Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (9)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Knöfler, M.
Right arrow Articles by Wolschek, M. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Knöfler, M.
Right arrow Articles by Wolschek, M. F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Human Reproduction, Vol. 5, No. 6, 573-580, June 1999
© 1999 European Society of Human Reproduction and Embryology

Cyclic AMP- and differentiation-dependent regulation of the proximal {alpha}HCG gene promoter in term villous trophoblasts

Martin Knöfler1,3, Leila Saleh1, Heinz Strohmer1, Peter Husslein1 and Markus F. Wolschek2

1 Department of Obstetrics and Gynecology, and 2 Department of Internal Medicine IV, University of Vienna, Währinger Gürtel 18–20, A-1090 Vienna, Austria


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Although the regulatory mechanisms controlling {alpha} and ß human chorionic gonadotrophin (HCG) expression have been investigated in choriocarcinoma cell model systems, little is known about the regulation of HCG subunit synthesis in non-tumourigenic trophoblasts. We therefore investigated {alpha}HCG mRNA transcription in villous cytotrophoblasts isolated from term placentae and have shown for the first time that the proximal {alpha}HCG gene promoter is functional in these cells. By establishing conditions which allow efficient transient transfection of immunopurified cells, we have demonstrated that a 363 bp sequence in the proximal 5' flanking region of the {alpha}HCG gene is sufficient to direct trophoblast-specific expression of a luciferase reporter. After 12–60 h cultivation, an increase in endogenous {alpha}HCG mRNA expression could be detected, indicating that aggregated villous trophoblasts undergo biochemical differentiation. Concomitantly, we observed induction of {alpha}HCG promoter-driven luciferase activity, suggesting that the 363 bp sequence of the proximal 5' flanking region is sufficient to direct differentiation-dependent increase of {alpha}HCG mRNA. Continuous luciferase expression required functional cAMP-response elements (CREs), since deletion of both recognition sequences eliminated differentiation-dependent transcription of the reporter. Elevation of cAMP values increased transcription of the wild-type construct; however, it did not affect promoter activity of the mutant plasmid. Moreover, we have demonstrated that during in-vitro differentiation, CREs interacted with increasing amounts of phosphorylated activating transcription factor/cyclic AMP response element-binding protein (ATF-1/CREB-1) suggesting that these cAMP-dependent DNA-binding factors are major determinants in regulating {alpha}HCG gene expression in villous trophoblasts.

{alpha}HCG gene promoter/ATF-1/cAMP response/transfection/villous trophoblast


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Successful pregnancy in humans depends on the correct spatial and temporal expression of placenta-derived hormones, which govern the maternal endocrine system as well as placental functions (Solomon, 1988Go; Talamantes and Olgren, 1988Go). The main site of hormonal production in the placenta are the trophoblasts of the floating villus, consisting of an outer layer of multinuclear syncytiotrophoblasts which originate by fusion of the underlying mononuclear cytotrophoblasts anchored to a basement membrane (Boyd and Hamilton, 1980Go). Distinct from cytotrophoblasts, villous syncytiotrophoblasts synthesize a specific set of hormones (Hoshina et al., 1982Go; Sasagawa et al., 1987Go) which act in both a paracrine and an autocrine manner (Lala and Hamilton, 1996Go).

To investigate trophoblast-specific hormone expression in primary cells, different methods were established for isolating villous cytotrophoblasts from term placenta (Kliman et al., 1986Go; Morrish et al., 1987Go; Bloxam et al., 1997aGo). In vitro, these mononuclear cells aggregate and fuse to form syncytial-like structures suggesting that in-vivo syncytia formation is mimicked (Douglas and King, 1990Go; reviewed in Bloxam et al., 1997bGo). Synthesis and secretion of trophoblast-specific hormones (chorionic gonadotrophin, placental lactogen and pregnancy-specific glycoprotein), were shown to increase during in-vitro culture, indicating biochemical differentiation (Kato and Braunstein, 1989Go; Ringler and Strauss, 1990Go). Cellular cAMP values rose during the period of cultivation suggesting that cAMP-dependent signal transduction might play a role in the differentiation process (Kao et al., 1992Go). Indeed, HCG secretion and mRNA synthesis of its subunits may be stimulated in response to cAMP (Feinman et al., 1986Go; Ringler et al., 1989Go). Along this line, addition of cAMP analogues was shown to promote syncytialization, and cell fusion was impaired in the presence of a specific protein kinase A inhibitor (Keryer et al., 1998aGo).

However, despite established methods to cultivate villous trophoblasts, the molecular mechanisms which control peptide hormone gene expression in these cells are poorly defined. This might be partly due to the fact that transfection of these primary cells with appropriate reporter genes has proven to be difficult. On the other hand, methods to efficiently transfect cytotrophoblasts with recombinant genes have not been systematically investigated. Rather, individual research groups have utilized their particular protocols for gene delivery (e.g. Jacquemin et al., 1993Go, 1996Go; MacCalman et al., 1996Go; Anteby et al., 1998Go).

One aim of this study was to improve our knowledge on gene uptake by villous trophoblasts. We have optimized transient transfection conditions of primary cells by using sensitive luciferase reporters and ß-galactosidase-expressing plasmids. Secondly, we sought to investigate regulatory mechanisms governing transcriptional activity of the {alpha}HCG gene in differentiating trophoblast cultures. Using appropriate transfection reagents, we have demonstrated that the proximal {alpha}HCG promoter is highly active in villous trophoblasts, suggesting that 363 bp of the 5' flanking region are sufficient to control cell-specific and differentiation-dependent transcription. Elevation of cAMP concentrations enhanced promoter-dependent luciferase activity and inducible expression was blocked in the presence of a protein kinase A inhibitor. Furthermore, we showed that transcription of the luciferase reporter requires functional cAMP-response elements (CREs) which interact with phosphorylated activating transcription factor-1/cyclic AMP response element-binding protein-1 (ATF-1/CREB-1) DNA-binding proteins in gel retardation assays. Our results suggest an important role of cAMP-dependent signal transduction/transcriptional activators in {alpha}HCG mRNA synthesis of primary villous trophoblasts.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Isolation, immunopurification and cultivation of villous term trophoblast cells
Villous trophoblast cells were isolated from selected placental tissue at 38–40 weeks gestation after spontaneous delivery or Caesarean section. Placental material was processed as described (Kliman et al., 1986Go). Briefly, tissue was digested three times with 25 mM HEPES solution containing 0.125% trypsin and 250 IU/ml DNase I in a shaking water bath (37°C). After sedimentation of tissue particles, cell suspension from the supernatant was fractionated on a 5–70% discontinuous Percoll gradient (Pharmacia Biotech, Uppsala, Sweden). Trophoblast cells were isolated from the middle layer of the gradient (density of 1.048–1.062 g/ml) and contaminating human leukocyte antigen (HLA)-I-positive cells were removed by magnetic separation. Unpurified cells were incubated with an anti-human HLA–ABC antibody (clone W6/32, 0.2 µg/106 cells; Serotec Oxford, UK) conjugated to an anti-mouse immunoglobulin (Ig)G, coupled to magnetic beads (Dynal, Oslo, Norway). Trophoblast purity was determined on cytospins by staining with the HLA-ABC antibody (negative control, 20 µg/ml) and counting the positive cells after immunocytochemical detection with an anti-cytokeratin 7 antibody (5 µg/ml; Dako, Glostrup, Germany). Using this method, we obtained cells with a purity of >=95% (Knöfler et al., 1998Go). Cells were seeded on plastic at a density of 4x105 cells/cm2 and cultivated in keratinocyte growth medium (KGM) + 10% fetal bovine serum (FBS) to perform in-vitro differentiation (Douglas and King, 1990Go).

Cloning of the proximal {alpha}HCG gene promoter and construction of mutant plasmids
A 363 bp fragment harbouring the proximal {alpha}HCG gene promoter was isolated by PCR of 1 µg genomic DNA (Clontech, Palo Alto, CA, USA), purified and cloned into pCRTM2.1 (Invitrogen, San Diego, CA, USA). Sequences and position (relative to the transcriptional start site) of oligonucleotide primers utilized in the PCR-reaction were: sense primer: 5'AAGTGTCAACTTTCAGGAGT 3' (–300 to –280) antisense primer: 5' GGCAGTTGACTGTGGATCTG 3' (+43 to +63).

Identity of the {alpha}HCG gene regulatory region was verified by sequencing on both strands using the non-radioactive ABI PRISM Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA, USA), as specified by the supplier. A fragment harbouring the promoter was excised with XhoI/KpnI and subcloned into the luciferase reporter (pGL3-Basic; Promega, Madison, WI, USA). Deletion of CREs was performed in two steps. Briefly, pGL3-Basic carrying the 363 bp 5' flanking region was digested with AatII, which cuts both palindromic CREs, and re-ligated as described (Delegeane et al., 1987Go). Constructs harbouring a single functional CRE were digested with AatII, made blunt ended with mungbean exonuclease and ligated. Deletion of both CREs was verified by sequencing. All plasmids were purified using EndoFree Plasmid Maxi Kit (Qiagen, Hilden, Germany).

Transient transfection of immunopurified cytotrophoblasts
Immunopurified villous trophoblast cells were seeded in KGM + 10% FBS at a density of 4x105 cells/cm2 in 24-well plates. After overnight incubation, the medium was changed and cells were either immediately transfected or cultivated for additional 24 h before supplementation of gene transfer reagents. Trophoblasts were incubated in the presence of 0.5 µg pCMV-ß-Gal (Clontech), varying amounts of transfection reagent and different concentrations of plasmid pGL3-Basic, enabling the ratio between DNA and transfection substance to be optimized without changing the quantity of pCMV-ß-Gal. ProFection Mammalian Transfection System-Calcium Phosphate (Promega) and FuGENETM6 Transfection Reagent (Boehringer Mannheim, Mannheim, Germany) were utilized according to the instructions of the manufacturers. For optimal conditions using ProFection, 2.5 µg pGL-3 basic and 0.5 µg pCMV-ß-Gal were dissolved in 9 µl CaCl2 + 66 µl H2O and added to 75 µl 2x hepes buffered saline (HBS). Precipitates were left on cells for 12 h. In the case of FuGENETM6, 5.5 µg pGL-3 basic and 0.5 µg pCMV-ß-Gal were diluted to 50 µl in KGM and added to a mixture of 24 µl reagent and 26 µl KGM. After combining DNA and reagent, complexes were added to cells in 500 µl KGM + 10% FBS. After additional 24 or 48 h supernatants were aspirated and cellular protein lysates were prepared using reporter lysis buffer (Promega).

Reporter assays
Luciferase activity and ß-Gal activity were determined in 200 µl of protein extract which had been stored at –70°C in reporter lysis buffer (Promega). Luciferase activity was determined on a luminometer (Lumat LB 9507; EG&G Berthold) by using luciferase assay system (Promega). Activity of ß-Gal was quantified by photometrically assaying the conversion of the chromogenic substrate chlorophenol red-ß-D-galactopyranoside (CPRG; Boehringer Mannheim) at 570 nm as described (Eustice et al., 1991Go). Values of ß-Gal were determined in 40 µl of protein lysate incubated 30 min at 37°C. Luciferase- and ß-Gal assays were performed in triplicate and mean value was calculated. Concentration of protein lysates was determined by Bio-Rad Assay Reagent according to the manufacturer's instructions (Bio-Rad, Vienna, Austria). The in-situ ß-Gal assay was performed utilizing ß-Gal Staining Kit as specified by the supplier (Invitrogen, San Diego, CA, USA).

Isolation and hybridization of RNA
Immunopurified villous trophoblast cells were seeded in KGM + 10% FBS at a density of 4x105 cells/cm2 in 6-well culture dishes and medium was changed after overnight incubation. 12, 60 and 108 h after preparation total RNA was extracted by direct lysis in the culture dishes using TRI Reagent (Molecular Research Center Inc, Cincinnati, OH, USA). For Northern blot analyses, equal amounts of total RNA (5 µg) were glycoxylated and separated by electrophoresis on agarose gels as previously described (McMaster and Carmichael, 1977Go). The fractionated RNA was transferred from gels to nylon membranes (Gene Screen, DuPont NEN, Boston, MA, USA), cross-linked to the membrane by UV irradiation, hybridized to [32P]-labelled ßHCG or {alpha}HCG cDNA probes as previously described (Strohmer et al., 1997Go), washed in 0.2x sodium chloride/sodium citrate (SSC) solution/0.1% sodium dodecyl sulphate (SDS) at 65°C, and exposed to X-ray films. All hybridizations were performed in 50% formamide, 5x SSC, 1x Denhardt's solution, 50 mM sodium phosphate (pH 6.5) and 200 µg/ml single-stranded salmon sperm DNA for 24 h at 42°C. Filters were stripped and rehybridized with a [32P]-labelled ß-actin cDNA. Autoradiographs were densitometrically scanned and the mRNA signals were quantified using Pdi Analysis Software for Biological Data. Values representing {alpha}HCG and ßHCG mRNAs were normalized according to ß-actin signals.

Electrophoretic mobility shift assay (EMSA)
Whole cell protein extracts were isolated from villous trophoblasts by freezing (liquid nitrogen)-thawing in buffer containing 20 mM HEPES (pH 7.9), 0.4 M NaCl, 2.5% Glycerol, 1 mM EDTA, 1 mM phenylmethylsulphonyl fluoride (PMSF), 0.5 mM sodium fluoride, 0.02 µg/ml leupeptin, 0.02 µg/ml aprotinin, 0.1 µg/ml trypsin inhibitor and 0.5 mM dithiothreitol (DTT). After removal of debris by centrifugation, extracts were stored at –70°C. 3 pmol of oligonucleotide harbouring the sense sequence of a CRE (–150 to –128) of the {alpha}HCG promoter were labelled for 45 min at 37°C using polynucleotide kinase (Boehringer) and 3 µl {gamma}-[32P]-ATP (3000 Ci/mmol). After removal of non-incorporated radioactivity, labelled sequences were annealed to the respective complementary oligonucleotide. Sequences were:

CRE-1s: 5' GATCAAATTGACGTCATGGTAA 3'

CRE-1a: 5' TTACCATGACGTCAATTTGATC 3'

Binding reactions (20 µl) were carried out for 30 min at room temperature in a mixture containing 0.1 pmol of double-stranded, [32P]-labelled oligonucleotide, 15 µg extract, 0.5 µg poly[d(I-C)], 0.5 µg poly[d(A-T)], 12% glycerol, 1.5 mM MgCl2, 12 mM HEPES (7.9), 1 mM DTT and 65 mM KCl. In supershift experiments, 1 µl of antibody was added and reactions were incubated for a further 15 min at room temperature. Antibodies against ATF-1 (SC-270), ATF-2 (SC-242), ATF-3 (SC-188), ATF-4/CREB-2 (SC-244) and CREB-1 (SC-271) were purchased from Santa Cruz Biotechnology Inc (Santa Cruz, CA, USA). Phospho-CREB-(Ser 133) antibody was supplied by New England Biolabs Inc (Beverly, MA, USA). In competition experiments, a 100-fold molar excess of cold double-stranded, wild-type or mutant CRE oligonucleotide was added. Sequences of mutant CREs were:

CRE-m1s: 5' GATCAAATTGATGTCATGGTAA 3'

CRE-m1a: 5' TTACCATGACATCAATTTGATC 3'

CRE-m2s: 5' GATCAAATACACGTCATGGTAA 3'

CRE-m2a: 5' TTACCATGACGTGTATTTGATC 3'

(mutated bases with respect to the wild-type are depicted in bold letters):

EMSA for detection of protein–DNA complexes was carried out by electrophoresis of binding reactions on 5% polyacrylamide gels at 4°C and 20 mAmp. Gels were dried and exposed to autoradiographic films.

Statistical analysis
Data are expressed as mean ± SD. Statistical analyses were performed with InStatTM software (GraphPad Software Co, USA). Comparisons within the groups were analysed using two-sided Student's t-test. P < 0.05 was considered to be statistically significant.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Optimization of transient transfection conditions
To investigate the efficiency of gene uptake by villous cytotrophoblasts, we utilized 10 different commercially available transfection reagents, including calcium phosphate, cationic lipids and a dendrimeric compound. We compared transient transfection efficiency of constant amounts (0.5 µg) of CMV-ß-Gal plasmids by assaying ß-Gal activity in the cellular extract. While most substances gave only low transfection rates (data not shown), cells were efficiently transformed by adding calcium phosphate precipitates or the non-liposomal FuGENETM6 Transfection Reagent (Figure 1Go). Gene delivery in the presence of calcium phosphate (ProFection) was found to be 5-fold more effective than in the presence of FuGENETM6.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 1. Efficiency of calcium phosphate (ProFection)- and FuGENETM6-mediated pCMV-ß-Gal uptake after transfecton with 0.5 µg pCMV-ß-Gal after 12 h (open bars) and 36 h (hatched bars) cultivation. Protein extracts were prepared after 60 and 84 h respectively. Endogenous ß-Gal activity was determined in mock-transfected cells (e.g. 2–3% compared with 100% in FuGENETM6/pCMV-ß-Gal-transfected cells). ß-Gal activities of each lysate were determined in triplicate and the mean was normalized to protein content. Bars representing average ß-Gal activity are the mean of eight independent transfections of four different trophoblast preparations; error bars indicate SD. ***P < 0.005.

 
363 bp of the proximal {alpha}HCG gene promoter confer cell-specific transcription in villous trophoblasts
To further investigate trophoblast cell-specific DNA uptake in our culture system we analysed expression of a luciferase reporter containing a PCR-fragment of the {alpha}HCG gene promoter (Figure 2Go). So far, transcriptional regulation of the {alpha}HCG gene has only been studied in choriocarcinoma cells (Budworth et al., 1997Go). We found that 363 bp of the proximal 5' flanking region were sufficient to direct villous cell-specific expression (Figure 3Go). Compared with the controls, transcription of the promoter-driven luciferase reporter was 87-fold and 62-fold enhanced in the presence of calcium phosphate or FuGENETM6, respectively.



View larger version (6K):
[in this window]
[in a new window]
 
Figure 2. Schematic representation of the wild-type and mutant {alpha} human chorionic gonadotrophin ({alpha}HCG) gene promoter. Sense (s) and antisense (a) oligonucleotides used in the polymerase chain reaction (PCR)-mediated isolation of the promoter are depicted by arrows. Wild-type cAMP-response elements (CREs), and residual bases of the mutant CRE elements are depicted as open and filled boxes respectively. Positions relative to the transcriptional start (+1) are indicated.

 


View larger version (17K):
[in this window]
[in a new window]
 
Figure 3 . Trophoblast-specific transcription of {alpha} human chorionic gonadotrophin ({alpha}HCG) promoter constructs after transfection with 0.5 µg pCMV-ß-Gal and 2.5 µg (ProFection) or 5.5 µg (FuGENETM6) luciferase-expressing plasmid: pGL-3 harbouring 363 bp of the proximal {alpha}HCG gene promoter (open bars) or pGL3-basic lacking promoter sequences (filled bars). Luciferase values were normalized to the constitutive ß-Gal activity. Bars representing the mean luciferase activity were calculated from eight independent transfections of four different trophoblast preparations, error bars indicate SD. *P < 0.002.

 
Differentiation-dependent transcription of the proximal {alpha}HCG gene promoter
In villous cultures, a time-dependent accumulation of endogenous {alpha}HCG and ßHCG mRNA expression was observed (Figure 4Go). Densitometric data indicated that {alpha}HCG and ßHCG transcripts increased 2.9- and 8.3-fold respectively, between 60–108 h of cultivation. Consistent with the fact that {alpha}HCG has been detected in 48% of isolated villous cytotrophoblasts (Kato and Braunstein, 1989Go), positive signals in early cultures were recognized after longer exposure of films (not shown). Contrary to that, ßHCG transcripts could not be detected 12 h after isolation, suggesting that ßHCG mRNA expression is more strongly associated with syncytia formation.



View larger version (45K):
[in this window]
[in a new window]
 
Figure 4. Differentiation-dependent increase of endogenous human chorionic gonadotrophin (HCG) subunit mRNA expression after 12, 60, and 108 h incubation. Northern blotting was carried out with [32P]-labelled {alpha}HCG, ßHCG and a-actin cDNA probes.

 
To assess the contribution of transcriptional activation to the overall accumulation of {alpha}HCG mRNA, cells were transfected with the promoter-driven luciferase reporter at various times of in-vitro culture (Figure 5Go). Analysis of normalized luciferase activity revealed that the reporter is efficiently transcribed between 0–24 h after plating, suggesting that up-regulation of endogenous {alpha}HCG mRNA is mainly achieved at the level of transcription. Compared with this early stage, the transcription rate further increased 1.5-fold at 24–48 h culture and remained at high levels during later stages of cultivation.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 5. Transcription of wild-type and mutant promoter during trophoblast differentiation. Cells were co-transfected with 2.5 µg luciferase-expressing plasmids and 0.5 µg pCMV-ßGal. Luciferase reporters contained either 363 bp of the proximal {alpha} human chorionic gonadotrophin ({alpha}HCG) gene promoter (open bars) or a mutant promoter (filled bars) carrying a deletion of both cAMP-response elements (CREs). Transfections using Profection were performed 0, 12, 24, 36, 48 and 60 h after plating (indicated). Protein lysates were prepared after an additional 24 h respectively (after 24, 36, 48, 60 and 84 h). Luciferase values of each extract were normalized to the respective ß-Gal activity. Internal ß-Gal activity (1–2% of overall ß-Gal activity in ProFection-mediated transfections) was invariant during in-vitro differentiation (not shown). Bars represent the mean values of 14 independent transfections of trophoblasts isolated from seven different placentae. *P < 0.05.

 
cAMP response elements are involved in differentiation-dependent transcription of the proximal {alpha}HCG gene promoter
DNA elements activating cAMP-dependent transcription of the {alpha}HCG gene in choriocarcinoma cells have been investigated in several publications (Delegeane et al., 1987Go; Heckert et al., 1996Go; Budworth et al., 1997Go). To estimate the influence of these enhancer elements during villous trophoblast differentiation, we utilized a promoter-luciferase reporter lacking functional CRE elements (Figure 2Go). Compared with the wild-type promoter, transcriptional activity of the mutant was 16- and 23-fold reduced at 12–36, and 24–48 h culture respectively, suggesting functional importance of the CREs during in-vitro differentiation (Figure 5Go).

Induction of the {alpha}HCG promoter by forskolin requires functional CREs and activation by protein kinase A
To investigate the impact of elevated cAMP values on {alpha}HCG gene promoter transcription, transfected cells were incubated with forskolin, an activator of adenylate cyclase (Figure 6Go). Compared to non-treated cells, luciferase activity of forskolin-treated trophoblasts was 3.1-fold and 2.8-fold elevated between 12–36 h and 36–60 h differentiation respectively. Plasmids harbouring CRE-mutants were not inducible indicating the importance of these particular recognition sequences in cAMP-dependent signal transduction. Addition of H-89, a specific protein kinase A inhibitor, diminished forskolin-dependent expression suggesting a predominant role of the kinase in the activation of CRE-binding proteins.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 6. cAMP-inducible expression of luciferase reporters by forskolin. Cells were co-transfected with 2.5 µg luciferase-expressing plasmids and 0.5 µg pCMV-ßGal. Luciferase reporters contained either wild-type promoter (open bars) or mutant promoter (filled bars) lacking functional cAMP-response elements (CREs). Transfections were performed 12 and 36 h after plating (indicated). DNA-precipitates were removed after 12 h and fresh medium containing forskolin (10 µM) was added. Additional wells, containing wild-type promoter-transfected cells, were preincubated for 30 min with medium containing 3 µM of H-89 (N-[2-(p-Bromocinnamyl)amino)ethyl]-5-isoquinolinesulphonamide (Calbiochem, San Diego, CA, USA) before supplementation of forskolin (hatched bars). Bars represent the mean values of eight independent transfections of trophoblasts isolated from four different placentae. *P < 0.02.

 
CREs interact with phosphorylated ATF-1/CREB-1 proteins during trophoblast differentiation
Various members of the activating transcription factor/cyclic AMP response element-binding protein (ATF/CREB) family of CRE-binding proteins have been described, which form different DNA-binding complexes by homo- and heterodimerization (Hoeffler et al., 1991Go). To define which proteins could be involved in activation of the {alpha}HCG promoter, we performed EMSA using one of the palindromic CREs of the gene. Three specific protein complexes interacting with the CRE were detectable in extracts of 24 h cultures (Figure 7AGo) which were specifically competed in the presence of an excess of cold, wild-type sequence. However, two different competitors carrying CRE mutants, had no effect on protein binding. Bands were supershifted upon addition of ATF-1 antibody indicating that the transcriptional activator was present in the complexes. On the other hand, we failed to detect other proteins of the ATF/CREB family including ATF-2, ATF-3, ATF-4 and CREB-2. Additionally, we observed a weak supershift with a monoclonal CREB-1 antibody (Figure 7BGo) after long exposure of films. Total CRE-binding activity as well as ATF-1-containing complexes increased between 0–48 h of cultivation, strongly suggesting a role in the differentiation-dependent accumulation of {alpha}HCG mRNA (Figure 7CGo). Protein complexes also displayed a weak supershift in the presence of antibodies against phosphorylated Ser133 of ATF-1/CREB-1 suggesting that CRE-binding proteins are active between 12 and 48 h of culturing.





View larger version (228K):
[in this window]
[in a new window]
 
Figure 7. Electrophoresis mobility shift assay (EMSA) showing the interaction of DNA-binding proteins with the cAMP-response element (CRE) during in-vitro differentiation. Specific CRE-binding complexes are indicated by arrows while supershifts are marked by stars. Non-specific complexes (open circles) showed higher mobility and did not disappear in the presence of an excess of specific competitor (not shown). (A) Specificity of CRE-binding complexes from villous trophoblasts. Radiolabelled wild-type CRE oligonucleotide was incubated with 15 µg protein extract (24 h culture) in the absence (–) or presence of a 100-fold molar excess of cold, double-stranded wild-type (wt), mutant-1 (m1) or mutant-2 (m2) CRE oligonucleotide. Antibodies against ATF-1, ATF-2, ATF-3 and ATF-4/CREB-2 were added and only ATF-1 produced a supershift. (B) Detection of ATF-1 and CREB-1 in trophoblast extracts. Labelled oligonucleotide harbouring the CRE was incubated with protein extract from 24 h cultures in the absence (–) or presence of ATF-1 or CREB-1 antibodies (indicated). Additionally, the protein lysate was preincubated for 30 min with CREB-1 antibody before labelled oligonucleotide was added [CREB-1(pre)]. (C) Differentiation-dependent accumulation of phosphorylated ATF-1-binding activity. Protein extract (10 µg) isolated from four different times of trophoblast differentiation (indicated) were incubated with the labelled CRE. Antibodies against ATF-1 and phosphorylated ATF-1/CREB-1 proteins (Ser 133) were added to produce the supershifts (*).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Placental-derived HCG is a member of the family of glycoprotein hormones consisting of a common {alpha}-subunit and a unique ß-subunit which confers hormone specificity (Pierce and Parsons, 1981Go). During early pregnancy, HCG concentrations peak at 9–10 weeks gestation and rapidly decline thereafter (Braunstein et al., 1980Go). Accordingly, a function in the rescue of the corpus luteum and maintenance of luteal functions until the occurrence of the luteal–placental shift has been suggested (Muyan and Boime, 1997Go). In-vivo production of HCG predominantly occurs in villous trophoblasts, which up-regulate hormone secretion in vitro, in a differentiation-dependent manner (Kato and Braunstein, 1989Go). Various growth factors have been suggested as playing a role in HCG subunit synthesis and secretion (Petraglia, 1991Go); however, the regulatory signals which control developmental HCG expression throughout pregnancy remain obscure.

Most of our knowledge on the molecular mechanisms controlling HCG subunit expression has been acquired from studies of malignant trophoblasts, which are easily transfected in cultures. Transcriptional activation of {alpha}HCG mRNA requires 180 bp of proximal 5' flanking region containing a composite enhancer for choriocarcinoma cell-specific transcription (Delegeane et al., 1987Go; Bokar et al., 1989Go; Jameson et al., 1989Go). The enhancer consists of an upstream regulatory element (URE) and two palindromic CREs (Heckert et al., 1996Go). Additionally, a junctional response element (JRE) and a CAAT box are required for optimal expression (Andersen et al., 1990Go). However, choriocarcinoma cells comprise a heterogenous population of high proliferative trophoblasts, which exhibit villous and extravillous properties (Crescimanno et al., 1996Go). Additionally, there is evidence that HCG expression of the trophoblast is correlated with the degree of cellular transformation (Graham et al., 1993Go), suggesting that the regulatory circuits of the tumour cells do not necessarily represent the molecular mechanisms which control HCG expression in vivo.

Therefore, we sought to investigate regulation of HCG production in villous cytotrophoblasts isolated from term placenta which undergo syncytialization during in-vitro culture. Different to trophoblast tumour cells, these primary cells fuse spontaneously and do not require high doses of cAMP analogues for syncytium formation. However, isolated cytotrophoblasts of term placenta do not proliferate in culture and therefore exhibit low transfectability with recombinant genes. To improve sensitivity of reporter assays we first optimized transient transfection conditions of these primary cells. Gene uptake mediated by FuGENETM6 and, in particular, calcium phosphate (ProFection) proved to be most efficient. In general, the total number of transiently transfected cells was low in our cultures (4–6%). The usage, however, of sensitive luciferase reporters allowed the detection of high levels of {alpha}HCG promoter-driven enzyme activity. Therefore, transfection conditions described here should also be valuable to study regulation of other villous trophoblast-specific promoters and genes.

Various studies suggest a role of cAMP in trophoblast syncytialization and hormone production. Endogenous cAMP values steadily increase after 24–72 h of trophoblast differentiation in vitro and were shown to induce cell fusion between aggregated cytotrophoblasts and also between syncytia (Kao et al., 1992Go; Keryer et al., 1998aGo,bGo). Additionally, discordant induction of {alpha} and ßHCG mRNA steady state values has been observed in the presence of a cAMP analogue (Ringler et al., 1989Go). However, signals and mechanisms, which control HCG subunit mRNA expression during syncytialization of primary cells have not been studied in detail. Utilizing optimized transfection conditions we investigated whether the proximal promoter of the {alpha}HCG gene is sufficient to direct reporter expression in villous trophoblasts. Our results indicate that 363 bp of 5' flanking region strongly enhance trophoblast cell-specific transcription. When cells were immediately transfected after plating, considerable amounts of luciferase reporter accumulated after 0–24 h suggesting that the proximal {alpha}HCG promoter is transcriptionally active in early cultures. During in-vitro differentiation endogenous amounts of {alpha}HCG mRNA increase from almost undetectable (at 12 h) to high concentrations (at 60 h). In association, promoter-driven luciferase expression increases after 24–48 h differentiation and remains high during later stages of cultivation. Therefore, we suspect that the differentiation-dependent accumulation of {alpha}HCG mRNA is mainly governed by the transcriptional activity of the gene. Additionally, our data suggest a crucial role of cAMP-mediated signal transduction in {alpha}HCG gene transcription, since elevation of cAMP values by forskolin induces promoter activity. Enhanced expression of luciferase was inhibited in the presence of H-89, a specific inhibitor of protein kinase A, suggesting that activity of the enzyme is required for cAMP-dependent {alpha}HCG mRNA synthesis. Since protein kinase A is also involved in syncytialization (Keryer et al., 1998aGo,bGo), one may conclude that it has a central role in both biochemical and morphological trophoblast differentiation.

Signalling of cAMP is known to result in the activation of different DNA-binding proteins interacting with the CRE. Protein kinase A-mediated phosphorylation of CREB at Ser 133 recruits the adaptor proteins CBP and p300, which function as co-activators for transcription (Arias et al., 1994Go; Kwok et al., 1994Go). In BeWo cells, two protein complexes containing CREM, ATF-1 and CREB-1 interact with the CRE of the {alpha}HCG gene promoter (Heckert et al., 1996Go). The CREs are essential for promoter function since mutation of both recognition sequences abolishes transcriptional activity (Budworth et al., 1997Go). Similar to choriocarcinoma cells, DNA-binding proteins interacting with CREs seem to play an important role in villous {alpha}HCG expression since deletion of both sequences inhibits differentiation-dependent as well as cAMP-inducible reporter expression. In villous trophoblast cell extracts three specific DNA-binding complexes interact with the CRE. While CREB-1 protein is weakly detectable in supershift experiments, we identified ATF-1 in two of the three complexes. ATF-1 activates cAMP-responsive genes by homo- and heterodimerization with CREB-1, however, it may also antagonize the stimulating function of CREB-1 (Ellis et al., 1995Go). Analysis of CRE-binding during in-vitro differentiation of trophoblast cultures points towards a positive role of ATF-1 to activate {alpha}HCG gene transcription. Concomitant with the increase of reporter expression, we observed an elevation of ATF-1 binding activity. Using an antibody against Ser 133 of the kinase inducible domain of ATF-1 and CREB-1, we detected active, phosphorylated proteins between 12 and 48 h of culturing, while post-translationally modified DNA-binding factors are absent in freshly isolated cells. Therefore, we suspect that increasing cAMP levels in early cultures result in rapid induction and activation of CRE-binding factors. Further studies are required to elucidate the role and interplay of particular CRE-binding factors in {alpha}HCG mRNA expression of differentiating villous trophoblasts. To this end, the methods described will allow to investigate the contribution of other promoter-elements to the overall {alpha}HCG transcription rate.


    Acknowledgments
 
The authors thank U.Tretzmüller and G.Meinhardt for their help in cloning {alpha}HCG promoter and constructing the CRE mutant. We are grateful to B.Mösl for supporting EMSA and to R.Vasicek for critical reading of the manuscript. This work was supported by grant Nr. 6795 of the `Jubiläumsfond' of the Austrian National Bank.


    Notes
 
3 To whom correspondence should be addressed Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Andersen, B, Kennedy, G.C. and Nilson, J.H. (1990) A cis-acting element located between the cAMP response elements and CCAAT box augments cell-specific expression of the glycoprotein hormone alpha subunit gene. J. Biol. Chem., 265, 21874–80.[Abstract/Free Full Text]

Anteby, E.Y., Johnson, R.D., Huang, X. et al. (1998) Lipopolysaccharide enhances the transcription of prostaglandin H synthase-2 gene in primary human trophoblasts. Am. J. Obstet. Gynecol., 178, 469–73.[Web of Science][Medline]

Arias, J, Alberts, A.S., Brindle, P. et al. (1994) Activation of cAMP and mitogen responsive genes relies on a common nuclear factor. Nature, 370, 226–9.[Medline]

Boyd, J.D. and Hamilton, W.J. (1980) The Human Placenta. MacMillan, London, UK.

Bokar, J.A., Keri, R.A., Farmerie, T.A. et al. (1989) Expression of the glycoprotein hormone alpha-subunit gene in the placenta requires a functional cyclic AMP response element, whereas a different cis-acting element mediates pituitary-specific expression. Mol. Cell. Biol., 9, 5113–5122.[Abstract/Free Full Text]

Bloxam, D.L., Bax, C.M.R. and Bax, B.E. (1997a) Culture of syncytiotrophoblasts for the study of human placental transfer, part I: isolation and purification of cytotrophoblasts. Placenta, 18, 93–98.[Web of Science][Medline]

Bloxam, D.L., Bax, C.M.R. and Bax, B.E. (1997b) Culture of syncytiotrophoblasts for the study of human placental transfer, part II: production, culture and use of syncytiotrophoblasts. Placenta, 18, 99–108.[Web of Science][Medline]

Braunstein, G.D, Rasor, J.L., Engvall, E. and Wade, M.E. (1980) Interrelationships of human chorionic gonadotropin, human placental lactogen, and pregnancy-specific beta 1-glycoprotein throughout normal human gestation. Am. J. Obstet. Gynecol., 138, 1205–1213.[Web of Science][Medline]

Budworth, P.R., Quinn, P.G. and Nilson, J.H. (1997) Multiple characteristics of a pentameric regulatory array endow the human alpha-subunit glycoprotein hormone promoter with trophoblast specificity and maximal activity. Mol. Endocrinol., 11, 1669–1680.[Abstract/Free Full Text]

Crescimanno, C., Foidart, J.M., Noel, A. et al. (1996) Cloning of choriocarcinoma cells shows that invasion correlates with expression and activation of gelatinase A. Exp. Cell. Res., 227, 240–251.[Web of Science][Medline]

Delegeane, A.M., Ferland, L.H. and Mellon, P. (1987) Tissue-specific Enhancer of the human glycoprotein hormone {alpha}-subunit gene: dependence on cyclic AMP-inducible elements. Mol. Cell. Biol., 7, 3994–4002.[Abstract/Free Full Text]

Douglas, G.C. and King, B.F. (1990) Differentiation of human trophoblast cells in vitro as revealed by immunocytochemical staining of desmoplakin and nuclei. J. Cell Sci., 96, 131–141.[Abstract/Free Full Text]

Ellis, M.J., Lindon, A.C., Flint, K.J. et al. (1995) Activating transcription factor-1 is a specific antagonist of the cyclic adenosine 3'.5'-monophosphate (cAMP) response element-binding protein-1-mediated response to cAMP. Mol. Endocrinol., 9, 255–265.[Abstract/Free Full Text]

Eustice, D.C, Feldman, P.A., Colberg-Poley, A.M. et al. (1991) A sensitive method for the detection of beta-galactosidase in transfected mammalian cells. Biotechniques, 11, 739–743.

Feinman, M.A, Kliman, H.J., Caltabiano, S and Strauss III, J.F. (1986) 8-Bromo-3',5'-adenosine monophosphate stimulates the endocrine activity of human cytotrophoblasts in culture. J. Clin. Endocrinol. Metab., 63, 1211–1217.[Abstract/Free Full Text]

Graham, C.H., Hawley, T.S., Hawley, R.G. et al. (1993) Establishment and characterization of first trimester human trophoblast cells with extended lifespan. Exp. Cell. Res., 206, 204–211.[Web of Science][Medline]

Heckert, L.L., Schultz, K. and Nilson, J.H. (1996) The cAMP response elements of the alpha subunit gene bind similar proteins in trophoblasts and gonadotropes but have distinct functional sequence requirements. J. Biol. Chem., 271, 31650–31656.[Abstract/Free Full Text]

Hoeffler, J.P, Lustbader, J.W and Chen, C.Y. (1991) Identification of multiple nuclear factors that interact with cyclic adenosine 3',5'-monophosphate response element-binding protein and activating transcription factor-2 by protein-protein interactions. Mol. Endocrinol., 5, 256–266.[Abstract/Free Full Text]

Hoshina, M., Boothby, M. and Boime I. (1982) Cytological localization of chorionic gonadotropin alpha and placental lactogen mRNAs during development of the human placenta. J. Cell. Biol., 93, 190–198.[Abstract/Free Full Text]

Jacquemin, P., Alsat, E., Oury, C. et al. (1993) Efficient lipofection of human trophoblast cells in primary cultures. Biochem. Biophys Res. Commun., 15, 376–381.

Jacquemin, P., Alsat, E., Oury, C. et al. (1996) The enhancers of the human placental lactogen B, A, and L genes: progressive activation during in vitro trophoblast differentiation and importance of the DF-3 element in determining their respective activities. DNA Cell Biol., 15, 845–854.[Web of Science][Medline]

Jameson, J.L., Albanese, C. and Habener, J.F. (1989) Distinct adjacent protein-binding domains in the glycoprotein hormone alpha gene interact independently with a cAMP-responsive enhancer. J. Biol. Chem., 264, 16190–16196.[Abstract/Free Full Text]

Kao, L.-C., Babalola, G.O., Kopf, G. S. et al. (1992) Differentiation of human trophoblasts: structure-function relationships. In Leung, P.C.K. (ed.), Molecular Basis of Reproductive Endocrinology. Springer Verlag, NY, USA.

Kato, Y. and Braunstein, G.D. (1989) Discordant secretion of placental protein hormones in differentiating trophoblasts in vitro. J. Clin. Endocrinol. Metab., 68, 814–820.[Abstract/Free Full Text]

Keryer, G., Alsat, E., Tasken, K. and Evain-Brion, D. (1998a) Cyclic AMP-dependent protein kinases and human trophoblast cell differentiation in vitro. J. Cell. Sci., 111, 995–1004.[Abstract]

Keryer, G., Alsat, E., Tasken, K. and Evain-Brion, D (1998b) Role of cyclic AMP-dependent protein kinases in human villous cytotrophoblast differentiation. Trophoblast Res., 12, 295–314.

Kliman, H.J, Nestler, J.E., Sermasi, E. et al. (1986) Purification, characterization, and in vitro differentiation of cytotrophoblasts from human term placentae. Endocrinology, 118, 1567–1581.[Abstract/Free Full Text]

Knöfler, M., Stenzel, M. and Husslein, P. (1998) Shedding of TNF receptors from purified villous term trophoblasts and cytotrophoblastic BeWo cells. Hum. Reprod., 13, 2308–2316.[Abstract/Free Full Text]

Kwok, R.P., Lundblad, J.R., Chrivia, J.C. et al. (1994) Nuclear protein CBP is a coactivator for the transcription factor CREB. Nature, 370, 223–226.[Medline]

Lala, P.K. and Hamilton, G.S. (1996) Growth factors, proteases and protease inhibitors in the maternal-fetal dialogue. Placenta, 17, 545–555.[Web of Science][Medline]

MacCalman, C.D., Furth, E.E., Omigbodun, A. et al. (1996) Transduction of human trophoblast cells by recombinant adenoviruses is differentiation dependent. Biol. Reprod., 54, 682–691.[Abstract]

McMaster, G.K. and Carmichael, G.G. (1977) Analysis of single- and double-stranded nucleic acids on polyacrylamide and agarose gels by using glyoxal and acridine orange. Proc. Natl. Acad. Sci. USA, 74, 4835–4838.[Abstract/Free Full Text]

Morrish, D.W, Bhardwaj, D., Dabbagh, L.K. et al. (1987) Epidermal growth factor induces differentiation and secretion of human chorionic gonadotropin and placental lactogen in normal human placenta. J. Clin. Endocrinol. Metab., 65, 1282–1290.[Abstract/Free Full Text]

Muyan, M. and Boime, I. (1997) Secretion of chorionic gonadotropin from human trophoblasts. Placenta, 18, 237–241.[Web of Science][Medline]

Petraglia, F. (1991) Placental neurohormones: secretion and physiological implications. Mol. Cell. Endocrinol., 78, 109–112.

Pierce, J.G. and Parsons, T.F. (1981) Glycoprotein hormones: structure and function. Ann. Rev. Biochem., 50, 465–495.[Web of Science][Medline]

Ringler, G.E., Kao, L.C., Miller, W.L. and StraussIII, J.F. (1989) Effects of 8-bromo-cAMP on expression of endocrine functions by cultured human trophoblast cells. Regulation of specific mRNAs. Mol. Cell. Endocrinol., 61, 13–21.[Web of Science][Medline]

Ringler, G.E. and Strauss, J.F. (1990) In vitro systems for the study of human placental endocrine function. Endocr. Rev., 11, 105–123.[Abstract/Free Full Text]

Sasagawa, M., Yamazaki, T, Endo, M. et al. (1987) Immunohistochemical localization of HLA antigens and placental proteins alpha hCG, beta hCG CTP, hPL and SP1 in villous and extravillous trophoblast in normal human pregnancy: a distinctive pathway of differentiation of extravillous trophoblast. Placenta, 8, 515–528.[Web of Science][Medline]

Solomon, S. (1988) The placenta as an endocrine organ: steroids. In Knobil, E. and Neill, J.D. (eds), The Physiology of Reproduction. Raven Press, New York, USA, 2085 pp.

Strohmer, H., Kiss, H., Mösl, B. et al. (1997) Hypoxia downregulates continuous and interleukin-1-induced expression of human chorionic gonadotropin in choriocarcinoma cells. Placenta, 18, 597–604.[Web of Science][Medline]

Talamantes, F. and Olgren, L. (1988) The placenta as an endocrine organ: polypeptides. In Knobil, E. and Neill, J.D. (eds), The Physiology of Reproduction. Raven Press, New York, USA, 2093 pp.

Submitted on December 12, 1998; accepted on March 12, 1999.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol Hum ReprodHome page
C. Leisser, L. Saleh, S. Haider, H. Husslein, S. Sonderegger, and M. Knofler
Tumour necrosis factor-{alpha} impairs chorionic gonadotrophin {beta}-subunit expression and cell fusion of human villous cytotrophoblast
Mol. Hum. Reprod., October 1, 2006; 12(10): 601 - 609.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
E. D. Johnstone, G. Chan, C. P. Sibley, S. T. Davidge, B. Lowen, and L. J. Guilbert
Sphingosine-1-phosphate inhibition of placental trophoblast differentiation through a Gi-coupled receptor response
J. Lipid Res., September 1, 2005; 46(9): 1833 - 1839.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Knofler, L. Saleh, S. Bauer, B. Galos, H. Rotheneder, P. Husslein, and H. Helmer
Transcriptional Regulation of the Human Chorionic Gonadotropin {beta} Gene during Villous Trophoblast Differentiation
Endocrinology, April 1, 2004; 145(4): 1685 - 1694.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Knofler, L. Saleh, S. Bauer, R. Vasicek, G. Griesinger, H. Strohmer, H. Helmer, and P. Husslein
Promoter Elements and Transcription Factors Involved in Differentiation-Dependent Human Chorionic Gonadotrophin-{alpha} Messenger Ribonucleic Acid Expression of Term Villous Trophoblasts
Endocrinology, October 1, 2000; 141(10): 3737 - 3748.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
M. Knofler
What factors regulate HCG production in Down's syndrome pregnancies?: Regulation of HCG during normal gestation and in pregnancies affected by Down's syndrome
Mol. Hum. Reprod., October 1, 1999; 5(10): 895 - 897.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (9)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Knöfler, M.
Right arrow Articles by Wolschek, M. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Knöfler, M.
Right arrow Articles by Wolschek, M. F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?