infertility
National University Hospital, Level 2, Department of Obstetrics and Gynaecology, Lower Kent Ridge Road, Singapore 119074, Singapore
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Molecular studies on the role of the androgen receptor in male infertility have thus far concentrated solely on exonic regions of the androgen receptor gene. We have therefore screened for the first time the androgen receptor gene 5' untranslated region (nucleotides –153 to +237 ) in 240 males with idiopathic infertility for lesions which could potentially impair spermatogenesis. This region encompasses the androgen receptor gene promoter. DNA was extracted from blood leukocytes and the polymerase chain reaction was used to amplify the promoter region as two overlapping products. Single strand conformational polymorphism analysis was carried out on these products to screen for mutations. This analysis did not reveal the presence of any gross deletions or mutations. Our results thus preclude aberrations in the promoter region of the androgen receptor gene as a common factor in the aetiology of idiopathic male infertility.
androgen receptor/gene/promoter/infertility
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
The development and maintenance of the male phenotype, including sperm production, are dependent on the androgens, testosterone and dihydrotestosterone, whose physiological effects are mediated by the androgen receptor (AR). The AR is a ligand-activated transcriptional regulatory protein belonging to the superfamily of nuclear receptors, members of which include the glucocorticoid, progesterone, oestrogen, and retinoic acid receptors. The main functional domains of nuclear receptors are the transactivation, the DNA-binding, and the ligand-binding domains. Androgens bind with high affinity to the steroid-binding pocket of the AR causing nuclear translocation and interaction with specific DNA response elements of target genes, thereby regulating their transcription (Beato, 1989
; Quigley et al., 1995).
The absolute requirement of androgens for spermatogenesis suggests that subfunctional ARs could exist in cases of infertility where normal serum androgen concentrations are observed. Systematic examination of the androgen receptor in infertile males has revealed that long polyglutamine tracts in the transactivation domain of the AR increase by up to 4-fold the risk of defective spermatogenesis (Tut et al., 1997). Studies on the androgen receptor coding regions of infertile males have indicated that whilst uncommon (Tincello et al., 1997), amino acid substitutions in the AR can result in defective sperm production and male infertility (Tsukuda et al., 1994; Yong et al., 1994, 1996; Wang et al., 1998). Another possibility, suggested by the reduced maximum androgen-binding capacity in genital skin fibroblasts of infertile males (Aiman and Griffin, 1982; Morrow et al., 1987), is that mutations of the promoter region of the AR gene could hinder the transcription machinery thereby reducing the total amount of AR protein in the testes.
In the present study, we have screened for the first time the promoter region of the AR gene in a large cohort of infertile males to investigate the susceptibility of this region to potentially pathogenic mutations.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Patients and controls
Recruitment of patients (n = 240) was from the infertility clinic of the National University Hospital, which is a tertiary referral centre for the region. For each patient, two independent samples taken two months apart were used for measurement of sperm density. Blood samples were also taken for measurement of testosterone, follicle stimulating hormone (FSH), luteinizing hormone (LH), prolactin, and where indicated for chromosomal analysis. Individuals displaying chromosomal disorders, hyperprolactinaemia, hypopituitarism, infective or obstructive syndromes of the genital tract were excluded. Table I
depicts the patient clinical data. Healthy males with proven fertility (n = 30) were used as control subjects.
|
Extraction of genomic DNA and polymerase chain reaction (PCR)
Genomic DNA was extracted from leukocytes of peripheral blood from patients and controls as described previously (Yong et al., 1994
). Nucleotides –153 to +237 of the AR 5' untranslated region (UTR) were amplified as two overlapping fragments using PCR. The first fragment encompassed nucleotides –153 to +123 and was amplified using the primer pair: 5' TCTCCAAAGCCACTAGGCAG 3' (sense) and 5' TGTACAGCACTGGAGC 3' (antisense). The PCR reactions contained 100 ng genomic DNA, 50 pmoles each primer, 10 mM Tris–HCl (pH 9.0), 1.5 mM MgCl2, 50 mM KCl, 1 unit Taq polymerase (Pharmacia, Uppsala, Sweden) and 5% glycerol (v/v). The second fragment encompassing nucleotides +23 to +237 was amplified by the primer pair: 5' GGAGCCAGCTTGCTGGGAGAG 3' (sense) and 5' ACCGAAGAGGAAAGGGCAGCTC 3' (antisense). The reaction mixture was similar to that for the first fragment except that glycerol was added to 10% (v/v). Both fragments were amplified using the thermal profile: 98°C for 5 min, 60°C for 30 s, 72°C for 2 min (1 cycle), followed by 30 cycles of 96°C for 1 min, 60°C for 30 s, 72°C for 1.5 min. Amplified fragments were visualized by electrophoresis on a 1.4% agarose gel.
Single strand conformation polymorphism (SSCP) analyses
Amplified fragments were denatured by heating to 95°C for 5 min. After brief incubation on ice, samples were run on an 8% non-denaturing polyacrylamide gel containing 5% gycerol (v/v) at 12°C as described previously (Yong et al., 1994).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Patient clinical data
Of the 240 patients analysed, 27% were azoospermic (no spermatozoa detectable), 44% were severely oligozoospermic (<5x106 spermatozoa/ml), 21% were moderately oligozoospermic (5–20x106 spermatozoa/ml) and 8% were normozoospermic (>20x106 spermatozoa/ml). The patients' hormonal parameters obtained are shown in Table I
. Mean serum testosterone was within normal limits. The mean gonadotrophin concentrations (FSH and LH) were borderline high indicating some degree of testicular hypofunction in the patients.
Screening of the androgen receptor gene promoter region
Figure 1 shows the region of the AR gene promoter that we have screened for mutations in infertile men. This region was amplified in the form of two overlapping PCR products as smaller DNA fragments are more compatible for the efficient detection of mutations using the SSCP method (Sheffield et al., 1993). PCR amplification of the AR promoter region was successful for all 240 patients and 30 controls as judged by agarose gel electrophoresis, and did not reveal any gross aberrations in patients or controls (Figure 2). Using SSCP, no mobility shifts could be discerned between patients or controls (Figures 3A and 3B).
|
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Germline mutations in gene promoter/regulatory regions have been implicated in the pathogenesis of several disorders including ß-thalassaemia, retinoblastoma, haemophilia B Leyden (reviewed in Cooper, 1992
), coronary artery disease (Jansen et al., 1997), familial combined hyperlipidaemia (Yang et al., 1995) and atherosclerosis (Kontula and Ehnholm, 1996). These mutations are typically associated with quantitative changes in transcriptional activity, attributable to altered binding of trans-acting protein factors to specific DNA sequences resident in the promoter region.
The AR gene promoter region does not contain an easily distinguishable TATA or CAAT box, two common motifs recognized by components of the transcription machinery. It is characterized by a long (~90 bp) homopurine/homopyrimidine (pur/pyr) stretch located immediately upstream of a GC-box (nuclotides –59 to –32) which binds the constitutive activator SP1 (Faber et al., 1993). In addition to SP1, transcriptional activity is mediated by the cAMP-response element binding protein factor and AP2 (Mizokami et al., 1994). Transcriptional initiation occurs in two regions, AR-TIS I (transcription beginning at nucleotides +1, +2 or +3) and AR-TIS II (transcription-initiation at nucleotides +12 or +13) (Faber et al., 1991; Jenster et al., 1995). Deletion of the pur/pyr stretch has been shown to confer a 3-fold reduction in promoter activity in vitro (Mizokami et al., 1994). This could be due to the removal of multiple weak SP1 binding sites resident in this region, which may function as a reservoir channelling this transcription factor to the adjacent functional GC-box (Chen et al., 1997). Abolishment of the SP1 binding site by site-directed mutagenesis of the GC-box prevents transcription from AR-TIS II (Faber et al., 1993). Transcription from AR-TIS I is dependent upon unresolved sequences in the region –5 to +57 (Faber et al., 1993). Mizokami and Chang (1994) have identified a 181 bp region (+21 to +202) which they suggest plays an essential role in the induction of AR translation. Particularly important was the sequence from +109 to +129 which is predicted to form a stem-loop secondary structure. More recently, Takane and McPhaul (1996) described two functional sequence elements that show similarity to the consensus binding site of the helix–loop–helix (HLH) family of proteins. These are located at positions –168 to –152 (HL1) and –19 to –14 (HL2) and their disruption leads to 40–60% reduction of promoter activity in vitro.
Based on the above observations, we screened the 5'UTR (nucleotides –153 to +237) of the AR gene for mutations in the above sequence motifs which could possibly cause male infertility through reduction of transcriptional and/or translational competence. Using the PCR–SSCP technique, we were unable to detect mutations in this region. For the PCR fragment lengths screened in this study, detection of 70–95% of all mutations present would be expected (Orita et al., 1989; Michaud et al., 1992; Sheffield et al., 1993). Given the relatively large cohort screened in this study it is, however, most likely that mutations within the region examined are rare in infertile men. Additionally, this method was successfully used by Crocitto et al. (1997) who detected two independent germline point mutations in the AR gene 5' UTR (positions +2 and +214) of two men with prostate cancer.
Our data thus supports the observation that promoter mutations, both in the AR gene (Crocitto et al., 1997) and in general (Cooper, 1992) are infrequent. However, it is conceivable that mutations which result in subtle reduction of promoter activity are located in regions of the AR gene 5' UTR not examined here. Mizokami et al. (1994) have identified numerous sequences located further upstream which bear similarity to the consensus DNA binding motifs for AP-1, cAMP response element binding protein, interleukin-6, NF-1 and retinoic acid receptor. A mutational analysis of these regions in the present cohort of patients is currently being undertaken.
|
Notes |
|---|
1 To whom correspondence should be addressed
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Aiman, J. and Griffin, J.E. (1982) The frequency of androgen receptor deficiency in infertile men. J. Clin. Endocrinol. Metab., 54, 725–732.[Abstract]
Beato, M. (1989) Gene regulation by steroid hormones. Cell, 56, 335–344.[ISI][Medline]
Chen, S., Supakar, P.C., Vellanoweth, R.L. et al. (1997) Functional role of a conformationally flexible homopurine/homopyrimidine domain of the androgen receptor gene promoter interacting with Sp1 and a pyrimidine single strand DNA-binding protein. Mol. Endocrinol., 11, 3–15.
Cooper, D.N. (1992) Regulatory mutations and human genetic disease. Ann. Med., 24, 427–437.[Medline]
Crocitto, L.E., Henderson, B.E. and Coetzee, G.A. (1997) Identification of two germline point mutations in the 5'UTR of the androgen receptor gene in men with prostate cancer. J. Urol., 158, 1599–1601.[Medline]
Faber, P.W., Rooij, H.C.J., Korput, H.A.G.M. et al. (1991) Characterisation of the human androgen receptor transcription unit. J. Biol. Chem., 266, 10743–10749.
Faber, P.W., van Rooij, H.C., Schipper, H.J. et al. (1993) Two different, overlapping pathways of transcription initiation are active on the TATA-less human androgen receptor promoter. The role of Sp1. J. Biol. Chem., 268, 9296–9301.
Jansen, H., Verhoeven, A.J., Weeks, L. et al. (1997) Common C-to-T substitution at position –480 of the hepatic lipase promoter associated with a lowered lipase activity in coronary artery disease patients. Arterioscler. Thromb. Vasc. Biol., 17, 2837–2842.
Jenster, G., van der Korput, H.A., Trapman, J. et al. (1995) Identification of two transcription activation units in the N-terminal domain of the human androgen receptor. J. Biol. Chem., 270, 7341–7346.
Kontula, K. and Ehnholm, C. (1996) Regulatory mutations in human lipoprotein disorders and atherosclerosis. Curr. Opin. Lipidol., 7, 64–68.[Medline]
Michaud, J., Brody, L.C., Steel, G. et al. (1992) Strand-separating conformational polymorphism analysis:efficacy of detection of point mutations in the human ornithine delta-aminotransferase gene. Genomics, 13, 389–394.[ISI][Medline]
Mizokami, A. and Chang, C. (1994) Induction of translation by the 5'-untranslated region of human androgen receptor mRNA. J. Biol. Chem., 269, 25655–25659.
Mizokami, A., Yeh, S.Y. and Chang, C. (1994) Identification of 3',5'-cyclic adenosine monophosphate response element and other cis-acting elements in the human androgen receptor gene promoter. Mol. Endocrinol., 8, 77–88.[Abstract]
Morrow, A.F., Gyorki, S., Warne, G.L. et al. (1987) Variable androgen receptor levels in infertile men. J. Clin. Endocrinol. Metab., 64, 1115–1121.[Abstract]
Orita, M., Suzuki, Y., Sekiya, T. et al. (1989) Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics, 5, 874–879.[ISI][Medline]
Quigley, C.A., De Bellis, A., Marschke, K.B. et al. (1995) Androgen receptor defects: historical, clinical, and molecular perspectives. Endocr. Rev., 16, 271–321.[ISI][Medline]
Sheffield, V.C., Beck, J.S., Kwitek, A.E. et al. (1993) The sensitivity of single-strand conformation polymorphism analysis for the detection of single base substitutions. Genomics, 16, 325–332.[ISI][Medline]
Takane, K.K. and McPhaul, M.J. (1996) Functional analysis of the human androgen receptor promoter. Mol. Cell. Endocrinol., 119, 83–93.[ISI][Medline]
Tincello, D.G., Saunders, P.T., and Hargreave, T.B. (1997) Preliminary investigations on androgen receptor gene mutations in infertile men. Mol. Hum. Reprod., 3, 41–43.
Tsukada, T., Inoue, M. and Tachibana, S. et al. (1994) An androgen receptor mutation causing androgen resistance in undervirilized male syndrome. J. Clin. Endocrinol. Metab., 79, 1202–1207.[Abstract]
Tut, T.G., Ghadessy, F.J., Trifiro, M.A. et al. (1997) Long polyglutamine tracts in the androgen receptor are associated with reduced transactivation, impaired sperm production, and male infertility. J. Clin. Endocrinol. Metab., 82, 3777–3782.
Wang, Q., Ghadessy, F.J. and Yong, E.L. (1998) Analysis of the transactivation domain of the androgen receptor in patients with defective spermatogenesis. Clin. Genet., in press.
Yang, W.S., Nevin, D.N., Peng, R. et al. (1995) A mutation in the promoter of the lipoprotein lipase (LPL) gene in a patient with familial combined hyperlipidiemia and low LPL activity. Proc. Natl. Acada. Sci. USA, 92, 4462–4466.
Yong, E.L., Ng, S.C., Roy, A.C. et al. (1994) Pregnancy after hormonal correction of severe spermatogenic defect due to mutation in androgen receptor gene. Lancet, 344, 826–827.
Yong, E.L., Abdullah, A.A.R., Choo, C.K. et al. (1996) Mild androgen insensitivity and male infertility: substitution in the ligand-binding domain of the androgen receptor that impairs transactivation but not androgen binding. Am. J. Hum. Genet., 59, (Suppl.), A43.
Submitted on August 28, 1998; accepted on December 11, 1998.
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||