Molecular Human Reproduction, Vol. 5, No. 4, 311-322,
April 1999
© 1999 European Society of Human Reproduction and Embryology
Identification of structural elements of the testis-specific voltage dependent calcium channel that potentially regulate its biophysical properties
1 Department of Research, North Shore University Hospital-New York University School of Medicine, Manhasset, New York, 2 Department of Obstetrics & Gynecology, North Shore University Hospital-New York University School of Medicine, 3 Departments of Obstetrics & Gynecology and Cell Biology, New York University School of Medicine
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Calcium influx through voltage-dependent calcium channels regulates the physiological acrosome reaction of mammalian spermatozoa. Expression of the mRNA for these voltage-dependent calcium channels and its coordinated translation is initiated early in rat male germ line development and continues throughout spermatogenesis. Herein, we report the complete mRNA and deduced amino acid sequence of the
1C pore-forming subunit of the rat testis-specific L-type calcium channel. This subunit is transcribed from the 1C gene, which is also expressed in brain and cardiac muscle. The cardiac- and testis-specific isoforms of the 1C subunit are produced by alternate splicing of the same primary transcript. The testis-specific isoform differs from that of cardiac tissue at its amino terminus and in transmembrane segments IS6, IIIS2 and IVS3, which are also dihydropyridine binding sites. In somatic tissues, segments S2 and S3 regulate channel activation while the amino terminus and segment IS6 contribute to channel inactivation kinetics. The amino terminus and IS6 segment of the testis-specific 1C subunit are also expressed respectively, in the brain and in smooth muscle from lung where they alter the electrophysiological characteristics of the subunit to produce relatively slow inactivation kinetics. These findings provide a molecular explanation for the detection by others, by patch clamp analysis, of T-type calcium currents in immature spermatogenic cells and of atypical L-type calcium currents in mature spermatozoa. acrosome reaction/alternative splicing/alternative promoters/calcium channel/calcium currents
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
The mammalian sperm acrosome reaction is a calciumdependent process (Yanagimachi and Usui, 1974
) that is regulated by voltage-dependent calcium ion channels (VDCC) located in the sperm head plasma membrane (for review, see Benoff, 1998). As in somatic cells, sperm VDCC exist in three states: (i) closed; (ii) inactivated; and (iii) open with current flowing, and are activated by membrane depolarization. In vivo, this depolarization is effected by progesterone (Foresta et al., 1993) and ATP (Foresta et al., 1992), and by contact with the zona pellucida (Florman et al., 1992; Arnoult et al., 1996a). In somatic cells, the amount of depolarization required to produce a calcium current varies, depending on which of at least seven different genes for the pore-forming 1 subunit of the VDCC was expressed (Perez-Reyes and Schneider, 1995; Perez-Reyes et al., 1998).
The nature of sperm VDCC has been a matter of considerable speculation. Their indirect characterization by electrophysiology remains equivocal. VDCC can be broadly characterized as low voltage-activated (e.g. T-type) or as high voltage-activated (e.g. L-type) (for review, see Benoff, 1998). In somatic cells, there is limited evidence for a role for T-type VDCC in secretory events (see Arnoult et al., 1996b). However, T-type currents have been recorded following patch clamp analysis of immature spermatogenic cells (Arnoult et al., 1996b; Santi et al., 1996), but T-type currents have not been detected after transfer of ion channels from mature spermatozoa to planar lipid bilayers (e.g. Tiwari-Woodruff and Cox, 1995). As a result of these observations, one group of researchers has cited the same membrane potential measurements to first characterize the mammalian sperm VDCC as `L-like' (Florman et al., 1992) and then as `T-type' (Arnoult et al., 1996b; Florman et al., 1998). Nevertheless, the currents described are in fact closer to those of L-type than T-type channels (Hosey and Landunski, 1988; Meir and Dolphin, 1998).
Pharmacological studies have not clarified this situation. The effects of calcium channel blockers on spermatogenesis and on acrosome exocytosis differ among man and animal systems (see Goodwin et al., 1997a; Benoff, 1998). Antagonists of both L-type (Florman et al., 1992; Florman, 1994) and T-type (Arnoult et al., 1996b) calcium channels attenuate depolarization-induced responses in spermatozoa. Unfortunately, L-type calcium channel blockers can inhibit T-type channels (Akaike et al., 1989) and good, highly-specific antagonists of T-type channels have not been identified (Bezprozvanny and Tsien, 1995; Randall and Tsien, 1997). The marked concentration dependence (Akaike et al., 1989; Mlinar and Enyeart, 1994), and voltage dependence (Bezprozvanny and Tsien, 1995) of channel selectivity of these pharmacological agents further complicates interpretation of inhibitor studies.
Molecular studies now offer a solution. More than one type of 1 subunit may be involved in the expression of T-type calcium currents (Piedras-Renteria et al.,1997; Meir and Dolphin, 1998), with a `T-type' channel formed by homo-oligomerization (Meir and Dolphin, 1998). Expression both in vivo and in vitro of different 1 subunits derived from somatic tissues has shown that genotype does not necessarily correlate with the phenotype produced, e.g. L-type 1 subunit expression has been associated with production of T-type currents (Biel et al., 1990; Rich et al., 1993; Lievano et al., 1994; Nakayama and Brading, 1996; Janssen, 1997; Meir and Dolphin, 1998). The possibility that this may be true in spermatozoa suggests that direct examination of calcium channel gene expression in testis and spermatozoa may help resolve the controversy concerning the identification of sperm VDCC.
It has been demonstrated that multiple mechanisms are employed in the regulation of gene expression in testis (for review, see Eddy and O'Brien, 1998). For example, a gene may exhibit tissue-restricted (testis-specific) expression. Alternatively, a particular gene may be a member of a gene family expressed in somatic cells. If so, its transcripts may be shared by somatic and germ cells or may be spermatogenic cell-specific. These germ cell-specific transcripts may arise from different parts of the genome, or reuse the same region of a chromosome, but invoking alternate promotors, transcription termination sites, or polyadenylation sites, or it may involve alternate mRNA splicing. It is of particular relevance to our study that, in some cases, a combination of mechanisms are employed, e.g. differential promotor utilization and alternate splicing (Lin and Morrison-Bogorad, 1991). Such alternate promoters control translation potential of testis-specific mRNAs (Gu et al., 1995; Yiu et al., 1995) while the amino terminal sequences of the encoded proteins may regulate their properties (Bolger et al., 1996).
We have previously reported a partial sequence of an L-type VDCC isoform of rat testis produced by alternate splicing of the cardiac 1C gene primary transcript which is present in seminiferous epithelium throughout spermatogenesis (Goodwin et al., 1997a, 1998a). This testis-specific VDCC isoform differed from cardiac muscle VDCC only in two small transmembrane regions. These regions have been implicated in channel activation and binding of dihydropyridine calcium channel blockers. We now report a rat testis mRNA sequence homologous to the rat cardiac 1C subunit of L-type VDCC, spanning nucleotides –214 to 6695 (end of coding sequence). Two additional sequence differences near the 5' end of the coding sequence have been identified in a region known to modulate channel inactivation. The relationship between the unique structure of the testis-specific L-type VDCC 1C subunit and the potential electrophysiological properties of this channel are discussed.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Products and reagents
All polymerase chain reaction (PCR) reagents were purchased from Perkin-Elmer (Foster City, CA, USA). All other enzymes were obtained from New England Biolabs (Beverly, MA, USA). Molecular weight markers were obtained from Gibco Laboratories (Grand Island, NY, USA). Unless otherwise noted, all other reagents were purchased from Sigma Chemical Co (St Louis, MO, USA).
Isolation of rat tissue RNA
Total RNA was isolated from various rat tissues (Sprague–Dawley males, aged 6 months and weighing 300–400 g) using guanidinium thiocyanate–phenol–chloroform extraction following a modified protocol of Chomcznski and Sacchi (1987) as previously described (Goodwin et al., 1997a).
Sertoli cell culture
Sertoli cell cultures from a Balb/c mouse were purchased from the American Type Cell Culture (ATCC CRL-1715, TM4; Rockville, MD, USA) and grown under conditions specified by the provider. Briefly, the cells were passaged in culture medium composed of a 1:1 mixture of Ham's F12 medium with Dulbecco's modified Eagle's medium (containing 1.2 g/l sodium bicarbonate, 15 mM HEPES, 4.5 g/l glucose), 92.5%, horse serum 5%, fetal bovine serum 2.5%. Total RNA was isolated from several confluent cell flasks using guanidinium thiocyanate–phenol–chloroform extraction following a modified protocol of Chomcznski and Sacchi (1987), as described by Goodwin et al. (1997a).
First strand synthesis
First strand cDNA was synthesized according to the manufacturer's instructions using a reverse transcription system kit (Promega, Madison, WI, USA) as previously described (Goodwin et al., 1997a).
PCR primers
Oligonucleotide primers were synthesized on an Applied Biosystems Model 394 DNA Synthesizer (Foster City, CA, USA). Sets of primers [forward (F) and reverse (R)] were designed from a previously published rat sequence of 1C subunit of L-type VDCC (dihydropyridine receptor) isolated from cardiac (Koch et al. 1989, 1990; Accession Nos. M59786, M34364) and brain (Snutch et al., 1991; Accession No. M67516) tissue. The number in the primer identifiers represents the first nucleotide base from which the primer was derived either in the forward or reverse direction:
RACH5'UT 5'GGAGGCGGTAGTGGAAAGCAGCA;
RBC 1F 5'ATGGTCAATGAAAACACCAGGTGTAC;
RACH 186F 5'ACAATGATTCGGGCCTTCGCTCAGCCA;
RACH 390R 5'GTCCTGCAGCTGCATTGGCATTCAT;
RACH 643R 5'CACAATGCTGATGCATGCCCTCCTGATG;
RACH 835R 5'TGGAAGAGTAGTCCGTAGGCAATCAC;
RACH 1185F 5'GCATAATAGATGTTCCAGCGGAAGAGGA;
RACH 1705R 5'GGTGTTGACAGACTTAGTCTCACTTGT;
RACH 2107R 5'ATCTTCGTCTCCACCAGGATGGTCTCC.
Generation of double-stranded cDNA
The above primers were used in PCR reactions with 50–100 ng rat testis (or other tissue where applicable) first strand cDNA in a 100 µl reaction as previously described (Goodwin et al., 1997a). The PCR conditions were 94°C for 30 s, 72°C for 2–4 min for 30 cycles in a Thermo-cycler model 9600 (Perkin-Elmer, Foster City, CA, USA).
Cloning of PCR products
All PCR products were visualized by ethidium bromide staining of a 1% agarose gel and gel purified using Wizard PCR Preps (Promega, Madison, WI, USA) according to the manufacturer's instructions. The purified PCR products were ligated into pT7 blue vector (Novagen, Madison, WI, USA) at 16°C overnight as previously described (Goodwin et al., 1997a).
DNA sequence analysis
Selected clones were sequenced using automated DNA Sequencing System Model 373A (Applied Biosystems DNA Sequencer, Foster City, CA, USA) following the manufacturer's protocols for fluorescence-based DNA sequencing with Taq polymerase. All sequencing primers were 18 nucleotides in length. Partial sequences were compiled and aligned with cardiac muscle 1C L-type VDCC sequence (Koch et al., 1989, 1990) as well as other VDCC sequences (Catterall, 1988; Mikami et al., 1989; Snutch et al., 1991; Tsien et al., 1991; Diebold et al., 1992; Perez-Reyes et al., 1998) with MacVector 5.0 Program (Kodak, New Haven, CT, USA), or BLAST 2 database program from the National Center for Biotechnology Information (Bethesda, MD, USA). Secondary structure predictions were determined using General Protein Mass Analysis for Windows, Version 2.13a (Lighthouse data, Odense SV, Denmark) or, alternatively, PC/GENE (Release 6.8, Oxford Molecular Group, Beaverton, OR, USA).
Northern blot analysis
Total RNA (10 µg) from a variety of rat tissues were size separated on denaturing agarose gels, transferred to MSI nylon membrane (Micron Separation Inc, Westboro, MA, USA) and hybridized with [32P]-random primed probes [pRACH62, a 2169 nucleotide clone containing rat testis-specific 1C sequence (Goodwin et al., 1997a) or actin cDNA from exon 4 and 5] following previously published protocols (Maniatis et al., 1987).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Functional expression of the cloned
1C subunit from the cardiac L-type VDCC, a protein with 24 transmembrane segments (Figure 1), indicated that it forms the pore of the ion channel and induces calcium currents which are both voltage-sensitive and inhibited by dihydropyridines (Mikami et al., 1989). The full length cDNA of the testis-specific 1C subunit was assembled from a series of overlapping cloned sequences (Figure 1). This cDNA construct begins with sequence (GCCAATGG), in good agreement with the consensus translation initiation sequence (Kozak, 1991), preceding a long open reading frame of 2138 amino acids, similar in size to 1 sequences in somatic tissues. Alignment of the respective nucleotide and deduced amino acid sequences of the rat testis and rat cardiac (Koch et al., 1989, 1990) 1C cDNAs showed strong conservation (>95%; Figures 2A,B), as does that between rat brain (Snutch et al, 1991; Accession # M67516) and rat testis (>98%, not shown). Herein, we concentrate upon the sequence of the testis-specific 1C subunit in and around its amino terminus which differs significantly from that of the cardiac muscle 1C subunit.
|
|
Tissue-specific expression of the L-type VDCC
1C subunitTo examine the role of tissue-specific gene transcription in the regulation of expression of the
1C subunit of the L-type VDCC, Northern blots were prepared using equal amounts (10 µg) of total RNA from a variety of rat tissues. These blots were probed with [32P]-labelled clone pRach62, a 2169 bp fragment of the testis-specific 1C subunit encompassing part of the domain III and all of domain IV (Goodwin et al., 1997a). Hybridization signals were observed only in the lanes containing RNAs from heart and skeletal muscle (Figure 3A). The size of the 1C subunit transcripts differed significantly between these tissues. The heart transcript was ~8.5 kb in length and the skeletal muscle was 6.5 kb, both consistent with reports from other laboratories (Tanabe et al., 1987; Koch et al., 1990). Even after a 2 week exposure, we were unable to detect a transcript of corresponding size in testis tissue (data not shown).
|
- and To eliminate the possibility that our failure to detect hybridization in the testis RNA lane was due to RNA degradation or lower RNA loading, blots were stripped and reprobed with [32P]-labelled cloned actin sequences from exons 4 and 5 (Figure 3B
). Two observations were made: (i) the hybridization signals after 2 days exposure were intense and equal in all lanes; and (ii) we detected two classes of actin mRNA in heart, skeletal muscle and testis, confirming a prior report (Waters et al., 1985).
A preliminary study suggested that 1C transcripts in testis were present in low copy number (Snutch et al., 1991). These data confirm that the transcript for the 1C subunit is of low abundance in testis.
Identification of the amino terminus of the rat testis-specific 1C subunit of the VDCC
In all, 20 attempts to amplify the 5' end of the testis-specific 1 transcript using primers RACH 186F and RACH 643R, derived from the 1C sequence of cardiac muscle, failed to yield a PCR product. Attempts to optimize PCR conditions by using magnesium titrations and varying concentrations of cDNAs and/or primers did not rectify this problem.
The 1C subunit is expressed in heart, smooth muscle and neurons (Birnbaumer et al., 1994). In these tissues, the amino terminus exhibits considerable structural diversity (Biel et al., 1991; Hui et al., 1991; Snutch et al., 1991). Given prior evidence for common cis-regulatory elements controlling transcription (e.g. Widlak et al., 1995) and translation (e.g. Han et al., 1995a,b) in brain and testis and for shared gene expression (e.g. Sharma et al., 1992; Hoog, 1995), we attempted to amplify the 5' end of the testis-specific 1C transcript using a forward primer derived from the amino terminus of the rat brain coding sequence (RBC 1F) and a reverse primer derived from the second exon of the rat cardiac 1C sequence (RACH 390R). A robust PCR product was readily obtained. These data provide the first evidence for tissue restriction of expression of the 5' end of the testis-specific 1C subunit.
The sequence immediately following the initiator methionine of the long open reading frame in the rat testis 1C subunit of the L-type VDCC encodes a shortened amino terminus of 16 amino acids very different from the 46 amino acid rat cardiac amino terminus (Figure 2B). The amino terminal sequence of the rat testis 1C subunit is identical to that of rat brain (Snutch et al., 1991; Diebold et al., 1992). This sequence is highly conserved across species as 15 of its 16 amino acid residues are identical to the human fibroblast (Soldatov, 1992) and the rabbit smooth muscle (Biel et al., 1990) 1C amino termini.
We have compared the predicted secondary structure of the testis-specific amino terminus with that of the cardiac isoform by the method of Garnier et al. (1978) (data not shown). The results indicate that the amino terminus of the testis-specific isoform would be less likely to be -helical, and should have a more random coiled structure than cardiac muscle. Examination of the expression of amino terminal deletion mutants of the cardiac 1C subunit in Xenopus oocytes indicated that shortening of the amino terminus was associated with increased VDCC expression (Wei et al., 1996). Therefore, these findings suggest that the shortened amino terminus of the 1C subunit identified in rat testis may provide a mechanism to increase the number of functional channels encoded by a rare mRNA.
Consensus donor and acceptor splice junction sequences (AG/GT; Mount, 1982) occur at the first point in the 3' direction where base sequences of the rat testis and rat cardiac cDNAs were identical. These sequences also occur at the boundary between exons 1 and 2 in the human fibroblast 1C sequence (Soldatov, 1994). Therefore, to directly examine the role of alternate splicing in the production of the testis-specific 1C, rat genomic DNA was used in an attempt to generate a PCR product encompassing exons 1 and 2 of the testis-specific sequence. No product was obtained. Attempts to amplify exons 1 and 2 of the cardiac sequence were similarly unsuccessful. These failures suggest that these exons are separated by >10 kb of intronic sequence (Snutch et al., 1991). The organization of the 1C sequence has only been reported for the human gene (Soldatov, 1994) where exons 1 and 2 are separated by >10 kb. Although only one form of exon 1 was reported for human, comparison of the amino terminal sequences of the human fibroblast and human cardiac 1C cDNAs (Schultz et al., 1993; Soldatov, 1994) suggest the existence of an alternate exon 1 and a more complex splicing pattern for the amino terminus. As Southern blot analysis has revealed that the rat genome contains only a single copy of the 1C gene (Snutch et al., 1991), these data taken together indicate that the heterogeneity between the amino termini of the testis and cardiac 1C proteins is the result of mutually exclusive splicing events.
Tissue restriction of the amino terminus of the testis-specific 1C isoform
To confirm the above findings, reverse transcription–polymerase chain reactions (RT–PCR) reactions were performed using a variety of rat tissues with forward primers specific to the cardiac muscle amino terminus (RACH 186F) or the brain/fibroblast amino terminus (RBC 1F) and the reverse primer from a common region (RACH 643R) (Figure 4).
|
The brain/fibroblast 5' primer demonstrated the presence of transcript in testis and brain tissue (Figure 4A
) but no transcript was detectable in any other tissue (except lung, which had a very faint product, not shown). A 5' primer specific to the cardiac form of the 1C subunit was used in parallel RT–PCR reactions with RNA from the same tissues. The only detectable transcript was in heart (Figure 4B). Cloning and sequencing as well as direct sequencing of these PCR products determined they contain only the sequence of the tissue specific-transcript.
When in-situ RT–PCR was performed, the transcript for the VDCC was detected in Sertoli cells of rat testis sections (Goodwin et al., 1998a). Therefore, Sertoli tissue culture cells (ATCC CRL-1715) that were grown in culture for RNA extraction were examined the expression of the 1C subunit by RT–PCR. Both the cardiac and testis amino terminal sequences were expressed (data not shown). As the cardiac amino terminus appeared in none of the rat testis cDNA preparations examined (see above), a predominantly Sertoli cell population was examined within the context of the testis tissue. RNA was extracted from the testis of prepuberal rats aged <2 weeks. These testes contain Sertoli cells and spermatogonia but no dividing germ cells (Clermont and Perey, 1957). While primers specific for the amino terminus of the 1C sequence found in adult rat testis generated a robust PCR product, no transcript containing the amino terminus expressed in cardiac muscle was detected in three different experiments. This result again confirmed that expression of the amino terminus of the testis-specific 1C isoform is tissue restricted. Either the ATCC CRL-1715 tissue culture population was not clonal or expression of the cardiac-specific amino terminus was the result of cell transformation. The latter has been observed in relation to 1 subunit expression in cultured somatic cells (e.g. Brereton et al., 1997).
Comparison of the structure of the 5' untranslated sequences of the testis and cardiac 1C transcripts
In all, 214 nucleotides of the 5' untranslated region (UTR) of the testis-specific 1C transcript were cloned. Its sequence was compared with the 188 nucleotides of the 5' UTR of the rat cardiac sequence (Koch et al., 1989; Figure 5A) and 214 nucleotides of rat brain sequence (Accession # M67516, not shown). Sequence alignment was performed with both the MacVector 5.0 alignment program and BLAST 2 alignment, which introduces gaps to optimize alignment. No sequence homology was detected between the rat cardiac and rat testis 5' UTR with either program. However, the 5' UTR of rat testis and rat brain are identical in this region (data not shown).
|
The important features of the 5' UTR of the testis-specific sequence are depicted in Figure 5B
. Although the cardiac 1C isoform promoter contains a related TATA sequence (Mitchell and Tjian, 1989) and other high voltage-activated 1 subunits promoters contain the canonical TATA box sequence (Hui et al., 1991), the testis-specific 5' UTR has no TATA-like structure. In addition, the testis-specific 5' UTR is more GC-rich than that of the cardiac sequence (55 versus 42%) and its GC-rich regions are upstream of the cap site region. There are consensus sequences for the RNA polymerase II transcription activator SP1 (GGGCGG; Kadonaga et al., 1986) further upstream. Finally, the 5' UTR contains multiple transcription start sites. At least three short open reading frames have been identified in the 5' direction of transcription and two occur in the reverse direction.
The motifs identified in the 5' UTR of the testis-specific 1C cDNA are shared with other genes specifically expressed in the male germ line (McCarrey, 1987; Virbasius and Scarpulla, 1988; Kilpatrick et al., 1990). These findings indicate that alternate promotor usage contributes to the production of the testis-specific isoform of the 1C subunit of the L-type VDCC.
Additional diversity generated by alternative exon usage in transmembrane segment IS6
Approximately one third of the clones isolated from PCR products which encoded homologous repeat domains I and II (see Figure 1) showed molecular diversity in transmembrane region IS6. In the human gene, this region is encoded by exon 8 (Soldatov, 1994). Based on observations that the IS6 expressed in rabbit (Mikami et al., 1989) and human cardiac (Schultz et al., 1993) and mouse brain forms of the 1C subunit (Ma et al., 1992) differ from human fibroblasts, the existence of an alternate exon 8 before or after the normal exon 8 has been suggested (Soldatov, 1994). Consistent with this suggestion, consensus splice junction sequences flank the sequences encoding these two IS6 segments (Mount, 1982). Thus, at least two different 1C proteins may co-exist in rat testis.
Alternative exons 8 encode a 34 amino acid peptide which encompass the transmembrane IS6 segment as well as the proximal parts of its surrounding linker regions (Figure 2B). There are four amino acid changes in the IS6 transmembrane segment itself. Three are conservative, and the fourth change substitutes a bulky hydrophobic residue (phenylalanine) for a smaller hydrophobic residue (isoleucine) in the testis-specific sequence.
IS6 and its flanking extracellular and intracellular linker regions have been identified as molecular determinants of voltage-dependent inactivation in calcium channels (Zhang et al., 1994). It is therefore of interest that, in the clones characterized and sequenced, the predominant form of IS6 (cardiac form) exhibits 13 amino acid differences from skeletal muscle 1S isoform whereas the alternatively expressed isoform (fibroblast and/or smooth muscle) differs only in six amino acid residues. Expression of the fibroblast form of IS6 should produce a VDCC with relatively slow tail current decay kinetics (Tanabe et al., 1991). The ratio of cardiac to smooth muscle isoforms found in testis is 2:1, suggesting there may be a broader range of inactivation kinetics than those observed in cardiac tissue. This may alter the physiological character of the channel.
The predicted secondary structures of the alternate IS6 segments expressed in testis do not differ (data not shown). Mutations in the linker region between transmembrane segments IS5 and IS6 in related sodium and potassium channels are sufficient to alter ion permeation (e.g. MacKinnon and Yellen, 1990; Hartmann et al., 1991). Therefore, the predicted secondary structure of the alternate IS6 segments in the context of their surrounding sequences was also examined (Figure 6). Nine amino acid substitutions have been identified in the linker region between IS5 and IS6 in the testis-specific 1C isoform: [1] aspartic acid for asparagine, [2] glycine for lysine, [3] alanine for threonine, [4, 5] valine for methionine, [6] asparagine for glutamine, [7] arginine for tyrosine, (8) aspartic acid for glutamic acid, and [9] tryptophan for leucine (Figure 2B). Changes 1 through 3 are encoded by exon 7, while changes 4 through 9 by alternate exon 8. Change number 2 results in a increase in beta-turn probability and changes numbers 4 through 9 are associated with a second increase in beta-turn probability (Figure 6A). Analysis of the results of these amino acid substitutions by the method of Garnier et al. (1978) indicates a substantial loss of -helical structure in the region between the two increases in ß-turn probabilities (not shown). In the cardiac-specific sequence (which exhibits a lower ß-turn probability; Figure 6B), and in related potassium channels, this region is thought to contribute to the selectivity gate of the pore of the channel (Doyle et al., 1998).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
It has been demonstrated that an L-type VDCC is expressed in rat and human testis (Goodwin et al., 1997a
,b,c, 1998a). Mature rat and human spermatozoa express a head plasma membrane-associated protein which is antigenically related to the L-type dihydropyridine receptor of skeletal muscle (Goodwin et al., 1997a). Preliminary findings indicate that L-type VDCC 1C transcripts are similarly present in human testis and, more importantly, in ejaculated human sperm VDCC (Goodwin et al., 1998b,c). In this report, we have completed the cloning and sequencing of the 1C subunit of the L-type VDCC from rat testis. This subunit has >95% homology with that of the cardiac muscle VDCC, except for four regions of sequence diversity derived by alternative exon usage: at the 5' end and in transmembrane regions IS6, IIIS2 and IVS3 (Goodwin et al., 1997a,1998a; and this report). There are two major findings reported in this paper.
Firstly, we have determined that the amino terminus of the testis-specific 1C unit is completely different from that of cardiac muscle (Koch et al., 1989,1990). This alternative amino terminus has been detected only in brain (Snutch et al., 1991), lung smooth muscle (Biel et al., 1990) and fibroblasts (Soldatov, 1992). Although `cassette'-like, highly conserved peptide sequences are common to the spliced products of all L-type Ca2+ channel genes (Koch et al., 1990; Biel et al., 1991; Snutch et al., 1991; Diebold et al., 1992; Soldatov, 1992,1994,1995; Perez-Reyes and Schneider, 1995), only the amino terminus region is spliced in a tissue-specific manner (Perez-Reyes and Schneider, 1995) and, by analogy with related potassium channels where the cytoplasmic amino terminus can directly occlude the central ion pore (Hoshi et al., 1990; Demo and Yellen, 1991), may contribute to channel inactivation kinetics (Zhang et al., 1994).
Use of alternate promotor sequences could theoretically drive such splicing. The change in amino acid sequence in the testis-specific 1C subunit occurs at the intron/exon boundary between the first and second exons of the human 1C subunit of the L-type VDCC (Soldatov, 1994) and may represent the use of an alternate promoter to generate the primary transcript in the testis. Both the complete lack of homology between the 5' UTR of the testis- and cardiac-specific 1C cDNAs and the identification of structural features within the 5' UTR of the testis-specific sequence previously identified in other male germ cell-specific promoters support this hypothesis.
Secondly, our characterization of the derived amino acid sequence of the rat testis-specific L-type VDCC 1C subunit provides insight into the regulation of an important calcium-dependent process, the acrosome reaction. We find it of interest that the rat testis-specific 1c subunit is quite similar to the rat brain forms rbC-I and rbC-II (Snutch et al., 1991) in the usage of the alternate amino terminus. This terminus usage may be essential for regulation of tissue-specific functions by modulating the electrophysiological parameters of calcium influx in brain and testis. In addition, one of the rbC isoform, rbC-1, contains the alternatively expressed IVS3 transmembrane segment (encoded by exon 31) which is also shared with testis and skeletal muscle transcripts. Expression studies with cloned 1s indicate this subunit is responsible for the electrophysiological and pharmocological properties of the channel, i.e. slow activation kinetics and dihydropyridine sensitivity (Tanabe et al., 1988; Perez-Reyes and Schneider, 1995). rbC antisense nucleotides can block the expression of rat brain calcium channels induced in Xenopus oocytes by injection of rbC transcript (Snutch et al., 1990). However, the rat brain calcium channel induced in Xenopus is completely insensitive to dihydropyridines and displays different waveforms from those of heart current (Leonard et al., 1987). The differences in physiological properties between the 1C subunits of brain and heart expressed in Xenopus oocytes may be due to structural differences between the two alternatively spliced transcripts. Thus, there is a precedent for fundamental changes in the biophysical properties of splice variants of the 1C subunit. Though, the overall sequence and splice choices of the rat brain and testis are similar, it is important to point out there are several amino acid substitutions that are found in the testis forms that differ both from the cardiac and brain form. There is also the addition of three amino acids found solely in the brain isoform, that may impose a tempering effect on channel kinetics. In support of the dramatic effect that several amino acid substitutions may have on the kinetics of the channel, deletion of a single nucleotide resulting in a frame shift mutation and premature truncation of the 1s subunit before the IVS6 loop results in a non-functional channel (Tanabe et al., 1988).
We also report that transmembrane segment IS6 of the testis-specific 1C subunit differs in sequence from the cardiac 1C sequence and is expressed as the result of alternative splicing. It is present in about one third of all testis-specific VDCC clones and is homologous to the IS6 sequence of the VDCC 1C subunit expressed in smooth muscle from lung (Biel et al., 1990). Like the alternate IIIS2 and IVS3 transmembrane regions of the testis-specific 1C sequence, this region has also previously been demonstrated to be involved in binding of calcium channel blockers (Welling et al., 1993; Doring et al., 1996). Transmembrane segments S2 and S3 are thought to form salt bridges with the voltage sensor transmembrane segment S4 to regulate channel activation (Tsien et al., 1991). Repetitive domain I as a whole is critical in determining both activation kinetics and tail current decay (Tanabe et al., 1991) with the linker between IS5 and IS6 plus transmembrane segment IS6 specifically responsible for modulation of voltage-dependent inactivation (Zhang et al., 1994).
The mechanism by which IS5–IS6 linker and IS6 regulate VDCC inactivation is currently unknown. Perhaps, as for channel activation (Catterall, 1988; Guy and Conti, 1990), inactivation involves conformational change associated with charge movement. Olcese et al. (1997) have inferred slow inactivation of depolarized Shaker potassium channels occurs through such a series of conformational changes. Substantial changes in secondary structure, such as those implied by the comparison of the sequence of the testis-specific IS5–IS6 linker segment with that of the cardiac-specific isoform, suggest that the conformational alterations to some different configuration characteristic of inactivated channels would follow different pathways in the two channels with different time constants. By analogy with potassium channels (Armstrong, 1988; Doyle et al., 1998), IS6 may form the lining of the ion pore and contribute to the ion selectivity filter. The predicted secondary structure of the IS6 region in the testis- and cardiac-specific isoforms is identical. Thus, a net effect of the increased ß-turn probability in the testis-specific IS5–IS6 linker would be to alter the voltage-dependence of inactivation. However, a second effect is also possible. As this linker region contributes to ion selectivity (Doyle et al., 1998), the predicted structural changes in this region could help explain why the testis-specific channel is more sensitive to nickel and less sensitive to cadmium than L-type VDCCs in somatic cells (Florman et al., 1992; Florman, 1994).
Based on studies of expression of intact and chimeric cDNAs for different 1 subunits (Tanabe et al., 1991; Welling et al., 1993; Zhang et al., 1994), it is likely that the alternative IS6 sequence expressed in testis would display a reduced affinity for dihydropyridines and the IS5–IS6 linker/IS6 sequence would exhibit relatively rapid activation kinetics and slow deactivation kinetics. These characteristics are consistent with both the observed slow time course of inhibition of the human sperm agonist-stimulated acrosome reaction by dihydropyridines (Goodwin et al., 1997a) and the biophysical properties of calcium currents in male germ cells (Arnoult et al., 1996b; Santi et al., 1996). That an L-type VDCC would contain an IS5–IS6 linker/IS6 segment, and possibly an amino terminus, that confers slow inactivation kinetics is consistent with an increasing body of evidence that many calcium channels exist that do not exactly fit defined categories (e.g. Ellinor et al., 1993; Sather et al., 1993). In fact, another high voltage-activated VDCC which produces R-type currents (the neuronal 1E subunit; Zhang et al., 1993; Williams et al., 1994; Wakamori et al., 1994; Schneider et al., 1994; Randall and Tsien, 1997) was initially misidentified as a T-type channel because it displayed many properties associated with low voltage-activated channels, such as nickel sensitivity and transient activation (Soong et al., 1993; Bourinet et al., 1996; Piedras-Renteria et al., 1997).
In conclusion, although electrophysiology and sensitivity to pharmacological and inorganic agents can be used to provide information about calcium currents, only molecular cloning allows definitive identification of the VDCC isoform actually producing the current. It is therefore quite provocative that our findings are consistent with prior reports on the expression of the 1C isoform in vitro. For example, 1A, 1B, 1C and 1D subunits, all part of high voltage-activated VDCC, produced both L-type and T-type currents in rat brain and mouse cell lines (Lievano et al., 1994). In addition, expression of rabbit 1B and rat 1C and 1E subunits in COS cells at low depolarization or in the absence of any auxiliary subunits was associated with the production of T-type calcium currents (Meir and Dolphin, 1998). It is also provocative that smooth muscle cells express exclusively the L-type VDCC 1C subunit (Biel et al., 1990; Rich et al., 1993) but display two calcium currents: (i) a high voltage-activated, nifedipine-sensitive current with slow tail current decay, and (ii) a typical L-type current (Nakayama and Brading, 1996; Janssen, 1997). The data reported herein suggest that ejaculated spermatozoa could also express two calcium currents as two IS6 segments are expressed in the adult rat testis RNA preparations examined. These observations are consistent with the existence of two sperm calcium channels which regulate intracellular free calcium levels during the acrosome reaction (Guerrero and Darszon, 1989; Spungin and Breitbart, 1996; Breitbart and Spungin, 1997) and provide the basis for additional studies.
|
Acknowledgments |
|---|
Appreciation is expressed to Colleen Millan for performing the fluorescence-based automated DNA sequencing, to Malcolm Meistrell for rat tissues, to Stephanie Canaras for assistance in proofreading the nucleotide and deduced amino acid sequences, and to George W.Cooper and Asha Jacob for critical reading of the manuscript. Supported by an ASRM/Organon Grant in Reproductive Medicine to L.O.G. and by National Institutes of Health Grant No. ES 06100 to SB.
|
Notes |
|---|
4 To whom correspondence should be addressed
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Akaike, N., Kostyuk, P.G. and Osipchuk, Y.V. (1989) Dihydropyridine-sensitive low-threshold calcium channels in isolated rat hypothalamic neurons. J. Physiol., 412, 181–195.
Armstrong, C. (1998) The vision of the pore. Science, 280, 56–57.
Arnoult, C., Zeng, Y. and Florman, H.M. (1996a) ZP3-dependent activation of sperm cation channels regulates acrosomal secretion during mammalian fertilization. J. Cell Biol., 134, 637–645.
Arnoult, C., Cardullo, R.A., Lemos, J.R. and Florman, H.M. (1996b) Activation of mouse sperm T-type Ca2+ channels by adhesion to the egg zona pellucida. Proc. Nat. Acad. Sci. USA, 93, 13004–13009.
Arnoult, C., Lemos, J.R. and Florman, H.M. (1997) Voltage-dependent modulation of T-type calcium channels by protein tyrosine phosphorylation. EMBO J., 16, 1593–1599.[Web of Science][Medline]
Benoff, S. (1998) Voltage dependent calcium channels in spermatozoa. In Baldi, E. (ed.), Frontiers in Bioscience. Sperm Biology: From Basic to Clinic. Pp. d1220–d1240.
Bezprozvanny, I. and Tsien, R.W. (1995) Voltage-dependent blockage of diverse types of voltage-gated Ca2+ channels expressed in Xenopus oocytes by the Ca2+ channel antagonist mibrefradil (Ro 40–5967). Mol. Pharmacol., 48, 540–549.[Abstract]
Biel, M., Ruth, P., Bosse, E. et al. (1990) Primary structure and functional expression of a high voltage activated calcium channel from rabbit lung. FEBS Lett., 269, 409–412.[Web of Science][Medline]
Biel, M., Hullin, R., Freundner,S. et al. (1991) Tissue-specific expression of high-voltage-activated dihydropyridine-sensitive L-type calcium channels. Eur. J. Biochem., 200, 81–88.[Web of Science][Medline]
Birnbaumer, L., Campbell, K.P., Catterall, W.A. et al. (1994) The naming of voltage-gated calcium channels. Neuron, 13, 505–506.[Web of Science][Medline]
Bolger, G.B., McPhee, I. and Houslay, M.D. (1996) Alternative splicing of cAMP-specific phosphodiesterase mRNA transcripts. J. Biol. Chem., 271, 1065–1071.
Bourinet, E., Zamponi, G.W., Stea, A. et al. (1996) The 1E calcium channel exhibits permeation properties similar to low-voltage-activated calcium channels. J. Neurosci., 16, 4983–4993.
Breitbart, H. and Spungin, B. (1997) The biochemistry of the acrosome reaction. Mol. Hum. Reprod., 3, 195–202.
Brereton, H.M., Harland, M.L., Froscio, M. et al. (1997) Novel variants of voltage-operated calcium channel 1-subunit transcripts in a rat liver-derived cell line: deletion in the IVS3 voltage sensing region. Cell Calcium, 22, 39–52.[Web of Science][Medline]
Catterall, W.A. (1988) Structure and function of voltage-sensitive ion channels. Science, 242, 50–61.
Chomcznski, P. and Sacchi, N. (1987) Single step method of RNA isolation by acid guanidinium thiocyanate–phenol–choloform extraction. Anal. Biochem., 162, 156–159.[Web of Science][Medline]
Chou, P.Y. and Fasman, G.D. (1979) Description of the method implemented in BETATURN. Biophys. J., 26, 367–384.[Web of Science][Medline]
Clermont, Y. and Perey, B. (1957) Study of the cell population of the seminiferous epithelium in the immature rat. Am. J. Anat., 100, 241–268.[Web of Science][Medline]
Demo, S.D. and Yellen, G. (1991) The inactivation gate of the Shaker K+ channel behaves like an open-channel blocker. Neuron, 7, 743–753.[Web of Science][Medline]
Diebold, R.J., Koch, W.J., Ellinor, P.T. et al. (1992) Mutually exclusive exon splicing of the cardiac calcium channel 1 subunit gene generates developmentally regulated isoforms in the rat heart. Proc. Natl. Acad. Sci, USA, 89, 1497–1501.
Doring, F., Degtiar, V.E., Grabner, M. et al. (1996) Transfer of L-type calcium channel IVS6 segment increases phenylalkylamine sensitivity of 1A. J. Biol. Chem., 271, 11745–11749.
Doyle, D.A., Cabral, J.M., Pfuetzner, R.A. et al. (1998) The structure of the potassium channel: molecular basis of K+ conduction and selectivity. Science, 280, 69–77.
Eddy,E.M. and O'Brien, D.A. (1998) Gene expression during mammalian meiosis. Curr. Top. Dev. Biol., 37, 141–200.[Web of Science][Medline]
Ellinor, P.T., Zhang, J.-F., Randall, A.D. et al. (1993) Functional expression of a rapidly inactivation neuronal calcium channel. Nature, 363, 455–458.[Medline]
Florman, H.M. (1994) Sequential focal and global elevations of sperm intracellular Ca2+ are initiated by the zona pellucida during acrosome exocytosis. Dev. Biol., 165, 152–164.[Web of Science][Medline]
Florman, H.M., Arnoult, C., Kazam, I.G. et al. (1998) A perspective on the control of mammalian fertilization by egg-activated ion channels in sperm: a tale of two channels. Biol. Reprod., 59, 12–16.
Florman, H.M., Corron, M.E., Kim, T.D.-H. and Babcock, D.F. (1992) Activation of voltage-dependent calcium channels of mammalian sperm is required for zona pellucida-induced acrosomal exocytosis. Dev. Biol., 152, 304–314.[Web of Science][Medline]
Foresta, C., Rossato, M. and Di Virgilio, F. (1992) Extracellular ATP is a trigger for the acrosome reaction in human spermatozoa. J. Biol. Chem., 267, 19443–19447.
Foresta, C., Rossatao, M. and Di Virgilio, F. (1993) Ion fluxes through the progesterone-activated channel of the sperm plasma membrane. Biochem. J., 294, 279–283.
Garnier, J., Osguthorpe, D.J. and Robson, B. (1978) Analysis of the accuracy and implications for predicting secondary structure of globular protein. J. Mol. Biol., 120, 97–120.[Web of Science][Medline]
Goodwin, L.O., Leeds, N.B., Hurley, I. et al. (1997a) Isolation and characterization of the primary structure of testis-specific L-type calcium channel: implications for contraception. Mol. Hum. Reprod., 3, 255–268.
Goodwin, L.O., Leeds, N.B., Jacob, A. et al. (1997b) Splicing variants of the human testis-specific voltage-dependent calcium (Ca) channel (VDCC): potential contribution to human male infertility and target for contraceptive development. [Abstr. No. O-060.] In Scientific Program and Abstracts of the 53rd Annual Meeting of the American Society for Reproductive Medicine, S30–S31.
Goodwin, L.O., Leeds, N.B. and Benoff, S. (1997c) Characterization of the human testis voltage dependent calcium channel. [Abstr. No. 630] In: Scientific Program and Abstracts of the Society for Gynecologic Investigation, 44th Annual Meeting, p. 238A.
Goodwin, L.O., Leeds, N.B., Hurley, I. et al. (1998a) Alternative splicing of exons in the 1 subunit of the rat testis L-type voltage-dependent calcium channel generates germ line-specific dihydropyridine binding sites. Mol. Hum. Reprod., 4, 215–226.
Goodwin, L.O., Leeds, N.B., Jacob, A. et al. (1998b) The unique structural diversity of the human testis-specific voltage-dependent calcium channel. [Abstr. No. 5] In: Scientific Program and Abstracts of the 23rd Annual Meeting of the American Society of Andrology, p. 26.
Goodwin, L.O., Karabinus, D.S., Hurley, I.R. et al. (1998c) Post-meiotic gene expression in human sperm: detection of the L-type voltage-dependent calcium channel (VDCC) 1 subunit mRNA. [Abstr. No. P250.] In Scientific Program and Abstracts of the American Society for Reproductive Medicine, 54th Annual Meeting, p.S207.
Gu, W., Morales, C. and Hecht, N.B. (1995) In male mouse germ cells, copper–zinc superoxide dismutase utilizes alternate promoters that produce multiple transcripts with different translation potential. J. Biol. Chem., 270, 236–243.
Guerrero, A. and Darszon, A. (1989) Evidence for the activation of two different Ca2+ channels during the egg jelly-induced acrosome reaction of sea urchin sperm. J. Biol. Chem., 264, 19593–19599.
Guy, H.R. and Conti, F. (1990) Pursuing the structure and function of voltage-gated channels. Trends Neurosci., 13, 201–206.[Web of Science][Medline]
Han, J.R., Gu, W. and Hecht, N.B. (1995a) Testis-brain RNA-binding protein, a testicular translational regulatory RNA-binding protein, is present in the brain and binds to the 3' untranslated regions of transported brain mRNAs. Biol. Reprod., 53, 707–717.[Abstract]
Han, J.R., Yiu, G.K. and Hecht, N.B. (1995b) Testis/brain RNA-binding protein attaches translationally repressed and transported mRNAs to microtubules. Proc. Natl. Acad. Sci. USA, 92, 9550–9554.
Hartmann, H.A., Kirsch, G.E., Drewe, J.A. et al. (1991) Exchange of conductance pathways between two related K+ channels. Science, 251, 942–944.
Hoog, C. (1995) Expression of a large number of novel testis-specific genes during spermatogenesis coincides with the functional reorganization of the male germ cell. Int. J. Dev. Biol., 39, 719–726.[Web of Science][Medline]
Hosey, M.M. and Ladunski, M. (1988) Calcium channels: molecular pharmacology, structure and regulation. J. Membr. Biol., 104, 81–105.[Web of Science][Medline]
Hoshi, T., Zagotta, W.N. and Aldrich, R.W. (1990) Biophysical and molecular mechanisms of Shaker potassium channel inactivation. Science, 250, 533–538.
Hui, A., Ellinor, P.T., Krizanova, O. et al. (1991) Molecular cloning of multiple subtypes of a novel rat brain isoform of the 1 subunit of the voltage-dependent calcium channel. Neuron, 7, 35–44.[Web of Science][Medline]
Janssen, L.J. (1997) T-type and L-type Ca2+ currents in canine bronchial smooth muscle: characterization and physiological role. Am. J. Physiol., 272, C1757–C1765.
Kadonaga, J.T., Jones, K.A. and Tjian, R. (1986) Promoter-specific activation of RNA polymerase II transcription by SP1. Trends Biochem. Sci., 11, 20–23.
Kilpatrick, D.L., Zinn, S.A., Fitzgerald, M. et al. (1990) Transcription of the rat and mouse proenkephalin genes is initiated at distinct start sites in spermatogenic and somatic cells. Mol. Cell. Biol., 10, 3717–3726.
Koch, W.J., Hui, A., Schull, G. et al. (1989) Characterization of cDNA clones encoding two putative isoforms of the alpha 1 subunit of the dihydropyridine-sensitive voltage-dependent calcium channel isolated from rat brain and rat aorta. FEBS Lett., 250, 386–388.[Web of Science][Medline]
Koch, W.J., Ellinor, P.T. and Schwartz, A. (1990) cDNA cloning of a dihydropyridine-sensitive calcium channel from rat aorta: Evidence for the existence of alternatively spliced forms. J. Biol. Chem., 265, 17786–17791.
Kozak, M. (1991) Structural features in eukaryotic mRNAs that modulate the initiation of translation. J. Biol. Chem., 268, 19867–19870.
Leonard, J.P., Nargeot, J., Snutch, T.P. et al. (1987) Calcium channels induced in Xenopus oocytes by injection of rat brain mRNA. J Neurosci., 7, 875–881.[Abstract]
Lievano, A., Bolden, A. and Horn, R. (1994) Calcium channels in excitable cells: divergent genotypic and phenotypic expression of 1-subunits. Am. J. Physiol., 267, C411–C424.
Lin, S.C. and Morrison-Bogorad, M. (1991) Cloning and characterization of a testis-specific thymosin beta 10 cDNA. Expression in post-meiotic male germ cells. J. Biol. Chem., 266, 23347–23353.
Ma, W.-J., Holz, R.W. and Uhler, M.D. (1992) Expression of a cDNA for a neuronal calcium 1 subunit enhances secretion from adrenal chromaffin cells. J. Biol. Chem., 267, 22728–22732.
MacKinnon, R. and Yellen, G. (1990) Mutations affecting TEA blockade and ion permeation in voltage-activated K+ channels Science, 250, 276–279.
Maniatis, T., Fritsch, E.F. and Sambrook, J. (1987) Molecular Cloning. Cold Spring Harbor Publications, Cold Spring Harbor, New York, USA.
McCarrey, J.R. (1987) Nucleotide sequence of the promotor region of a tissue-specific human retroposon: comparison with its housekeeping progenitor. Gene, 61, 291–298.[Web of Science][Medline]
Meir, A. and Dolphin, A.C. (1998) Known calcium channel 1 subunits can form low threshold small conductance channels with similarities to native T-type channels. Neuron, 20, 341–351.[Web of Science][Medline]
Mikami, A., Imoto, M., Tanabe, T. et al. (1989) Primary structure and functional expression of the cardiac dihydropyridine-sensitive calcium channel. Nature, 340, 230–233.[Medline]
Mitchell, P.J. and Tjian, R. (1989) Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins. Science, 245, 371–378.
Mlinar, B. and Enyeart, J.J. (1994) Identical inhibitory modulation of A-type potassium currents by dihydropyridine calcium channel agonists and antagonists. Mol. Pharmacol., 46, 743–749.[Abstract]
Mount, S.M. (1982) A catalogue of spliced junction sequences. Nucl. Acids Res., 10, 459–472.
Nakayama, S. and Brading, A.F. (1996) Long Ca2+ channel opening induced by large depolarization and Bay K8644 in smooth muscle cells isolated from guinea pig detrusor. Br. J. Pharmacol., 119, 716–720.[Web of Science][Medline]
Olcese, R., Latorre, R., Torre, L. et al. (1997) Correlation between charge movement and ionic current during slow inactivation in Shaker K+ channels. J. Gen. Physiol., 110, 579–589.
Perez-Reyes, E. and Schneider, T. (1995) Molecular biology of calcium channels. Kidney Int., 48, 1111–1124.[Web of Science][Medline]
Perez-Reyes, E., Cribbs, L.L., Daud, A. et al. (1998) Molecular characterization of a neuronal low-voltage-activated T-type calcium channel. Nature, 391, 896–900.[Medline]
Piedras-Renteria, E.S., Chen, C.-C. and Best, P.M. (1997) Antisense nucleotides against rat brain 1E DNA and its atrial homologue decrease T-type calcium current in atrial myocytes. Proc. Natl. Acad. Sci. USA, 94, 14936–14941.
Randall, A.D. and Tsien, R.W. (1997) Contrasting biophysical and pharmacological properties of T-type and R-type calcium channels. Neuropharmacology, 36, 879–893.[Web of Science][Medline]
Rich, A., Kenyon, J.L., Hume, J.R. et al. (1993) Dihydropyridine sensitive calcium channels expressed in canine colonic smooth muscle. Am. J. Physiol., 264, C745–C754.
Santi, C.M., Darszon, A. and Hernandez-Cruz, A. (1996) A dihydropyridine-sensitive T-type Ca2+ current is the main Ca2+ current carrier in mouse primary spermatocytes. Am. J. Physiol., 271, C1583–C1593.
Sather, W.A., Tanabe, T., Zhang, J.F. et al. (1993) Distinctive biophysical and pharmacological properties of class A (BI) calcium channel alpha subunits. Neuron, 11, 291–303.[Web of Science][Medline]
Schneider, T., Wei, X., Olcese, R. et al. (1994) Molecular analysis and functional expression of the human type-E1 subunit. Recept. Channels, 2, 255–270.[Web of Science][Medline]
Schultz, D., Mikala, G., Yatani, A. et al. (1993) Cloning, chromosomal localization, and functional expression of the 1 subunit of the L-type voltage-dependent calcium channel from normal human heart. Proc. Natl. Acad. Sci. USA, 90, 6228–6232.
Sharma, P.M., Yang, X., Bowman, M. et al. (1992) Molecular cloning of rat Wilms' tumor complementary cDNA and a study of messenger RNA expression in the urogenital system and the brain. Cancer Res., 52, 6407–6412.
Soong, T.W., Stea, A., Hodson, C.D. et al. (1993) Structure and functional expression of a member of the low voltage-activated calcium channel family. Science, 260, 1133–1136.
Snutch, T.P., Leonard, J.P., Gilbert, M.M. et al. (1990) Rat brain expresses a heterogeneous family of calcium channels. Proc. Natl. Acad. Sci. USA, 87, 3391–3395.
Snutch, T.P., Tomlinson, W.J., Leonard, J.P. and Gilbert, M.M. (1991) Distinct calcium channels are generated by alternative splicing and are differentially expressed in the mammalian CNS. Neuron, 7, 45–57.[Web of Science][Medline]
Soldatov, N.M. (1992) Molecular diversity of L-type Ca2+ channel transcripts in human fibroblasts. Proc. Natl. Acad. Sci. USA, 89, 4628–4632.
Soldatov, N.M. (1994) Genomic structure of human L-type Ca2+ channel. Genomics, 22, 77–87.[Web of Science][Medline]
Soldatov, N.M., Bouron, A. and Reuter, H. (1995) Different voltage-dependent inhibition by dihydropyridines of human Ca2+ channel splice variants. J. Biol. Chem., 270, 10540–10543.
Spungin, B. and Breitbart, H. (1996) Calcium mobilization and influx during sperm exocytosis. J. Cell Sci., 109, 1947–1955.[Abstract]
Tanabe, T., Takeshima, H., Mikami, A. et al. (1987) Primary structure of the receptor for calcium channel blockers from skeletal muscle. Nature, 328, 313–318.[Medline]
Tanabe, T., Beam, K.G., Powell,J.A. and Numa, S. (1988). Restoration of excitation-contraction coupling and slow calcium current in dysgenic muscle by dihydropyridine receptor complementary DNA. Nature, 336, 134–139.[Medline]
Tanabe, T., Adams, B.A., Numa, S. and Beam, K.G. (1991) Repeat I of the dihydropyridine receptor is critical in determining calcium channel activation kinetics. Nature, 352, 800–803.[Medline]
Tiwari-Woodruff, S.K. and Cox, T.C. (1995) Boar sperm plasma membrane Ca2+-selective channels in planar lipid bilayers. Am. J. Physiol., 268, C1284–C1295.
Tsien, R.W., Ellinor, P.T. and Horne, W.A. (1991) Molecular diversity of voltage-dependent Ca2+ channels. Trends Pharmacol., 12, 349–354.[Medline]
Virbasius, J.V. and Scarpulla, R.C. (1988) Structure and expression of rodent genes encoding the testis-specific cytochrome c. Differences in gene structure and evolution between somatic and testicular variants. J. Biol. Chem., 263, 6791–6796.
Wakamori, M., Niidome, T., Furutama, D. et al. (1994) Distinctive functional properties of neuronal BII (class E) calcium channel. Recept. Channels, 2, 303–314.[Web of Science][Medline]
Waters, S.H., Distel, R.J. and Hecht, N.B. (1985) Mouse testes contain two size classes of actin mRNA that are differentially expressed during spermatogenesis. Mol. Cell. Biol., 5, 1649–1654.
Wei, X., Neely, A., Olcese, R. et al. (1996) Increase in Ca2+ channel expression by deletions at the amino terminus of the cardiac alpha1C subunit. Recept. Channels, 4, 205–215.[Web of Science][Medline]
Welling, A., Kwan, Y.W., Bosse, E. et al. (1993) Subunit-dependent modulation of recombinant L-type calcium channels. Circ. Res., 73, 974–980.
Widlak, W., Markkula, M., Krawczyk, Z. et al. (1995) A 252 bp upstream region of the rat spermatocyte-specific hst70 gene is sufficient to promote expression of the hst70-CAT hybrid gene in testis and brain of transgenic mice. Biochim. Biophys. Acta, 1264, 191–200.[Medline]
Yanagimachi, R. and Usui, N. (1974) Calcium dependence of the acrosome reaction and activation of guinea pig spermatozoa. Exp. Cell Res., 89, 161–174.[Web of Science][Medline]
Yiu, G.K., Gu, W. and Hecht, N.B. (1994) Heterogeneity in the 5' untranslated region of mouse cytochrome cT mRNAs leads to altered translational status of the mRNAs. Nucl. Acids Res., 22, 4599–4606.
Zhang, J.-F., Randall, A.D., Ellinor, P.T. et al. (1993) Distinctive pharmacology and kinetics of cloned neuronal Ca2+ channels and their possible counterparts in mammalian CNS neurons. Neuropharmacology, 32, 1075–1088.[Web of Science][Medline]
Zhang, J.F., Ellinor, P.T., Aldrich, R.W. and Tsien, R.W. (1994) Molecular determinants of voltage-dependent inactivation in calcium channels. Nature, 372, 97–100.[Medline]
Submitted on August 14, 1998; accepted on January 18, 1999.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  K. Jurkat-Rott and F. Lehmann-Horn The impact of splice isoforms on voltage-gated calcium channel {alpha}1 subunits J. Physiol., February 1, 2004; 554(3): 609 - 619. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Jacob, I. R. Hurley, L. O. Goodwin, G. W. Cooper, and S. Benoff Molecular characterization of a voltage-gated potassium channel expressed in rat testis Mol. Hum. Reprod., April 1, 2000; 6(4): 303 - 313. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. O. Goodwin, D. S. Karabinus, R. G. Pergolizzi, and S. Benoff L-type voltage-dependent calcium channel {alpha}-1C subunit mRNA is present in ejaculated human spermatozoa Mol. Hum. Reprod., February 1, 2000; 6(2): 127 - 136. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Wennemuth, R. E. Westenbroek, T. Xu, B. Hille, and D. F. Babcock CaV2.2 and CaV2.3 (N- and R-type) Ca2+ Channels in Depolarization-evoked Entry of Ca2+ into Mouse Sperm J. Biol. Chem., July 7, 2000; 275(28): 21210 - 21217. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||