Molecular Human Reproduction, Vol. 5, No. 5, 481-486,
May 1999
© 1999 European Society of Human Reproduction and Embryology
Progesterone receptor expression in the human placenta
Department of Biochemistry and Department of Molecular Reproduction, Development and Genetics, Indian Institute of Science, Bangalore 560 012, India
| Abstract |
|---|
|
|
|---|
The presence of progesterone receptors (PR) in the human placenta has been demonstrated using the reverse transcriptasepolymerase chain reaction technique. It was observed that the amount of PR in the human placenta is less during late gestation. Electrophoretic mobility shift assays with nuclear extract isolated from the first trimester and term placenta revealed three complexes when incubated with [32P]dCTP-labelled progesterone response element, and, in competition with unlabelled progesterone response element, the formation of all three complexes was inhibited. When supershift analysis of these complexes was carried out using antibodies which cross-react with both the A and B types of the PR or only with the B type receptor, only the A-form of PR was detected in the human placenta.
electrophoretic mobility shift assay/placenta/PR monoclonal antibody/progesterone receptor/RTPCR
| Introduction |
|---|
|
|
|---|
The two most important steroid hormones produced by the human placenta are oestradiol and progesterone, the concentrations of which continuously increase throughout the course of pregnancy. The quantity of progesterone produced by the human placenta can be as much as 250600 mg per day during late gestation (Solomon, 1994
| Materials and methods |
|---|
|
|
|---|
Materials
Modifying enzymes and PCR reagents were obtained from Life Technologies Inc., Gaithesburg, MD, USA. Enhanced Chemiluminescence (ECL) detection reagents and Hybond nitrocellulose were obtained from Amersham, Life Sciences Ltd, Buckingham, UK. [
-32P]dCTP was obtained from Du Pont. Secondary antibodyhorseradish peroxidase (HRP) conjugate and other routine chemicals were obtained from Sigma, St Louis, MO, USA. hPRA-3, which recognizes both PR types A and B, was obtained as a gift from Prof. Satyaswaroop, University of Pennsylvania, Philadelphia, PA, USA, and KC 146 which recognizes only PR type B, was generously provided by Prof. Geoffrey Greene, University of Chicago, Chicago, IL, USA.
RTPCR
The procedures employed for the collection of human placenta, isolation of RNA, RTPCR, and the sequences of the primers used have been described earlier (Shanker et al., 1997
). Primers specific for human PR were designed based on the published sequence of the human PR cDNA in order to amplify the region corresponding to amino acids 730840 (ligand binding domain). The forward primer used was 5' GGCGGATCCGTCAAGTGGTCTAAATCATTG 3' and the reverse primer used was 5' GGCGAATTCCTGGGTTTGACTTCGTAGCCC 3'. The expected size of amplification with the set of primers used is 351 bp. To rule out the possibility that the amplification is due to contamination from uterine tissue with which placenta is closely associated and which is also a rich source for PR, every batch of RNA isolated from placenta was screened for the presence of message for the uterine protein PP14 using specific primers. It is now well established that PP14 is an exclusively uterine protein. It should also be noted that the PP14 message could be detected even when RNA was diluted 1000-fold, and in all our RTPCR reactions to monitor PR we employed undiluted RNA without detecting PP14 message, thus establishing that the observed amplification is indeed due to presence of PR in placenta and not due to uterine tissue contamination. Two micrograms of first trimester, or 6 µg of term, placental total RNA was used for RTPCR; 10% of the RT reaction product was used for PCR in the case of first trimester placenta, while 20% was used in the case of term placenta.
Electrophoretic mobility shift assay (EMSA)
Nuclear extracts from human placenta were prepared according to established methods (Gorski et al., 1986
) with some modifications in the procedure of salt extraction. All procedures were carried out in the cold, and all solutions, tubes and centrifuges were chilled to 0°C. When included, phenylmethylsulphonyl fluoride (PMSF) and dithiothreitol (DTT) were added to the buffers just prior to use. Five grams of human first trimester or term placental minces were gently homogenized in 10 ml homogenization buffer [10 mM HEPESKOH (pH 7.6), 25 mmol/l KCl, 0.5 mmol/l spermidine, 1 mmol/l EDTA, 2 mol/l sucrose, 10% glycerol] using a motor-driven glass-teflon homogenizer until most of the cells were broken, leaving the nuclei intact. The homogenate was diluted to 28.3 ml with homogenization buffer, layered on a 10 ml cushion of the same buffer and centrifuged at 76 000 g for 30 min at 2°C in an SW28 rotor. The nuclear pellet obtained was resuspended in 1.7 ml of nuclear lysis buffer [10 mM HEPES-KOH (pH 7.6), 100 mmol/l KCl, 3 mmol/l MgCl2, 0.1 mmol/l EDTA. 1 mmol/l DTT. 0.1 mmol/l PMSF, 10% glycerol] and KCl was added to a final concentration of 0.5 mol/l. The suspension was kept on ice for 30 min with frequent vortexing to extract DNA binding proteins. Following this, the suspension was centrifuged at 12 000 g for 10 min at 0°C and the supernatant was dialysed against two changes of dialysis buffer [25 mM HEPESKOH (pH 7.6), 40 mmol/l KCl, 0.1 mmol/l EDTA, 1 mmol/l DTT,10% glycerol] overnight. The dialysate was centrifuged at 12 000 g for 10 min at 0°C and the supernatant was frozen in small aliquots by placing in liquid nitrogen and stored at 70°C until further use. EMSA was performed as described (Klein-Hitpass et al., 1991
). Typical binding reactions contained (20 µl volume): 100200 pg (45x104 cpm) progestin response element (PRE) oligonucleotide labelled with [
-32P]dCTP and Klenow DNA polymerase, 250 ng poly [dIdC.dIdC, 20 µg (FTHP) or 50 µg (term placenta) nuclear extract, 25 mmol/l HEPESKOH pH 7.6], 60 mmol/l KCl, 10% (w/v) glycerol, 2.5% (w/v) Ficoll 400, 1 mmol/l MgCl2, 2 mmol/l DTT, 0.15 mmol/l EDTA and 0.05 mmol/l EGTA. Binding reactions were carried out at room temperature for 20 min, separated in 4.5% polyacrylamide gels, dried and autoradiographed. For antibody-mediated supershift, binding reaction mixtures were incubated for a further 20 min in the presence of 1 µg of either of the two monoclonal antibodies to the human PR, hPRa-3 or KC 146. The PRE oligonucleotide used as probe and competitor was obtained by annealing the two complementary strands 5'-ggttAAAGTCAGAACACAGTGTTCTGATCAA-3' and 5'-ggttTTGATCAGAACACTGTGTTCTGACTTT-3'. The 5' `ggtt' overhangs so obtained were used as templates to radiolabel the duplex by end-filling with Klenow polymerase in the presence of [
-32P]dCTP. Protein content in the nuclear extracts was estimated according to established methods (Lowry et al., 1951
) using bovine serum albumin as the standard.
Western blot analysis
Nuclear extracts (200 µg protein) prepared from first trimester or term placenta were electrophoresed on 10% sodium dodecyl sulphatepolyacrylamide gel electrophoresis and were transferred to nitrocellulose as described (Towbin et al., 1979
). After blocking the non-specific binding sites by incubating the membrane with 5% fat-free milk, it was incubated with hPRa-3 (4 µg/ml), followed by incubation with anti-mouse IgGHRP conjugate. Antigenantibody complex was detected using enhanced chemiluminescence Western blotting reagents (Amersham).
| Results |
|---|
|
|
|---|
Expression of PR mRNA in human placenta
The RTPCR analysis for PR mRNA using first trimester and term human placental RNA is presented in Figure 1
|
Demonstration of PR protein in the human placenta
Since the PR mRNA was detectable only by RTPCR but not by Northern analysis (Shanker et al., 1997
|
In order to identify which of the three complexes contained PR, we did supershift analysis with a monoclonal antibody to the human PR, hPRa-3, which is known to recognize both the forms of PR, i.e. PR-A and PR-B (Clarke et al., 1987
|
Western blot analysis carried out with hPRa-3 revealed the presence of an 82 kDa species corresponding to PR-A (Figure 4
|
B form of PR is not detectable in the human placenta
It can be seen from results presented in Figure 4
| Discussion |
|---|
|
|
|---|
Apart from the uterus, it has been suggested that progesterone might also exert its effects on the placenta and thereby regulate placental function. In fact, recent reports describing the effects of progesterone on the expression of chorionic gonadotrophin (CG)
and ß subunit genes in the human placenta (Rao et al., 1995
The concentration of PR mRNA is much higher in FTHP than in term placenta (Figure 1
) which is also reflected in the protein concentration as judged by Western blot analysis (Figure 4
) or EMSA (data not shown). The extremely low concentration of PR in the term placenta could be of significance in the initiation of labour. In most mammals (except primates), the end of gestation is associated with a fall in maternal progesterone concentration which contributes to the initiation of labour. In humans and other primates, labour is initiated, although there is no fall in the concentration of progesterone. This suggests that a decline in progesterone action in late gestation, without an actual fall in the concentration of the hormone, could be an important component of initiation of labour in women. Progesterone inactivation by a specific binding protein (Westphat et al., 1997
), or by a local antiprogestin (Casey and Macdonald, 1993
), or by a change in PR concentrations (Khan-Dawood and Dawood, 1984
) during late pregnancy has been suggested but not demonstrated. Recently it has been proposed (Karalis et al., 1996
) that cortisol might be the local antiprogestin which blocks the action of progesterone to initiate labour. It has been suggested that in the human placenta, progesterone might bring about its actions by binding to the glucocorticoid receptor in the absence of PR; cortisol would compete for the glucocorticoid receptor with progesterone, thus blocking the action of progesterone resulting in the initiation of labour. However, our results demonstrate that the PR indeed are present even during late gestation, though there is a significant decline in the placental PR concentrations. Consequently, it is only justified to consider the involvement of the PR to a great extent in initiation of labour in addition to the possible involvement of glucocorticoid receptors as proposed (Karalis et al., 1996
). In addition, results obtained in our laboratory have demonstrated that ZK 98299, an antiprogestin known not to have any anti-glucocorticoid activity (Koper et al., 1997
) (unlike the more commonly used antiprogestin RU 486 which binds to glucocorticoid receptor), inhibits the expression of CG
and ß subunit genes (Prasad, 1993
), and regulates progesterone synthesis (Shanker and Rao, 1997) in the human placenta, suggesting the presence of functional PR in the human placenta. Our results demonstrate a decline in PR concentrations during late pregnancy and this agrees well with other suggestions (Khan-Dawood and Dawood 1984
), who proposed that the decrease in PR at the end of gestation might be a factor contributing to the onset of labor.
PR is a ligand-inducible transcription factor belonging to the family of steroid/thyroid/retinoic acid receptors. It regulates gene expression by binding to PRE on the DNA located upstream of progesterone-responsive genes, upon activation by the binding of progesterone. The human PR exists as two major forms: PR-B is the full length receptor and is 933 amino acids long; PR-A lacks 164 residues from the N-terminus (Weigel, 1996
). Our data suggest that only the A form of PR is detectable in the human placenta. The results obtained using nuclear extracts prepared from T47D cancer cells (known to express PR), which were used as a positive control in the gel retardation assays establish that the antibody used is specific. Besides, this antibody is a well characterised one and is reported to be specific for PR (Clarke et al., 1987
). It is well established that PR-A is a ligand-dependent, trans-dominant repressor of the activity of glucocorticoid, mineralocorticoid and androgen receptors, as well as that of PR-B (Tung et al., 1993
; Vegeto et al., 1993
). Studies (Tung et al., 1993
) reveal that when PR-B alone is present the ligands such as RU486, which are regarded as antagonists, behave as agonists. It is pertinent to note in this connection that our earlier studies (Shanker and Rao, 1997) revealed that while RU 486 stimulates progesterone synthesis in FTHP, it inhibits in the term placenta. Using anti-progesterone antibodies specific for B type as well as those that recognize both A and B type, It has been demonstrated (Wang et al., 1998
) that by immunohistochemistry that both types of receptors could be detected in glandular and stromal nuclei during the proliferative phase but only in stromal nuclei during the secretory phase and early pregnancy. Of importance to the present discussion is the observation that the predominant type of PR in the stromal nuclei during the secretory phase and early pregnancy is the A type, also observed by us. Additional support for the possibility that only the A form is predominantly present in certain situations comes from other studies (Viville et al., 1997
) who have reported that A type dominated over B type in leiomyomata. There is only other report claiming that PR-B is not detectable (Boyd-Leinen et al., 1982
), who reported the absence of PR-B in the oviduct of aged non-laying hens. It is suggested (Kastner et al., 1990
) that the differential expression of hPR forms A and B from their cognate promoters generates a system of tissue-specific regulation of progesterone action. However, the possibility that our failure to detect the PR-B in the human placenta in the present study could be due to the extremely low level of expression, which may be below the limits of detection methods employed in the study, cannot be ruled out. It has been well documented that the ratio of PR-A to -B determines the genetic response of a target cell to progesterone. Considering this, as well as our results on the differential action of RU 486 in placenta, it is possible that the presence of PR-A stimulates progesterone production during early pregnancy, whereas, with the progression of pregnancy, in the presence of PR-A and possible presence of PR-B (not detectable by us by the present methods) RU 486 inhibits progesterone production. In a tissue such as placenta, where the ratio of PR isoforms appears to be highly in favour of PR-A, the in-vivo scenario could be very complex due to the trans-dominant repressor function of PR-A.
| Acknowledgments |
|---|
We wish to thank the Rockefeller Foundation, New York, the Department of Biotechnology and the Council of Scientific and Industrial Research, Govt. of India for the financial support. We also wish to thank Dr P.G.Satyaswaroop, Pennsylvania State University and Dr G.L.Greene, Ben-May Institute, University of Chicago, for providing the monoclonal antibodies to PR, hPRa-3 and KC146 respectively and Dr J.F.Strauss III, Department of Obstetrics and Gynecology, University of Pennsylvania Medical Center, Philadelphia for critical evaluation of the manuscript.
| Notes |
|---|
1 To whom correspondence should be addressed at: Department of Biochemistry, Indian Institute of Science, Bangalore 560012, India
| References |
|---|
|
|
|---|
Boyd-Leinen, P.A., Fournier, D. and Spelsberg, T.C. (1982) Nonfunctioning progesterone receptors in the developed oviducts from estrogen-withdrawn immature chicks and in aged nonlaying hens. Endocrinology, 111, 3036.
Casey, M.L. and Macdonald, P.C. (1993) Human parturition: distinction between the initiation of parturition and the onset of labor. Semin. Reprod. Endocrinol., 11, 272284.[Web of Science]
Clarke, C.L., Zaino, R.J., Feil, P.D. et al. (1987) Monoclonal antibodies to human progesterone receptor: Characterization by biochemical and immunohistochemical techniques. Endocrinology,121, 11231132.
Feil, P.D., Clarke, C.L. and Satyaswaroop, P.G. (1988) Progestin-mediated changes in progesterone receptor forms in the normal human endometrium. Endocrinology, 123, 25062513.
Gorski, K., Carneiro, M. and Schibler, U. (1986) Tissue-specific in vitro transcription from the mouse albumin promoter. Cell, 47, 767776.[Web of Science][Medline]
Karalis, K., Goodwin, G. and Majzoub, J.A. (1996) Cortisol blockade of progesterone: A possible mechanism involved in the initiation of human labor. Nat. Med., 2, 556560.[Web of Science][Medline]
Kastner, P., Krust, A., Turcotte, B. et al. (1990) Two distinct estrogen regulated promoters generate transcripts encoding the two functionally different human progesterone receptors forms A and B. EMBO J., 9, 16031614.[Web of Science][Medline]
Khan-Dawood, F.S. and Dawood, M.Y. (1984) Estrogen and progesterone receptor and hormone levels in human myometrium and placenta in term pregnancy. Am. J. Obstet. Gynaecol., 150, 501505.[Web of Science][Medline]
Klein-Hitpass, L., Cato, A.C.B., Henderson, D. et al. (1991) Two types of antiprogestins identified by their differential action in transcriptionally active extracts from T47D cells. Nucl. Acids Res., 19, 12271234.
Koper, J.W., Molijn, G.J., van Uffelen, C.J. et al. (1997) Antiprogestins and iatrogenic glucocorticoid resistance. Life Sci., 60, 617624.[Web of Science][Medline]
Lowry, O.H., Rosebrough, N.J., Farr, A.L. et al. (1951) Protein measurement with the Folin phenol reagent. J. Biol. Chem., 193, 265275.
Ma, W., Hu, Z.B. and Drexler, H.G. (1994) Sensitivity of different methods for the detection of myeloperoxidase in leukemia cells. Leukemia, 8, 336342.[Web of Science][Medline]
McCormick, P.D., Razel, A.J., Spelsberg, T.C. et al. (1981) Absence of high-affinity binding of progesterone (R 5020) in human placenta and fetal membranes. Placenta, 3 (Suppl.), 23132.[Medline]
Padayachi, T., Pegoraro, R.J., Rom, L. et al. (1990) Enzyme immunoassay of oestrogen and progesterone receptors in uterine and intrauterine tissue during human pregnancy and labour. J. Steroid Biochem. Mol. Biol., 37, 509511.[Web of Science][Medline]
Prasad, K.S.S. (1993) Studies on the regulation of synthesis and secretion of human chorionic gonadotropin: role of placental steroid, progesterone. Ph.D. thesis, Indian Institute of Science, Bangalore, India.
Press, M.F. and Greene, G.L. (1988) Localization of progesterone receptor with monoclonal antibodies to the human progestin receptor. Endocrinology, 122, 11651175.
Rao, A.J., Prasad, K.S.S., Sharma, S.C. et al. (1995) Role of 17 beta oestradiol and progesterone in the regulation of synthesis and secretion of chorionic gonadotropin by the first trimester human placenta. J. Steroid Biochem. Mol. Biol., 53, 233239.[Web of Science][Medline]
Rossmanith, W.G., Wolfahrt, S., Ecker, A. et al. (1997) The demonstration of progesterone, but not of estrogen, receptors in the developing human placenta. Horm. Metab. Res., 29, 604610.[Web of Science][Medline]
Rivera, J. and Cano, A. (1989) Oestrogen and progesterone receptors in human term placenta: Measurement by binding assays and immunological methods. Placenta, 10, 579588.[Web of Science][Medline]
Shanker Y.G. and Jagannadha Rao, A. (1997) Regulation of progesterone biosynthesis in the human placenta by estradiol 17ß and progesterone. Biochem. Mol. Biol. Int., 43, 591599.[Web of Science][Medline]
Shanker, Y.G., Sharma, S.C. and Rao, A.J. (1997) Expression of progesterone receptor mRNA in first trimester human placenta. Biochem. Mol. Biol. Int., 42, 12351240.[Web of Science][Medline]
Solomon, S. (1994) The primate placenta as an endocrine organ steroids. In Knobil, E. and Neil, J.D. (eds), The Physiology of Reproduction. Raven Press, New York, pp. 863873.
Towbin, H., Staehelin, T. and Gordan, J. (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Nat. Acad. Sci. USA, 76, 43504354.
Tung, L., Mohamed, M.K., Hoeffler, J.P. et al. (1993) Antagonist-occupied human progesterone B-receptors activate transcription without binding to progesterone response elements and are dominantly inhibited by A-receptors. Mol. Endocrinol., 7, 12561265.
Vegeto, E., Shahbaz, M.M., Wen, D.X. et al. (1993) Human progesterone receptor A form is a cell and promoter specific repressor of human progesterone receptor B function. Mol. Endocrinol., 7, 12441255.
Viville, B., Charnock-jones, D.S., Sharkey, A.M. et al. (1997) Distribution of the A and B forms of the progesterone receptor messenger ribonucleic acid and protein in uterine leiomyomata and adjacent myometrium. Hum. Reprod., 12, 815822.
Wang, H., Critchley, H.O., Kelly, R.W. et al. (1998) Progesterone receptor subtype B is differentially regulated in human endometrial stroma. Mol. Hum. Reprod., 4, 407412.
Weigel, N.L. (1996) Steroid hormone receptors and their regulation by phosphorylation. Biochem. J., 319, 657667.
Westphat, D., Stroupe, S.D. and Cheng, S.L. (1997) Progesterone binding to serum proteins. Ann. NY Acad. Sci., 286, 1028.
Younes, M.A., Besch, N.F. and Besch, P.K. (1981) Estradiol and progesterone binding in human term placental cytosol. Am. J. Obstet. Gynaecol., 141, 170174.[Web of Science][Medline]
Submitted on September 16, 1998; accepted on February 10, 1999.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
H. Wang, X. Wu, K. Hudkins, A. Mikheev, H. Zhang, A. Gupta, J. D. Unadkat, and Q. Mao Expression of the breast cancer resistance protein (Bcrp1/Abcg2) in tissues from pregnant mice: effects of pregnancy and correlations with nuclear receptors. Am J Physiol Endocrinol Metab, December 1, 2006; 291(6): E1295 - E1304. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-m. Yie, R. Xiao, and C. L. Librach Progesterone regulates HLA-G gene expression through a novel progesterone response element Hum. Reprod., October 1, 2006; 21(10): 2538 - 2544. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Goldman, A. Weiss, I. Almalah, and E. Shalev Progesterone receptor expression in human decidua and fetal membranes before and after contractions: possible mechanism for functional progesterone withdrawal Mol. Hum. Reprod., April 1, 2005; 11(4): 269 - 277. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. A. Patel, J. W. Funder, and J. R. G. Challis Mechanism of Cortisol/Progesterone Antagonism in the Regulation of 15-Hydroxyprostaglandin Dehydrogenase Activity and Messenger Ribonucleic Acid Levels in Human Chorion and Placental Trophoblast Cells at Term J. Clin. Endocrinol. Metab., June 1, 2003; 88(6): 2922 - 2933. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







