Molecular Human Reproduction, Vol. 5, No. 7, 627-635,
July 1999
© 1999 European Society of Human Reproduction and Embryology
Outer dense fibre proteins from human sperm tail: molecular cloning and expression analyses of two cDNA transcripts encoding proteins of ~70 kDa
1 III Zoologisches Institut-Entwicklungsbiologie, Universität Göttingen, Humboldtallee 34A, 37073 Göttingen, and 2 Zentrum Pathologie, Universität Göttingen, Abteilung Gastroenteropathologie, Robert-Koch-Strasse 40, 37075 Göttingen, Germany
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionReferences |
|---|
The outer dense fibres (ODF) are a main cytoskeletal structure of the sperm tail. Despite their importance in the morphology and function of the sperm tail, their constituents are poorly described. Here we investigate the protein composition of human outer dense fibres. Our results suggest that human ODF consist of about 10 major and of at least 15 minor proteins, where all major proteins are ODF1, ODF2 or ODF2-related proteins. From a human testis cDNA library, we isolated two slightly different cDNAs encoding ODF2 proteins of ~70 kDa. Human ODF2 cDNAs and their encoded proteins are very similar to those isolated from rat and mouse pointing to a high evolutionary pressure residing on these proteins. Transcription of ODF2 is restricted to testis tissue and more specifically to round spermatids as was demonstrated by a non-radioactive in-situ hybridization. ODF2 proteins were detected in the sperm tail. Their distribution along the length of the sperm tail shows that the ODF normally extend to about half the principal piece of the sperm tail. The former result opens the possibility for a screening regarding the distribution of sperm tail proteins related to motility disorders.
human ODF/in-situ hybridization/spermatogenesis
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
The outer dense fibres (ODF) are sperm tail-specific cytoskeletal structures (Fawcett et al., 1975). They consist of nine fibres which surround the axoneme on its outer side accompanying the tubuli doublets in the middle and principal piece of the sperm tail. At the anterior end, the ODF make close contact with the paracentriolar connecting piece and extend posteriorly for varying lengths into the principal piece. At present, no active motility could be assigned to the ODF. Instead their function may be to maintain the passive elastic structure and elastic recoil of the sperm tail and/or to protect it against shearing forces encountered during epididymal transport and especially during ejaculation (Baltz et al., 1990
). Also discussed are a force transmission to the flagellar base by way of the ODFs and, therefore, a support of the axonemal beat (Lindemann, 1996). The fact that these structures are found only in the sperm tails of animals with internal fecundation supports the former suggestion.
Despite their conservation across the animal phylogenetic tree, including insects (Baccetti et al., 1973), which indicates an important function in sperm motility and/or morphology, the protein composition and the function of these fibres has not been well studied.
The protein composition of ODF has been studied in several mammalian species. These analyses have shown that in rat spermatozoa the ODF are composed of six major polypeptides (Vera et al., 1984) and of at least 14 polypeptides (Oko, 1988), whereas the protein at ~30 kDa is the major ODF protein not only in rat spermatozoa but also in bull (Baccetti et al., 1973). In humans, three to seven individual proteins were ascribed to the ODF (Haidl et al., 1991; Henkel et al., 1992; Stalf et al., 1993).
The genes encoding the main ODF protein of ~30 kDa (Odf1) were cloned from a variety of species (Van der Hoorn et al., 1990; Burfeind and Hoyer-Fender, 1991; Hoyer-Fender, 1993; Burfeind et al., 1993; Morales et al., 1994; Hoyer-Fender et al., 1995; Kim et al., 1995) including man (Gastmann et al., 1993), and a high sequence identity on the nucleotide as well as the amino acid sequence level were demonstrated. The 30 kDa ODF1 protein has a high cysteine and proline content with a repetitive conserved sequence motif of Cys-X-Pro at its C-terminal end (Hoyer-Fender et al., 1995), which is also conserved in the protein encoded by the Drosophila melanogaster gene Mst87F (Schäfer, 1986). The high cysteine content may be responsible for the binding of zinc, since ODF1 has been described as the main zinc-binding protein of the sperm tail (Calvin, 1979).
Further ODF proteins have been described recently, as ODF2 in rat and mouse and are encoded by nearly identical cDNAs (Brohmann et al., 1997; Hoyer-Fender et al., 1998). Here we investigate the protein pattern of human ODF and show that it is very similar to those of rat and mouse. The most prominent proteins of human ODF are the 30 kDa ODF1 protein and several proteins in the molecular mass range of 40–85 kDa. These latter proteins have been identified recently in rat and mouse as proteins related to ODF2 (Brohmann et al., 1997; Hoyer-Fender et al., 1998). We describe the isolation and characterization of two nearly identical cDNAs encoding human ODF2 proteins. A high degree of identity was found on the nucleotide as well as the amino acid sequence level between ODF2 cDNAs and their derived proteins from rat, mouse, and man. The human ODF2 gene is transcribed in testis tissue only, as was expected for a gene encoding sperm tail proteins. By a non-radioactive in-situ hybridization method on human testis sections ODF2 transcripts could be detected in the cytoplasm of round spermatids.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Sources of tissues
Human tissues and human spermatozoa were provided from Universität Göttingen, Klinikum.
Isolation of cDNA clones and sequence analysis
Screening of the Lambda Zap Express human testis cDNA library (Stratagene, La Jolla, USA) was performed by standard methods (Benton and Davis, 1977). As DNA probe the rat Odf2 cDNA was used, which was labelled with [32P]-dNTP by the random hexanucleotide primer method (Feinberg and Vogelstein, 1983). Hybridization of filters was performed in 5x sodium chloride/sodium citrate (SSC), 5x Denhardt's solution and 100 µg/ml denatured salmon sperm DNA at 63°C overnight. Filters were washed twice in 2x SSC at room temperature and then in 0.2x SSC, 0.1% sodium dodecyl sulphate (SDS) at hybridization temperature. DNA sequences were determined (Chen and Seeburg, 1985; Sanger et al., 1977) using Sequenase 2.0 (Amersham Pharmacia Biotech, Freiburg, Germany).
RNA preparation and cDNA synthesis
Total RNA was prepared by guanidinium HCl lysis (Chomczynski and Sacchi, 1987) and any contaminating DNA digested with RNase-free DNase (RQ1, Promega Corp, Madison, USA) prior to cDNA synthesis. cDNA synthesis was performed by a protocol of Life Technologies, Karlsruhe, Germany. As enzyme the Reverse Transcriptase SuperSciptTM II (Life Technologies) was used. 5 µg total RNA were incubated at 42°C for 2 min together with 1 µl Oligo (dT)12–18 (500 µg/ml), 4 µl First Strand Buffer, 2 µl 0.1 M DTT and 1 µl 10 mM dNTP Mix (10 mM each dATP, dGTP, dCTP and dTTP at neutral pH) in a final reaction volume of 20 µl. After addition of 1 µl SuperscriptTM II the mixture was incubated 50 min at 42°C. The reaction was inactivated by heating at 70°C for 15 min. After this procedure the cDNA was ready to use as a template for amplification in polymerase chain reaction (PCR).
Polymerase chain reaction
cDNAs were diluted 1:100 and 1 µl used for PCR. For amplification of human ODF2, the primers 78 (ACAAGCTCAACCAGGCTCAC) and 79 (CCAGCTGTGACTGGAACTG) were used that generate a product of about 220 bp. As control for cDNA quantity amplification of a ubiquitously expressed nuclear protein (Singh et al., 1991) was performed with primers 7 (CTAATTCTTGTCGTCTTTTTTG) and 8 (GAAAGTGGAGGAGGTACT). The DNA was first denatured for 4 min at 94°C followed by 35 cycles with denaturation at 94°C for 30 s, annealing at 54°C for 2 min 30 s and elongation at 72°C for 2 min 30 sec (Thermocycler, MWG). PCR products were separated on 1% agarose gels.
Western blotting
Human spermatozoa were provided by the Clinic of the University of Göttingen. Spermatozoa of rat and mouse were isolated from epididymides as described (Vera et al., 1984). Epididymal spermatozoa were used for the isolation of ODF (Vera et al., 1984). Spermatozoa and ODF proteins were separated by SDS–polyacrylamide gel electrophoresis (PAGE) (Laemmli, 1970) and transferred to Hybond-C (Amersham Corporation) (Towbin et al, 1979). The membrane was blocked in 5% dry milk in TBST (10 mM Tris/HCl 7.6, 150 mM NaCl, 0.05% Tween 20), and incubated with anti-ODF protein antiserum SA 963, diluted 1:400 in blocking solution, or affinity-purified anti-ODF2 antiserum, diluted 1:50 in blocking solution. Bound antibodies were detected via binding of anti-rabbit immunoglobulin (Ig)G-antibodies linked to horseradish peroxidase (Sigma) and Renaissance Western Blot Chemiluminescence Reagent (DuPont/NEN, Boston, MA, USA).
Affinity purification of anti-ODF2 antibodies
Affinity purification was performed as described elsewhere (Hoyer-Fender et al., 1998). An antiserum against total ODF proteins of rat spermatozoa were raised in rabbits by Eurogentec. Rat Odf2 cDNA was cloned into pGEX-3X (Pharmacia). ODF2 protein, fused to glutathione-S-transferase (GST), was expressed by induction with 1 mM isopropyl-ß-thiogalactopyranoside at 37°C and proteins were separated on SDS-polyacrylamide gels (Laemmli, 1970) and transferred to Hybond-C (Towbin et al., 1979). The antiserum was first preabsorbed with immobilized total Escherichia coli proteins including GST. The preabsorbed antiserum was then incubated with total E.coli proteins containing the ODF2 protein fused to GST. Elution of bound antibodies was performed as described (Weinberger et al., 1985). Binding specificity of the eluted antibodies was tested on Western blots containing total ODF proteins as described previously.
Immunocytochemistry
Spermatozoa were washed in phosphate-buffered saline (PBS), air-dried onto slides and fixed in acetone. Spermatozoa were predigested with proteinase K (2 µg/ml) at 37°C for 30 min. Antibody incubation was performed with the affinity-purified anti-ODF2 antibody, diluted 1:400, for 2 h at room temperature. For detection, a second antibody linked to alkaline phosphatase and colour reaction with Nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phospate was used (NBT/BCIP).
In-situ hybridization
Human testes were fixed in Bouin's solution and embedded in paraffin. In-situ hybridization was performed as previously described (Hoyer-Fender et al., 1998). In-vitro transcripts of human Odf2 were labelled by incorporation of UTP-linked to digoxigenin (DIG). Both sense and antisense transcripts were hybridized in situ. After post-hybridization washings and RNase digestion transcripts were detected by the fluorochrome Cy3 using the TSA-Amplification System (DuPont/NEN). In brief, DIG-labelled RNA was detected by an anti-DIG-antibody linked to biotin. Biotin was detected by streptavidin linked to horseradish peroxidase and the signal amplified by biotin-tyramide. This last biotin-tyramide precipitate was detected by streptavidin-Cy3 (Devitron). The acrosomic vesicles were stained with peanut lectin-fluorescein isothiocyanate (FITC) for identification of germ cell stages.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Protein composition of ODF of human sperm tails
Although the protein composition of the ODF of rat spermatozoa has been well characterized (Vera et al., 1984
; Oko, 1988), that of the human sperm tail is a matter of controversy (Henkel et al., 1992; Stalf et al., 1993). Since the ODF are a main structural component of the sperm tail with a major influence on its morphology and motility, knowledge of their protein composition is imperative.
We used an antiserum raised against isolated ODF of rat spermatozoa to compare the protein composition of isolated ODF with those of total spermatozoa and to compare the protein pattern between rat, mouse, and man (Figure 1). The same protein pattern is found in rat ODF as well as in total rat spermatozoa (Figure 1, Rn ODF compared with Rn Sp). The antiserum reacts most strongly with proteins at ~21 kDa, and 30 kDa, which is ODF1, 40 kDa and several proteins in the molecular mass range of 70–85 kDa (Figure 1 arrows), whereas the preimmune serum showed no cross-reactivity (not shown). Since the protein pattern detected by the antiserum is the same in isolated ODF as well as in total spermatozoa the antiserum is useful for the detection of ODF proteins in total sperm proteins. If there was cross-reactivity to proteins that did not belong to the ODF they would be present in minor amounts only. Therefore, we assume that those proteins in total spermatozoa that are detected by the antiserum are indeed ODF proteins. This holds true particularly for the major proteins but may also include the minor or at least some of the minor proteins.
|
The protein composition of the ODF of mouse spermatozoa is similar to those of the rat (Figure 1
, Mm ODF compared with Rn ODF). Differences exist mainly in the quantity and in the molecular masses of minor proteins. One remarkable difference between mouse and rat ODF is the presence of a 21 kDa protein in rat which is absent in mouse. In humans we found a similar protein pattern to that in rat and mouse. The major proteins of human ODF (Figure 1, Hs Sp, arrowheads) are of 30, 40, and 55 kDa, and in the 85 kDa mass range but not the 70 kDa protein present in rat and mouse ODF, which is only a minor protein in human. There are at least 10 minor proteins of molecular mass 30–70 kDa, and more than five proteins with molecular masses >100 kDa in human ODF. To summarize, the overall protein pattern of human ODF is very similar compared to those of rat and mouse, with differences mainly in the quantity of some minor protein bands. We assume that human ODF consist of about 10 major proteins and of at least 15 minor proteins.
Several proteins are antigenically related and belong to ODF2
Affinity-purified antibodies directed against the protein encoded by rat Odf2 detect several proteins at ~85 kDa together with some proteins in the smaller molecular mass range (Brohmann et al., 1997; Hoyer-Fender et al., 1998). In humans, a similar ODF2 protein pattern is obtained (Figure 2). Total proteins of human, mouse and rat spermatozoa (Figure 2, Hs Sp, Mm Sp, Rn Sp) and total ODF proteins of mouse and rat (Figure 2, Mm ODF, Rn ODF) were separated on denaturing SDS gels and after transfer incubated with affinity purified anti-ODF2 antibodies (Figure 2). The main fraction of ODF2 proteins are at ~85 kDa. Two other proteins with strong reactivity to anti-ODF2 antibodies are found in human spermatozoa at 40 and 55 kDa which are also present in mouse and/or rat (arrowheads in Figure 2). In addition to these major ODF2 fractions two further proteins in human spermatozoa reacted only weakly with the anti-ODF2 antibodies (not shown). These are the 70 kDa protein present in major portions in rat and mouse, and a protein of <55 kDa which is also found in rat and mouse (arrows in Figure 2).
|
For all three species a very similar ODF2 pattern was obtained (Figure 2
). Besides the ODF1 protein fraction at ~30 kDa (Gastmann et al., 1993) the ODF2 proteins are the main fraction in total ODF proteins. Nevertheless, Figures 1 and 2 demonstrate that the ODF1 protein in addition to several minor ODF proteins were not detected by the affinity purified anti-ODF2 antibodies. Besides the two main protein fractions of ODF1 and ODF2 the ODF including those of man are composed of several previously unknown proteins which are, however, present only in minor quantities.
Cloning of human ODF2 cDNAs
From a human testis cDNA library we isolated two slightly different DNA sequences (ODF2/1 and ODF2/2, Figure 3) similar in sequence to mouse and rat Odf2. The nucleotide sequences of the 3' region and their deduced amino acid sequences are completely identical. In the 5' region one of the cDNA clones (ODF2/1) contains an insertion of 57 bp, encoding an additional 19 amino acids. The nucleotide sequences upstream from the putative translation start of ODF2/1 are identical to those of ODF2/2. There is a similarity between human ODF2/1 and mouse Odf2/1 (Hoyer-Fender et al., 1998) regarding the presence of the insertion in the 5' region and the sequences of the 5' untranslated regions; if we assume that human ODF2/1 corresponds to mouse Odf2/1, then translation starts with MKG in both clones.
|
Therefore, the open reading frame (ORF) of ODF2/1 extends from nucleotide 89 to 1918, encoding a protein of 610 amino acids with a putative molecular weight of 70.8 kDa and an isoelectric point of 6.22. The open reading frame of ODF2/2 starts at nucleotide position 248 and ends at position 2161. The putative protein consists of 638 amino acids and has a molecular mass of 73.4 kDa with an estimated isoelectric point of 7.2. The N-terminal region of ODF2/2 is 45 amino acids longer than that of ODF2/1, assuming that the first ATG in ODF2/1 at position 89 is the translation start. Therefore, the ORF of ODF2/1 starts with the sequence MKG, which is present at amino acid positions 46–48 of ODF2/2. Besides the additional 45 N-terminal amino acids in ODF2/2 and the insertion present in ODF2/1, both ODF2 proteins are completely identical in amino acid sequence.
The putative amino acid sequences of both human ODF2 proteins (HsODF2/1 and HsODF2/2) are also nearly identical to those of the mouse MmODF2/1 and MmODF2/2 (Hoyer-Fender et al., 1998; Figure 4). Human ODF2 have the same number of amino acids as their analogues in the mouse. HsODF2/1 differs only in 13 amino acids from MmODF2/1, HsODF2/2 differs in 11 amino acids from MmODF2/2. The N-terminal region and the start of translation of the human ODF2/1 are nearly identical to those of the rat RnODF2/1 (Brohmann et al., 1997), except for the insertion found in the human clone. An insertion of the same size could be detected by RT–PCR with sequence specific primers in rat testis cDNA (H.Brohmann and S.Hoyer-Fender, unpublished observations). The sequence variability, therefore, seems to be similar in human, mouse and rat ODF2/Odf2 cDNAs and their corresponding proteins.
|
Human ODF2 is transcribed in testis tissue
RT–PCR was carried out in order to determine the transcription of ODF2 in human tissues. Total RNA was isolated from human heart, liver, spleen, kidney, and testis and reverse transcribed. The cDNAs were amplified with primers specific for human ODF2 (78 and 79). The expected DNA fragment of 222 bp was found only in testis cDNA (Figure 5
). There were no products on cDNA of heart, liver, spleen and kidney. As a control, a PCR was carried out with primers 7 and 8, which are specific for a ubiquitously expressed nuclear protein (Singh et al., 1991). The expected PCR product of ~500 bp was found in all tissues examined. This result shows that we have chosen the correct conditions for amplification and ODF2 is transcribed exclusively in testis. Accordingly, ODF2 seems to be a testis-specific expressed gene.
|
Transcription of ODF2 is restricted to haploid germ cells
A non-radioactive in-situ hybridization was performed on human testis sections. Antisense or sense human ODF2 transcripts labelled with DIG–UTP were hybridized in situ. After post-hybridization washing, RNase digestion and amplification with TSA transcripts were detected by Streptavidin-Cy3 fluorescence (Figures 6 and 7
). For identification of the germ cell stages the acrosomic vesicles of the differentiating spermatids were stained with peanut-lectin-FITC. Hybridization with the antisense probe shows a specific fluorescence over the cytoplasm of round spermatids after signal amplification (Figure 6A) whereas the nuclei are essentially devoid of signals. Careful identification of the germ cell stages revealed that ODF2 transcripts could be detected at their highest concentration in the cytoplasm of step 2 round spermatids (Figure 6B,C) of stage II of the spermatogenic cycle. The merged image of Figure 6C demonstrates the co-localization of the hybridization signal with the round spermatids. In earlier round spermatids, low amounts of ODF2 are already present, but ODF transcripts were not found in elongating spermatids. The identification of the spermatogenic cycle was as previously described (Clermont, 1963).
|
|
As well as a light red background we obtained no results with the sense probe (Figure 7
) and with the antisense probe without signal amplification (not shown). Staining of the acrosomic vesicles with peanut lectin-FITC was useful not only for the identification of the germ cell stages but in addition demonstrates that hybridization with the sense probe yielded no specific signals although round spermatids of step 2 are present (Figures 7A,B).
Detection of ODF2 in whole sperm tails
The spermatozoa were digested with proteinase K, incubated with anti-ODF2 antibodies, and the antibodies detected by NBT/BCIP colour reaction of alkaline phosphatase linked to the secondary antibody. The annulus, which marks the border between the middle piece and the principal of the sperm tail is clearly visible (arrowheads in Figure 8). As it is evident from the dark staining in Figure 8A compared with the image of the whole spermatozoon shown by phase contrast (Figure 8B), ODF2 could be detected in the middle piece and extend to about half the principal piece of the sperm tails. Since ODF2 is a component of ODF (Brohmann et al., 1997) our results, therefore, support previous findings (Holstein and Roosen-Runge, 1981) which suggest that human ODF normally extends to ~60% of the principal piece. Control experiments without the first antibody or with the non-immune serum revealed no staining at all (Figure 8C).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
The ODF are a main cytoskeletal structure of the sperm tail. Up to now no active motility could be assigned to these fibres. Instead of being directly involved in the induction of progressive motility the ODF seem to have a modulating influence on sperm motility. They may provide tensile strength that is necessary to protect the sperm tail against shearing forces encountered during epididymal transport and especially during ejaculation (Baltz et al., 1990
).
Nevertheless the ODF are important for sperm morphology and function (Mortimer, 1997). Impaired development of the ODF has been described as a major cause of tail abnormalities in infertile men (Haidl et al., 1991). Despite their importance for the function of the sperm tail, their protein components are poorly described. Even the number and the molecular masses of human ODF proteins are a matter of controversy (Haidl et al., 1991; Henkel et al., 1992; Stalf et al., 1993).
We have shown that the overall protein pattern detected by an antiserum which is directed against ODF proteins of rat spermatozoa is nearly identical in mouse and rat ODF proteins and in total spermatozoa and it is also nearly identical in human spermatozoa. We therefore suppose that the antiserum essentially detects ODF proteins with no or only weak cross-reactivity to non-ODF proteins. Those proteins in total human spermatozoa that cross-react with the anti-rat ODF antiserum are, therefore, ODF proteins. Our results demonstrate that the main ODF proteins in human are also present in rat and mouse ODF (Figure 1). Most of these proteins belong to ODF2 as they cross-react with an affinity purified anti-ODF2 antibody (Figure 2). Of the 10 major ODF proteins found in human spermatozoa, the 30 kDa protein is ODF1 (Gastmann et al., 1993), whereas all other major proteins belong to ODF2. Of the ??? at least 15 minor ODF proteins found in human spermatozoa, two of them belong to ODF2 (Figure 2), i.e. a protein at 70 kDa and another protein of <55 kDa, although the other proteins have not yet been identified. In addition to ODF1 and ODF2, therefore, human ODF consists of several previously unknown proteins present in minor quantities. Some proteins in human ODF may not be detected by the anti-rat ODF-antiserum, so increasing the number of protein components of human ODF. Nevertheless, the scaffold of the fibrils of the ODF seems to consist mainly of ODF2 and ODF1.
Based on the ODF protein patterns, a high degree of evolutionary conservation of the proteins may be presumed. By cloning the 30 kDa Odf1 cDNA we have shown that a high sequence similarity exists both at the nucleotide and the amino acid sequence levels between rat, mouse and man (Hoyer-Fender et al., 1995). The polypeptides encoded by human ODF1 cDNA and rat Odf1 cDNA have a sequence similarity of 84% (Gastmann et al., 1993). The molecular cloning of the cDNAs encoding further predominant ODF proteins, ODF2, demonstrates the high evolutionary conservation which we show here by comparing the sequences of man, mouse and rat (Figure 4). From each species we isolated two slightly different Odf2 cDNAs which show very high conserved 3' regions and more variable 5' regions. The C-terminal sequences not depicted in Figure 4 are nearly completely identical in all identified ODF2 proteins of rat (Brohmann et al., 1997), mouse (Hoyer-Fender et al., 1998) and man. An exception is an insertion of 23 amino acids found only in some rat proteins (Brohmann et al., 1997). The two human ODF2 cDNAs (ODF2/1 and ODF2/2; Figure 3) are nearly identical to those from mouse (Hoyer-Fender et al., 1998). The amino acid sequences of ODF2/1 and ODF2/2 from man, mouse and rat have a sequence similarity of >97%, despite their variable N-terminal regions. This high degree of similarity may indicate a high evolutionary pressure acting on this gene demonstrating therefore an important role for the function of the spermatozoa. The conserved C-terminal region of ODF2 contains two leucine zipper motifs (Brohmann et al., 1997) that are required for interaction with ODF1 (Shao et al., 1997). The more variable 5' regions may yield proteins with differences in sequence and length of their putative N-terminal regions in addition to small amino acid insertions or deletions. The variability of the 5' region, respectively the N-terminal region, is probably the reason for the heterogeneity of the proteins detected by the anti-ODF2 antibodies.
Transcription of ODF2 is restricted to testis tissue and more specifically to round spermatids. These results were expected, since the gene encodes a sperm tail protein and is similar to findings in the rat and mouse. Moreover, the non-radioactive in-situ hybridization on human testis demonstrates its applicability on tissues with low expression levels. The in-situ hybridization shows the expected pattern of transcript localization in the cytoplasm whereas the nuclei are completely devoid of ODF2 RNA. ODF2 transcript levels were found to peak in stage II round spermatids, whereas no transcripts were found in elongating spermatids.
The isolation and characterization of the cDNAs encoding the most prominent ODF proteins of human spermatozoa is important both for understanding the genetic factors in sperm motility, and for diagnosing male infertility. In cases of sperm motility disturbances caused by tail defects, it is important to prevent the patients from having to undergo further frustrating therapeutic trials. The detection of ODF2 proteins in the whole sperm tail by antibodies enables easy and inexpensive screening for their localization in patients with sperm motility disorders.
|
Acknowledgments |
|---|
This work was supported by the Bundesministerium für Bildung, Wissenschaft, Forschung und Technologie (01 KY 9504 to S.H.-F.). The nucleotide sequences reported here have been submitted to the GenBank/EMBL Data Bank with accession numbers AF 012549 (ODF2/1) and AF 053970 (ODF2/2).
|
Notes |
|---|
3 To whom correspondence should be addressed
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Baccetti, B., Pallini, V. and Burrini, A.G. (1973) The accessory fibers of the sperm tail. 1 Structure and chemical composition of the bull `coarse fibers'. J. Submicrosc. Cytol., 5, 237–256.
Baltz, J.M., Williams, P.O. and Cone, R.A. (1990) Dense fibers protect mammalian sperm against damage. Biol. Reprod., 43, 485–491.[Abstract]
Benton, W.D. and Davis, R.W. (1977) Screening lambda gt recombinant clones by hybridisation to single plaques in situ. Science, 196, 180–182.
Brohmann, H., Pinnecke, S. and Hoyer-Fender, S. (1997) Identification and characterisation of new cDNAs encoding outer dense fiber proteins of rat sperm. J. Biol. Chem., 272, 10327–10332.
Burfeind, P. and Hoyer-Fender, S. (1991) Sequence and developmental expression of a mRNA encoding a putative protein of rat sperm outer dense fibers. Dev. Biol., 148, 195–204.[Web of Science][Medline]
Burfeind, P., Belgardt, B., Szpirer, C. and Hoyer-Fender, S. (1993) Structure and chromosomal assignment of a gene encoding the major protein of rat sperm outer dense fibers. Eur Biochem., 216, 497–505.[Web of Science][Medline]
Calvin, H.I. (1979) Electrophoretic evidence for the identity of the major zinc-binding polypeptides in the rat sperm tail. Biol. Reprod., 21, 873–882.[Abstract]
Chen, E.Y. and Seeburg, P.H. (1985) Supercoil sequencing: A fast and simple method for sequencing plasmids. DNA, 4, 165–170.[Web of Science][Medline]
Chomczynski, P. and Sacchi, N. (1987) Single step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal. Biochem., 162, 156–159.[Web of Science][Medline]
Clermont, Y. (1963) The cycle of the seminiferous epithelium in man. Am. J. Anat., 112, 35–51.[Web of Science][Medline]
Fawcett, D.W. (1975) The mammalian spermatozoon. Dev. Biol., 11, 391–436
Feinberg, A.P. and Vogelstein, B. (1983) A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem., 132, 6–13.[Web of Science][Medline]
Gastmann, O., Burfeind, P., Günther, E. et al. (1993) Sequence, expression, and chromosomal assignment of a human sperm outer dense fiber gene. Mol. Reprod. Dev., 36, 407–418.[Web of Science][Medline]
Haidl, G., Becker, A. and Henkel, R. (1991) Poor development of outer dense fibres as a major cause of tail abnormalities in the spermatozoa of asthenoteratozoospermic men. Hum. Reprod., 6, 1431–1438.
Henkel, R., Stalf, T. and Miska, W. (1992) Isolation and partial characterisation of the outer dense fiber proteins from human spermatozoa. Biol. Chem. Hoppe-Seyler, 373, 685–689.[Web of Science][Medline]
Holstein, A.F. and Roosen-Runge, E.C. (1981) Atlas of Human Spermatogenesis. Grosse, Berlin, Germany.
Hoyer-Fender, S,. (1993) Identity of two rat testis cDNAs. Dev. Biol., 157, 553.[Web of Science][Medline]
Hoyer-Fender, S., Burfeind, P. and Hameister, H. (1995) Sequence of mouse Odf1 cDNA and its chromosomal localisation: extension of the linkage group between human chromosome 8 and mouse chromosome 15. Cytogent. Cell. Genet., 70, 200–204.[Web of Science][Medline]
Hoyer-Fender, S., Petersen, C., Brohmann, H. et al. (1998) Mouse Odf2 cDNAs consist of evolutionary conserved as well as highly variable sequences and encode outer dense fiber proteins of the sperm tail. Mol. Reprod. Dev., 51, 167–175.[Web of Science][Medline]
Kim, Y., Adham, I.A., Haack, T. et al. (1995) Molecular cloning and characterisation of the bovine and porcine outer dense fibers cDNA and organisation of the bovine gene. Biol. Chem. Hoppe-Seyler, 376, 431–435[Web of Science][Medline]
Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of the bacteriophage T4. Nature, 227, 680–685.[Medline]
Lindemann, C.B. (1996) Functional significance of the outer dense fibers of mammalian sperm examined by computer simulation with the geometric clutch model. Cell. Motil. Cytoskel., 34, 258–270.[Web of Science][Medline]
Morales, C.R., Oko, R. and Clermont, Y. (1994) Molecular cloning and developmental expression of an mRNA encoding the 27 kDa outer dense fiber protein of rat spermatozoa. Biol. Reprod., 37, 229–240.
Mortimer, S.T. (1997) A critical review of the physiological importance and analysis of sperm movement in mammals. Hum. Reprod. Update, 3, 403–439.
Oko, R. (1988) Comparative analysis of proteins from the fibrous sheath and outer dense fibers of rat spermatozoa. Biol. Reprod., 14, 169–182.
Sanger, F., Nicklen, S. and Coulson, A. R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA, 74, 5463–5467.
Schäfer, U. (1986) Genes for male specific transcripts in Drosophila melanogaster. Mol. Gen. Genet., 202, 219–225.
Shao, X., Tarnasky, H.A., Schalles, U. et al. (1997) Interactional cloning of the 84-kDa major outer dense fiber protein Odf84. J. Biol. Chem., 272, 6105–6113.
Singh, P.B., Miller, J.R., Pearce, J. et al. (1991) A sequence motif found in a Drosophila heterochromatin protein is conserved in animals and plants. Nucleic Acids Res., 19, 789–794.
Stalf, T., Henkel, R. and Miska, W. (1993) Weitere Untersuchungen zur Proteinzusammensetzung der Mantelfasern in menschlichen Spermatozoen. Fertilität, 9, 203–209.
Towbin, H., Staehelin, T. and Gordon, J. (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: Procedure and some applications. Proc. Natl. Acad. Sci. USA, 76, 4350–4354.
Van der Hoorn, F.A., Tarnasky, H. A. and Nordeen, S.K. (1990) A new rat gene RT7 is specifically expressed during spermatogenesis. Dev. Biol., 142, 147–154.[Web of Science][Medline]
Vera, J.E., Brito, M., Zuvic, T. and Burzio, L.O. (1984) Polypeptide composition of rat sperm outer dense fibers. A simple procedure to isolate the fibrillar complex. J. Biol. Chem., 259, 5970–5977.
Weinberger, C., Hollenberg, S.M., Ong, E.S. et al. (1985) Identification of human glucocorticoid receptor complementary DNA clones by epitope-selection. Science, 228, 740.
Submitted on October 14, 1998; accepted on March 31, 1999.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  E. Bonilla and E. Y. Xu Identification and characterization of novel mammalian spermatogenic genes conserved from fly to human Mol. Hum. Reprod., March 1, 2008; 14(3): 137 - 142. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N.-K. Soung, Y. H. Kang, K. Kim, K. Kamijo, H. Yoon, Y.-S. Seong, Y.-L. Kuo, T. Miki, S. R. Kim, R. Kuriyama, et al. Requirement of hCenexin for Proper Mitotic Functions of Polo-Like Kinase 1 at the Centrosomes Mol. Cell. Biol., November 15, 2006; 26(22): 8316 - 8335. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Kumar, N. Rangaraj, and S. Shivaji Activity of Pyruvate Dehydrogenase A (PDHA) in Hamster Spermatozoa Correlates Positively with Hyperactivation and Is Associated with Sperm Capacitation Biol Reprod, November 1, 2006; 75(5): 767 - 777. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.P. Dadoune, A. Pawlak, M.F. Alfonsi, and J.P. Siffroi Identification of transcripts by macroarrays, RT-PCR and in situ hybridization in human ejaculate spermatozoa Mol. Hum. Reprod., February 1, 2005; 11(2): 133 - 140. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. F. Donkor, M. Monnich, E. Czirr, T. Hollemann, and S. Hoyer-Fender Outer dense fibre protein 2 (ODF2) is a self-interacting centrosomal protein with affinity for microtubules J. Cell Sci., September 15, 2004; 117(20): 4643 - 4651. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. H. Ing, A. M. Laughlin, D. D. Varner, T. H. Welsh Jr., D. W. Forrest, T. L. Blanchard, and L. Johnson Gene Expression in the Spermatogenically Inactive "Dark" and Maturing "Light" Testicular Tissues of the Prepubertal Colt J Androl, July 1, 2004; 25(4): 535 - 544. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. L. Pixton, E. D. Deeks, F. M. Flesch, F. L.C. Moseley, L. Bjorndahl, P. R. Ashton, C. L.R. Barratt, and I. A. Brewis Sperm proteome mapping of a patient who experienced failed fertilization at IVF reveals altered expression of at least 20 proteins compared with fertile donors: Case report Hum. Reprod., June 1, 2004; 19(6): 1438 - 1447. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Kitamura, Y. Miyagawa, N. Iguchi, H. Nishimura, H. Tanaka, and Y. Nishimune Molecular cloning and characterization of the human orthologue of the oppo 1 gene encoding a sperm tail protein Mol. Hum. Reprod., May 1, 2003; 9(5): 237 - 243. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Yu, R. Oko, and A. Miranda-Vizuete Developmental Expression of Spermatid-Specific Thioredoxin-1 Protein: Transient Association to the Longitudinal Columns of the Fibrous Sheath During Sperm Tail Formation Biol Reprod, November 1, 2002; 67(5): 1546 - 1554. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Nakagawa, Y. Yamane, T. Okanoue, S. Tsukita, and S. Tsukita Outer Dense Fiber 2 Is a Widespread Centrosome Scaffold Component Preferentially Associated with Mother Centrioles: Its Identification from Isolated Centrosomes Mol. Biol. Cell, June 1, 2001; 12(6): 1687 - 1697. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. J. Flickinger, J. Rao, L. Ann Bush, N. E. Sherman, R. J. Oko, F. C.L. Jayes, and J. C. Herr Outer Dense Fiber Proteins Are Dominant Postobstruction Autoantigens in Adult Lewis Rats Biol Reprod, May 1, 2001; 64(5): 1451 - 1459. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||