Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (70)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Baranova, H.
Right arrow Articles by Bruhat, M.A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baranova, H.
Right arrow Articles by Bruhat, M.A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Human Reproduction, Vol. 5, No. 7, 636-641, July 1999
© 1999 European Society of Human Reproduction and Embryology

Possible involvement of arylamine N-acetyltransferase 2, glutathione S-transferases M1 and T1 genes in the development of endometriosis

H. Baranova1,5, M. Canis2, T. Ivaschenko3, E. Albuisson4, R. Bothorishvilli2, V. Baranov3, P. Malet1 and M.A. Bruhat2

1 Laboratoire d'Histologie-Embryologie-Cytogénétique, Faculté de Médecine, Université d'Auvergne, 28 Place H.Dunant, B.P. 38, Clermont-Ferrand 63001, 2 Departement de Gynécologie et Obstetrique, Polyclinique–CHU, Clermont-Ferrand 63000, France, 3 Center of Hereditary Pathology, St Petersburg 199034, Russia, and 4 Laboratoire de Biostatistiques et Informatique Médicale, Faculté de Médecine, Université d'Auvergne, Clermont-Ferrand 63001, France


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Wide inter-individual variation of expression of compound metabolic enzymes is determined by polymorphism and may predispose the development of diseases provoked by environmental factors. The combined analysis of phase II detoxification system genes: arylamine N-acetyltransferase 2 (NAT2), and glutathione S-transferases (GST) M1 and T1 was carried out in patients with minimal/mild (group I; n = 36) and moderate/severe endometriosis (group II; n = 29) and controls (n = 72) of French origin, using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP). The results show a significant difference between patients and controls with regard to NAT2 gene polymorphism (P < 0.05). This is mainly due to the high percentage of slow acetylator genotypes (SA) in patients compared with controls (60.0 versus 38.9%; P < 0.02) with a distinct preponderance in subjects with minimal/mild endometriosis (69.4%, P < 0.005) where there is a significantly elevated frequency of slow allele S1 (NAT2*5) (P = 0.05). Significantly increased proportions of GSTM1-deficient genotypes were found in both groups of patients, in comparison with the controls (75.0 and 79.3% versus 45.8%; P < 0.0001). A preponderance of GSTT1-negative subjects among patients was also detected, but did not appear significant. We suggest the involvement of both NAT2 and GSTM1 detoxification system genes in the pathogenesis of endometriosis and the possible impact of NAT2 gene polymorphism in the development of different forms of this disease.

arylamine N-acetyltransferase2/detoxification/endometriosis/glutathione S-transferase/polymorphism


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Recent ecogenetic and pharmacogenetic studies (Daly et al., 1994Go; Nebert, 1997Go) show the importance of intraindividual hereditary variations of foreign compound metabolizing enzymes, which contribute to: (i) differences in responses to environmental agents, which may lead to development of environmentally provoked diseases [lung cancer, bladder cancer (Brockmuller et al., 1996Go) and chronic bronchitis (Baranova et al., 1997aGo)]; and (ii) interindividual variation of drug effects (Meyer et al., 1997).

Endometriosis is a multifactorial disease with significantly elevated frequency in industrial areas (Nisolle et al., 1997Go) and possible genetic predisposition (Kennedy et al., 1996Go). The important role of numerous environmental toxins, including organochlorines and specially dioxins has been also demonstrated (Osteen et al., 1997).

We postulated that the lack of detoxification, which is determined genetically, might be a risk factor for development of endometriosis. Our initial results have suggested the involvement of glutathione S-transferase (GST) M1 gene (phase II of detoxification) in the pathogenesis of this disease due to the high preponderance of GSTM1-deficient subjects among patients (Baranov et al., 1996Go; Baranova et al., 1997bGo). Current investigations are devoted to the other members of phase II detoxification system genes: arylamine N-acetyltransferase 2 (NAT2) and glutathione S-transferase T1 (GSTT1).

The polymorphism of NAT2 gene considerably affects the activity of arylamine N-acetyltransferase 2 enzyme and therefore N-acetylation and biotransformation of xenobiotics with a primary aromatic amine or a hydrazine structure (Hein et al., 1993Go), such as toxic nitrosamines in tobacco smoke, antioxidants and pesticides. It is also implicated in drug metabolism, including drug–drug interactions (Speilberg, 1996Go). According to variation of NAT2 enzyme activity, the population is divided in two main groups of slow (SA) and rapid acetylators (RA). SA are homozygous for the recessive forms of NAT2 gene, have two slow alleles and decreased levels of NAT2 protein up to 20% (Grant et al., 1990); RA are characterized by the presence of at least one wild-type NAT2 fast allele (Cascorbi et al., 1995Go). Of Caucasians, ~50% are SA, but this proportion differs considerably according to geographical regions (Daly, 1994). Numerous studies report the association of NAT2 slow genotypes with susceptibility to a variety of diseases, including bladder cancer (Brockmuller et al., 1996Go), hepatocellular carcinoma (Agundez et al., 1996Go) and breast cancer (Ambrosone et al, 1996Go).

GSTs play an important role in the defence reactions of the organism by glutathione conjugation with electrophilic compounds (Mannervik et al., 1985). They are involved in detoxification of polycyclic aromatic hydrocarbons (found in tobacco smoke, food, and combustion fumes) and also pesticides (Chasseaud et al., 1979). GSTM1 and GSTT1 genes are polymorphic and the presence of two 0-alleles in each gene corresponds to the presence of deletion with consequent loss of mRNA and protein product (Seidegard et al., 1988Go; Arand et al., 1996Go). The percentage of GSTM1-deficient individuals is ~45% in the general Caucasian population, but it is greatly increased in patients with tobacco-induced lung and bladder cancer (Seidegard et al., 1990Go; Brockmoller et al., 1996). GSTT1 deletion is present in 15% of Caucasians. Both GSTM1 and GSTT1 genes seem to be involved in pathogenesis of different types of cancers and can be considered as risk modifiers for various environmentally induced diseases (Lear et al., 1996Go; Sarhanis et al., 1996Go).

In the current study, comparative analysis of distribution of NAT2-, GSTM1- and GSTT1- deficient genotypes and precise allelic detection were carried out in patients with different stages of endometriosis and controls in order to estimate possible impact of NAT2, GSTM1 and GSTT1 gene polymorphisms in development of this disease.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Patients
Previously described controls (n = 72) and patients (n = 50), who were analysed for the presence of GSTM10/0 deletion (Baranova et al., 1997) and also 15 new patients with different stages of endometriosis were included in this study, which was carried out in Polyclinique, Centre Hospitalier Université de Clermont-Ferrand, France. All individuals were women of reproductive age of French origin and from Central France. Only patients with clinically, endoscopically and histologically confirmed diagnoses were studied (Canis et al., 1995Go). According to the revised American Fertility Society (AFS, 1985) classification, all patients were staged into two groups: group 1 = AFS stage I–II; group 2 = AFS stages III–IV. Women who were admitted to the hospital for voluntary abortions and who did not have any malignant pathology were included in the control group. The absence of endometriosis in controls was verified by standard examination and ovarian ultrasound procedure (Canis et al., 1992Go). Anamnestic data were obtained in a 10 min interview by the clinicians and information for statistical analysis was scored as present/absent for: (i) life history factors: smoking (current, regular or occasional; Perriot, 1995Go), allergy [delayed or intermediated hypersensitivity and type of allergy; (Bousquet et al., 1993Go)], chronic diseases, previous pregnancies; (ii) clinical features: pelvic pain syndrome, infertility and relapses (recurrence of clinical symptoms) (International Dictionary of Medicine and Biology, 1986Go; Canis et al., 1992Go). Information about residence (city/village) of all studied individuals was also included.

Laparoscopic treatment and associated procedures for ovulation disorders, if necessary, were applied in patients with infertility. Pain was treated by laparoscopic procedures in combination with post-operative pharmacotherapy (progestins, luteinizing hormone-releasing hormone: Canis et al., 1992Go).

Genetic analysis
Polymorphism in three genes: NAT2, GSTT1 and GSTM1 of the phase II of detoxification system was detected by polymerase chain reaction (PCR) and PCR restriction fragment length polymorphisms (PCR–RFLP). PCR and PCR–RFLP were performed directly from blood spots, as described previously (Baranov et al., 1991Go).

Correlation between the genotype and enzyme activity for all three genes has been demonstrated in previous studies (Brockmoller et al., 1994; Cascorbi et al., 1995Go; Arand et al., 1996Go) and, therefore, it has not been performed in the present investigation.

NAT2 gene
NAT2 gene polymorphism was detected in four polymorphic sites, as previously described (Spurr et al., 1995Go) with slight modifications and adoption of PCR–PFLP procedure for direct analysis without DNA extraction. Three most common slow alleles: S1, S2, S3 (NAT2*5, NAT2*6, NAT2*7) respectively according to a new classification (Cascorbi et al., 1995Go); and one wild-type fast allele: F1 (NAT2*4) were identified. Single PCR amplification was performed with the primers: P1: 5'-GCTGGGTCTGGAAGCTCCTC-3' and P2: 5'-TTGGGTGATACATACACAAGGG-3' in 50 µl of PCR mixture, containing: 2.5 µl of 10 mM dNTP, 5 µl of 10x buffer (GibcoBRL; Life technologies SARL, Cedex, France), 4 µl of 50 mM MgCl2 (GibcoBRL), 0.5 µl of each primer (50 mM), 5 IU Taq DNA polymerase (GibcoBRL), H2O up to 50 µl. A small fragment of a blood spot (1 mm2) was plunged in the mixture, which was then overlaid with one drop of mineral oil. PCR was started by 5 min of initial denaturation followed by 35 cycles of 94°C for 40 s; 58°C for 1 min; 72°C for 1 min and final extension for 7 min. Amplified products were restricted with the enzymes: KpnI (for the detection of C<<T point mutations at nucleotide (nt) position 481), DdeI (for A<<G at nt position 803), TaqI (for G<<A at nt position 590) and BamHI (for G<<A at nt position 857). Electrophoresis was carried out in 7% of polyacrylamide gel at 200 V for 90 min stained with ethidium bromide (Figure 1Go).



View larger version (41K):
[in this window]
[in a new window]
 
Figure 1. Detection of NAT2 alleles by direct polymerase chain reaction (PCR)–restriction fragment length polymorphism (RFLP). M = Marker: DNA digested with Pst1; Hs1 = heterozygote for S1 slow allele; Fw = homozygote for wild-type fast allele (NAT2*4); S1m = homozygote for S1 slow allele; S2m = homozygote for S2 slow allele; Hs2 = heterozygote for S2 slow allele; Hs3 = heterozygote for S3 slow allele.

 
GSTT1 gene
GSTT10/0 deletions were detected by internal standard-controlled PCR in 25 ml of PCR mixture of: 1.5 µl of 10 mM dNTP, 2.5 µl of 10/ buffer (GibcoBRL; Life Technologies SARL, Cedex, France), 2.5 µl of 50 mM MgCl2 (GibcoBRL), 0.5 µl of each primer (50 mM), 2.5 IU Taq DNA polymerase (GibcoBRL), H2O up to 25 µl. GSTT1 forward primer: 5'–TTCCTTACTGGTCCTCACATCTC-3' and GSTT1 reverse primer: 5'–TCACCGGATCATGGCCAGCA–3' (Arand et al., 1996Go) were applied for amplification of 450 bp fragment, which corresponds to GSTT1 gene and primers 1A1S: 5'-GAACTGCCACTTCAGCTGTCT-3', 1A1ASHincII: 5'-GAAAGACCTCCCAGCGGTCA-3' for the CYP1A1 gene with result product of 187 bp (Oyama et al., 1995Go) were used as internal control. PCR parameters were as following: 5 min of initial denaturation; 33 cycles of 94°C for 55 s, 64°C for 1 min, 72°C for 1 min; and a final extension for 7 min.

This approach enabled the peculiarities of CYP1A1 Ile–Val gene polymorphism to be studied by following restriction of the amplified product with HincII restriction enzyme. Electrophoresis was carried out in 7% of polyacrylamide gel at 200 V 90 min stained with ethidium bromide (Figure 2).

GSTM1 gene
GSTM1 gene deficiency (GSTM10/0 genotype) and precise alleleic detection (GSTM1A*, GSTM1B* and GSTM10*) in our first 50 patients and 72 controls were identified as described (Baranova et al, 1997). These results are included in current combined analysis of genetic polymorphisms and life history factors.

Statistical analysis
The BMDP4F program (Dixon et al., 1992) was applied to calculate the Pearson {chi}2 test of independence and, if the minimum expected frequency was too low, Fisher's exact test was used. Mantel–Haenszel analysis (Mantel et al., 1959) was performed to estimate the odds ratio common to different levels and to test whether it was equal to one.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The results of genetic analysis are summarized in Tables I–IIIGoGoGo and show the significant impact of GSTM1 and NAT2 gene polymorphisms, but not of GSTT1 gene polymorphisms in development of endometriosis (P = 0.001; P = 0.031 and not significant respectively; Table IGo).


View this table:
[in this window]
[in a new window]
 
Table I. Distribution of patients with endometriosis and controls according toGSTM1,GSTT1 andNAT2 genotypes and the impact of polymorphic effects of each gene in development of endometriosis.Figures in parentheses are percentages
 

View this table:
[in this window]
[in a new window]
 
Table II. Frequencies of detectedNAT2 alleles and comparative analysis of their distribution in patients and controls
 

View this table:
[in this window]
[in a new window]
 
Table III. Distribution of clinical symptoms relative toGSTM1 andNAT2 genotypes in endometriosis patients. Figures in parentheses are percentages
 
NAT2 gene polymorphism
Polymorphic effects of NAT2 gene mainly corresponded to the high proportion of SA genotypes in patients: 60.0 versus 38.9% in controls (P = 0.017) (Table IGo).

Precise statistical analysis of each group of patients compared to controls revealed that the highest percentage of SA genotypes was present in the group of patients with minimal/mild endometriosis (69.4%; versus 38.9% in controls; P = 0.004), but not that with moderate/severe endometriosis (48.3% versus 38.9% in controls; not significant) (Table IGo). Also, the number of heterozygotes for NAT2 gene appeared to be significantly low in patients with minimal/mild forms of disease (27.8% versus 48.6% in controls; P = 0.042), but again not those with moderate/severe forms (44.8%; versus 48.6% in controls; not significant). Finally, for development of different stages of endometriosis the impact of NAT2 gene polymorphism was found to be marginally statistically significant (P = 0.065).

Moreover, comparative analysis of allelic frequencies showed a significant difference in distribution of slow and fast alleles between all patients and controls (P = 0.01) (Table IIGo). Interestingly, this difference contributed to the group I of patients with minimal/mild endometriosis, but not to the group II (Table IIGo). So, the proportion of S1 was higher in patients with minimal/mild endometriosis (0.53 versus 0.38 in controls; P = 0.05), but not in patients with moderate/severe forms (0.40; not significant). The significantly decreased frequency of allele F was also observed in group I of patients (0.17 versus 0.37 in controls; P = 0.01), but not in group II (0.29; not significant). The proportions of S2 and S3 were nearly equal in all studied groups.

GSTM1 gene polymorphism
The analysis of 15 additional patients did not affect previously reported results (Baranova et al., 1997bGo). The proportion of GSTM1-negative subjects among patients remained highly significant (76.9 versus 45.8%; P = 0.0001) and did not vary much between the two groups of patients (group I: 75.0%; group II: 79.3%). The significantly decreased number of individuals with GSTM1A/B and GSTM1A/0 (or A/A) also seems to be common to both groups of patients, compared with the controls (Table IGo).

GSTT1 gene polymorphism
The preponderance of GSTT1-negative subjects was observed in both groups of patients, but did not appear to be significant (20.0% in all patients against 9.7% in controls; not significant) (Table IGo).

Combined analysis of the deficiencies in GSTM1, GSTT1 and NAT2
The combined analysis of the deficiencies in studied genes did not reveal any increased risk, synergistic or antagonistic effect on predisposition and development of endometriosis. No correlation between NAT2 polymorphic effects, life history factors (smoking, chronic pathology, allergy, age) and severity of the disease has been found up to date.

Life history factors and anamnestic data
The results of current analysis of patients and controls relative to age, allergy, chronic pathology, smoking and pregnancies did not differ from that previously performed and were significant for age (P < 0.001) and smoking (P < 0.0135) (Baranova et al., 1997bGo).

There was no significant difference in distribution of all studied individuals according to their residence and 69.2% of patients and 79.2% of controls lived in urban areas. Differencies in the clinical picture in patients with minimal/mild and moderate/severe forms of endometriosis and the effects of GSTM1 and NAT2 deficiencies are presented in Table IIIGo. The comparison of the two groups revealed a significant difference for the presence of relapses (P = 0.01), but not for the pain syndrome and infertility. Nevertheless, patients without any positive effect after treatment of pain syndrome represented only 16.7% in the group with minimal/mild endometriosis compared with 34.5% in the group with moderate/severe forms. Interestingly, the number of patients with no positive effect after treatment of infertility was elevated in group I: 36.1% (13 cases) versus 27.6% (eight cases).

The analysis of patients according to clinical symptoms and distribution of GSTM1- and NAT2-deficient genotypes revealed that the proportions of GSTM1 deletion in patients without positive effect after infertility treatment were nearly equal between group I and II, but the percentages of NAT2 SA genotypes were very different (92.3% in group I versus 62.5% in group II). The same trends were observed for relapses and presence of the pain syndrome (Table IIIGo). The small number of studied cases means that these differences cannot be considered to be significant and the results are mostly descriptive, but nevertheless, these first data indicate possible GSTM1 and NAT2 polymorphic effects in endometriosis patients according to the form of disease.


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Peculiarities of NAT2 and GSTM1 gene polymorphisms in endometriosis patients
NAT2 gene
The over-representation of slow NAT2 alleles, particularly S1 and under-representation of fast allele and consequently increased number of SA genotypes in patients with endometriosis, suggest a significant impact of the NAT2 gene in development of this disease.

Unexpectedly, the preponderance of NAT2 SA genotypes was related mainly to the patients with minimal/mild endometriosis. Moreover, the frequencies of slow alleles were nearly equal in patients with moderate/severe endometriosis and controls. The descriptive analysis of clinical symptoms and NAT2 polymorphic effects in patients also shows trends towards diversion in the two studied groups (Table IIIGo). Interestingly, other investigations also indicate notable differences between minimal/mild and moderate/severe endometriosis according to clinical symptoms, especially pelvic pain and infertility (Thornton et al., 1997Go), immune status (Arichi et al., 1996), role of growth factors (Shifren et al., 1996Go) and morphological criteria (Nisolle et al., 1997Go).

Our results are the first indication that NAT2 deficiency might be involved in development of different forms of endometriosis.

GSTM1 gene and GST status
Interestingly, the impact of GSTM1 gene polymorphisms in endometriosis does not appear to be similar to that of NAT2. The proportions of GSTM1 negative subjects do not differ significantly between the groups I and II of patients and are increased with the severity of disease, whereas the percentage of active GSTM1 genotypes is decreased. Finally, no patient with GSTM1A/B genotype, which corresponds to the highest activity of GSTM1 enzyme was found in group II (moderate/severe endometriosis; Table IGo). These data are consistent with our earlier findings (Baranova et al., 1997bGo). Distribution of clinical symptoms according to the GSTM1 gene polymorphism appears to follow a reverse pattern when compared with the impact of NAT2 deficiency, particularly for relapses, presence of pain syndrome and infertility. The detection of GSTT1 deletion indicates certain, but non-significant preponderance of GSTT1-negative subjects among patients, which has the same trend as GSTM1 deficiency and is correlated with earlier results (Chen et al., 1996Go) obtained in Caucasians.

Other investigations of GSTs and xenobiotic pathways in endometriosis patients are necessary. However, there is a high likelihood that the lack of such an important metabolic pathway as glutathione conjugation might be a risk factor for susceptibility to endometriosis, so analysis of GST status, particularly detection of GSTM1 deficiency, could have a prognostic significance.

Biotransformation process and endometriosis
Metabolic pathways of xenobiotics include their activation during the phase I of the biotransformation process followed by conjugation of highly toxic intermediate metabolic products during phase II. Therefore, expression of phase I and II enzymes must be well co-ordinated.

The genes which code for foreign compound metabolizing enzymes are highly polymorphic, so the presence of deletions or slow alleles can provoke imbalanced interactions of phase I and II. In relation to environmentally induced diseases and drug metabolism, the supergene families of cytochrome P-450 (CYP) (phase I), GST, and NAT (phase II) play a key role. Several investigations reported the dramatically increased risk for cancer susceptibility in the case of association of some alleleic variants in CYP, GST and NAT2 genes (Warwick et al., 1994Go; Brockmuller et al., 1996Go). Interestingly, the CYP1A1, CYP1A2, CYP1B1 of phase I, which are known as dioxin inducible genes, seem to play a role in development of endometriosis (Johnson et al, 1997Go). NAT and GST act on the products of phase I and in case of altered mechanism might be involved in adverse immune reactions. Thus, slow acetylation as a result of NAT2 gene polymorphism is believed to be a risk factor for the induction of cytotoxity and immune response to neoantigens because of increased covalent binding of reactive metabolites (Spielberg, 1996). The involvement of the immune system in the development of endometriosis due to participation of natural killer (NK) cells (Provinciali et al., 1995Go) and activated macrophages (Kligman et al., 1996Go) has been suggested by other authors (Rier et al., 1997). These reactions might be provoked by environmental toxins either directly or by formation of intermediate toxic endogenous compounds (Osteen et al., 1997). The changes in NK activity and their correlation with the severity of endometriosis are well known (Koninckx et al., 1994). Recent investigations demonstrate that this phenomenon might be also connected with decreased glutathione content, which contributes to disorders in thr cytoskeleton components with consequent impairment of NK cell activity (Malorni et al., 1997Go). From these data we can speculate on possible involvement of acetylation and gluthatione conjugation reactions in pathogenesis of endometriosis.

In conclusion, we suggest the participation of at least two genes of the phase II detoxification system in development of endometriosis.


    Notes
 
5 To whom correspondence should be addressed Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Ambrosone, C.B., Freudencheim, J.L., Graham, S. et al. (1996) Cigarette smoking, N-acetyltransferase 2 genetic polymorphisms, and breast cancer risk. J. Am. Med. Assoc., 276, 1494–1512.[Abstract/Free Full Text]

American Fertility Society (1985) Revised American Fertility Society classification of endometriosis: 1985. Fertil. Steril., 43, 351–352.[Medline]

Agundez, J.A., Olivera, M., Ladero, J.M. et al. (1996) Increased risk for hepatocellular carcinoma in NAT2-slow acetylators and CYP2D6-rapid metabolizers. Pharmcogenetics, 6, 501–512.[Web of Science][Medline]

Arand, M., Muhlbauer, R., Hengstler, J. et al. (1996) A multiplex polymerase chain reaction protocol for the simultaneous analysis of the glutathione S-transferase GSTM1 and GSTT1 polymorphisms. Anal. Biochem., 236, 184–186.[Web of Science][Medline]

Arici, A., Tazuke, S., Attar, E. et al. (1996) Interleukin-8 concentration in peritoneal fluid of patients with endometriosis and modulation of interleukin-8 expression in human mesothelial cells. Mol. Hum. Reprod., 2, 40–45.[Abstract/Free Full Text]

Baranov, V., Gourbunova, V., Ivaschenko, T. et al. (1991) Five years experience of prenatal diagnosis of cystic fibrosis in the former USSR. Prenat. Diagn., 12, 575–586.

Baranov, V., Ivaschenko, T., Bakay, M. et al. (1996) Proportion of GSTM1 0/0 genotype in some slavic populations and its correlations with cystic fibrosis and other multifactorial diseases Hum. Genet., 97, 516–520.[Web of Science][Medline]

Baranova, H., Perriot, J., Albuisson, E. et al. (1997a) Peculiarities of GSTM1 0/0 genotype in French heavy smokers with different types of chronic bronchitis. Hum. Genet., 99, 822–826.[Web of Science][Medline]

Baranova, H., Bothorishvilli, R., Canis, M. et al. (1997b) GSTM1 gene polymorphism and susceptibility to endometriosis in French population. Mol. Hum. Reprod., 3, 775–780.[Abstract/Free Full Text]

Brockmuller, J., Kreb, R., Drakoulis, N. et al. (1994) Glutathione S-transferase M1 and its variants A and B as host factors of bladder cancer susceptibility: a case-control study. Cancer Res., 54, 4103–4111.[Abstract/Free Full Text]

Brockmuller, J., Cascorbi, I., Kerb, R. and Roots, I. (1996) Combined analysis of inherited polymorphisms in arylamine N-acetyltransferase 2, glutathione S-transferases M1 and T1, microsomal epoxide hydrolase and cytochrome P450 enzymes as modulators of bladder cancer risk. Cancer Res., 56, 3915–3925.[Abstract/Free Full Text]

Bousquet, J., Godard, P. and Michel, F.B. (1993) Allergologie. Editions Ellipses, Paris, France.

Canis, M. Wattiez, A., Pouly, J.L. et al. (1992) In Brosens, I. and Donnez, J. (eds), The Current Status of Endometriosis. Research and Mangement. The Parthenon Publishing Group. pp. 407–417.

Canis, M., Loh, F.H., Wattiez, A. et al. (1995) Endometriosis: Current Understanding and Management. Blackwell Science, Oxford, UK, pp. 168–181.

Cascorbi, I., Drakoulis, J., Brockmuller, J. et al (1995) Arylamine N-acetyltransferase (NAT2) mutations and their allelic linkage in unrelated Caucasian individuals: correlation with phenotypic activity. Am. J. Hum. Genet., 57, 581–592.[Web of Science][Medline]

Chasseaud L.F. (1979) The role of glutathione S-transferase in the metabolism of chemical carcinogenes and other electrophilic agents. Adv. Cancer Res., 29, 175–274.[Medline]

Chen, C.L., Liu, Q. and Relling, M.V. (1996) Simultaneous characterization of glutathione S-transferase M1 and T1 polymorphisms by polymerase chain reaction in American whites and blacks. Pharmacogenetics, 6, 187–191.[Web of Science][Medline]

Daly, A.K., Cholerton, S., Armstrong, M. et al. (1994) Genotyping for polymorphisms in xenobiotic metabolism as a predictor of disease susceptibility. Environ. Health Perspect., 102 (Suppl. 9P), 55–61.

Dixon, W.J. (ed.) (1992) BMDP Statistical Software Manual 1–1500. University of California Press, Berkeley, CA, USA.

Hein, D.W., Doll, M.A., Rustan, T.D. et al. (1993) Metabolic activation and deactivation of arylamine carcinogens by recombinant human NAT1 and polymorphic NAT2 acetyltransferases. Carcinogenesis, 14, 675–678.[Abstract/Free Full Text]

International Dictionary of Medicine and Biology (1986) Vol. 1. A Weley Medical Publication, John Wiley & Sons, Chichester, UK.

Johnson, K.L., Cummings, A.M. and Birnbaum, L.S. (1997) Promotion of endometriosis in mice by polychlorinated dibenzo-p-dioxins, dibenzofurans, and biphenyls. Environ. Health Perspect., 105, 750–755.[Web of Science][Medline]

Kennedy, S., Hadfield, R., Mardon, H. and Barlow, D. (1996) Age of onset of pain symptoms in non-twin sisters concordant for endometriosis. Hum. Reprod., 11, 403–405.

Kligman, I., Grifo, J.A. and Witkin, S.S. (1996) Expression of the 60 kDa heat shock protein in peritoneal fluids from women with endometriosis: implications for endometriosis-associated infertility. Hum. Reprod., 11, 2736–2738.[Abstract/Free Full Text]

Koninckx, P.R. (1994) Is mild endometriosis a condition occuring intermittently in all women? Hum. Reprod., 9, 2202–5.[Free Full Text]

Lear, J.T., Heagerty, A.H., Smith, A. et al. (1996) Multiple cutaneous basal cell carcinomas: glutathione S-transferase (GSTM1, GSTT1) and cytochrome P450 (CYP2D6, CYP1A1) polymorphisms influence tumour numbers and accrual. Carcinogenesis, 17, 1891–1896.[Abstract/Free Full Text]

Malorni, W., Straface, E., Di Genova, G. et al. (1997) Oxidized low-density lipoproteins affect natural killer cell activity by impairing cytoskeleton function and altering the cytokine network. Exp. Cell Res., 236, 436–445.[Web of Science][Medline]

Mannevrik, B., Awashi, Y.S., Board, P.G. et al. (1992) Nomenclature for human glutathione S-transferases. Biochem. J., 282, 305B.

Mantel, N. and Haenszel, W. (1959) Statistical aspects of the analysis of data from retrospective studies of disease. J. Natl. Cancer Inst., 22, 719–748.

Meyer, U.A. and Zanger, U.M. (1997) Molecular mechanisms of genetic polymorphisms of drug metabolism. Ann. Rev. Pharmacol. Toxicol., 37, 269–296.[Web of Science][Medline]

Nebert, D.W. (1997) Polymorphisms in drug-metabolizing enzymes: what is their clinical relevance and why do they exist? Am. J. Hum. Genet., 60, 265–271.[Web of Science][Medline]

Nisolle, M., Casanas-Roux, F. and Donnez, J. (1997) Peritoneal endometriosis, ovarian endometriosis and adenomyotic nodules of the rectovaginal septum: a different histopathogenesis? Gynaecol. Endoscopy, 6, 203–209.

Osteen, K.G. and Sierra-Riviera, E. (1997) Does disruption of immune and endocrine systems by environmental toxins contribute to development of endometriosis? Semin. Reprod. Endocrinol., 15, 301–308.[Medline]

Oyama, T., Mitsudomi, T., Kawamoto, T. et al (1995) Detection of CYP1A1 gene polymorphism using designed RFLP and distributions of CYP1A1 genotypes in Japanese. Int. Arch. Occup. Environ. Health, 67, 253–256.[Web of Science][Medline]

Perriot, J. (1995) Tabacologie. Masson, Paris, France.

Provinciali, M., Di Stefano, G. and Muzzioli, M. (1995) Relationship between 17-beta-estradiol and prolactin in the regulation of natural killer cell activity during progression of endometriosis. J. Endocrinol. Invest., 18, 645–642.[Web of Science][Medline]

Rier, S.E. and Yeaman, G.R. (1997) Immune aspects of endometriosis: relevance of the uterine mucosal immune system. Semin. Reprod. Endocrinol., 15, 209–220.[Medline]

Sarhanis, P., Redman, C., Perrett, C. et al. (1996) Epithelial ovarian cancer: influence of polymorphism at the glutathione S-transferase GSTM1 and GSTT1 loci on p53 expression. Br. J. Cancer, 74, 1757–1761.[Web of Science][Medline]

Seidegard, J., Vorachek, W.R., Pero, R.W. and Pearson, W.R. (1988) Hereditary difference in the expression of the human glutathione S-transferase active on trans-stilben oxide are due to a gene deletion. Proc. Natl. Acad. Sci USA, 85, 7293–7297.[Abstract/Free Full Text]

Seidegard, J., Pero, R.W., Markowits, M.M. et al. (1990) Isoenzyme of glutathione S-transferase (class Mu) as a marker for the susceptibility to lung cancer: a follow up study. Cancerogenesis, 11, 33–36.

Shifren, J.L., Tseng, J.F., Zaloudek, C.J. et al. (1996) Ovarian steroid regulation of vascular endothelial growth factor in the human endometrium: implications for angiogenesis during the menstrual cycle and the pathogenesis of endometriosis. J. Clin. Endocrinol. Metab., 81, 3112–3118.[Abstract/Free Full Text]

Speilberg, S.P. (1996) N-acetyltransferases: pharmacogenetics and clinical consequences of polymorphic drug metabolism. J. Pharmacokinet. Biopharm., 24, 509–519.[Web of Science][Medline]

Spurr, N.K., Gough, A.C., Chinegwundoh, I. and Smith, C.A.D. (1995) Polymorphisms in drug-metabolizing enzymes as modifiers of cancer risk. Clin. Chem, 41, 1864–1869.[Abstract/Free Full Text]

Thornton, J.G., Morley, S., Lilleyman, J. et al. (1997) The relationship between laparoscopic disease, pelvic pain and infertility; an unbiased assessment. Eur. J. Obstet. Gynecol. Reprod. Biol., 74, 57–62.[Web of Science][Medline]

Warwick, A., Sarhanis, P., Redman, C. et al (1994) Theta-class glutathione S-transferase gstt1 genotypes and susceptibility to cervical neoplasia: interactions with GSTM1, CYP2D6 and smoking. Carcinogenesis, 14, 149–66.

Submitted on October 20, 1998; accepted on March 15, 1999.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Hum Reprod UpdateHome page
C.B. Tempfer, M. Simoni, B. Destenaves, and B.C.J.M. Fauser
Functional genetic polymorphisms and female reproductive disorders: Part II--endometriosis
Hum. Reprod. Update, January 1, 2009; 15(1): 97 - 118.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
J. Matsumoto, H. Iwano, H. Inoue, N. Iwano, N. Yamashiki, and H. Yokota
Metabolic Barrier against Bisphenol A in Rat Uterine Endometrium
Toxicol. Sci., September 1, 2007; 99(1): 118 - 125.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
S. H. Kim, Y. M. Choi, G. H. Lee, M. A. Hong, K. S. Lee, B. S. Lee, J. G. Kim, and S. Y. Moon
Association between susceptibility to advanced stage endometriosis and the genetic polymorphisms of aryl hydrocarbon receptor repressor and glutathione-S-transferase T1 genes
Hum. Reprod., July 1, 2007; 22(7): 1866 - 1870.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
S P Renner, R Strick, P Oppelt, P A Fasching, S Engel, R Baumann, M W Beckmann, and P L Strissel
Evaluation of clinical parameters and estrogen receptor alpha gene polymorphisms for patients with endometriosis
Reproduction, January 1, 2006; 131(1): 153 - 161.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
P. Vigano, E. Somigliana, I. Chiodo, A. Abbiati, and P. Vercellini
Molecular mechanisms and biological plausibility underlying the malignant transformation of endometriosis: a critical analysis
Hum. Reprod. Update, January 1, 2006; 12(1): 77 - 89.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
S.-W. Guo
Glutathione S-transferases M1/T1 gene polymorphisms and endometriosis: a meta-analysis of genetic association studies
Mol. Hum. Reprod., October 1, 2005; 11(10): 729 - 743.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
D. Ertunc, M. Aban, E.C. Tok, L. Tamer, M. Arslan, and S. Dilek
Glutathione-S-transferase P1 gene polymorphism and susceptibility to endometriosis
Hum. Reprod., August 1, 2005; 20(8): 2157 - 2161.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
M. Deguchi, S. Yoshida, S. Kennedy, N. Ohara, S. Motoyama, and T. Maruo
Lack of Association Between Endometriosis and N-acetyl transferase 1 (NAT1) and 2 (NAT2) Polymorphisms in a Japanese Population
Reproductive Sciences, April 1, 2005; 12(3): 208 - 213.
[Abstract] [PDF]


Home page
Mol Hum ReprodHome page
S. E. Hur, J. Y. Lee, H.-S. Moon, and H. W. Chung
Polymorphisms of the genes encoding the GSTM1, GSTT1 and GSTP1 in Korean women: no association with endometriosis
Mol. Hum. Reprod., January 1, 2005; 11(1): 15 - 19.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
V. Suryanarayana, M. Deenadayal, and L. Singh
Association of CYP1A1 gene polymorphism with recurrent pregnancy loss in the South Indian population
Hum. Reprod., November 1, 2004; 19(11): 2648 - 2652.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
Y.-Y. Hsieh, C.-C. Chang, F.-J. Tsai, C.-C. Lin, J.-M. Chen, and C.-H. Tsai
Glutathione S-transferase M1*null genotype but not myeloperoxidase promoter G-463A polymorphism is associated with higher susceptibility to endometriosis
Mol. Hum. Reprod., October 1, 2004; 10(10): 713 - 717.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
Y. Saijo, F. Sata, H. Yamada, K. Suzuki, S. Sasaki, T. Kondo, Y.Y. Gong, E.H. Kato, S. Shimada, M. Morikawa, et al.
Ah receptor, CYP1A1, CYP1A2 and CYP1B1 gene polymorphisms are not involved in the risk of recurrent pregnancy loss
Mol. Hum. Reprod., October 1, 2004; 10(10): 729 - 733.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
D. Lattuada, P. Vigano, E. Somigliana, M. P. Odorizzi, M. Vignali, and A. M. Di Blasio
Androgen Receptor Gene Cytosine, Adenine, and Guanine Trinucleotide Repeats in Patients With Endometriosis
Reproductive Sciences, May 1, 2004; 11(4): 237 - 240.
[Abstract] [PDF]


Home page
ReproductionHome page
R. Varma, T. Rollason, J. K Gupta, and E. R Maher
Endometriosis and the neoplastic process
Reproduction, March 1, 2004; 127(3): 293 - 304.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
M. Morizane, S. Yoshida, S. Nakago, S. Hamana, T. Maruo, and S. Kennedy
No Association of Endometriosis With Glutathione S-Transferase M1 and T1 Null Mutations in a Japanese Population
Reproductive Sciences, February 1, 2004; 11(2): 118 - 121.
[Abstract] [PDF]


Home page
Hum ReprodHome page
J. Lin, X. Zhang, and Y. Chen
Mutagen sensitivity as a susceptibility marker for endometriosis
Hum. Reprod., October 1, 2003; 18(10): 2052 - 2057.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
F. Wieser, L. Hefler, C. Tempfer, U. Vlach, C. Schneeberger, J. Huber, and R. Wenzl
Polymorphism of the Interleukin-1{beta} Gene and Endometriosis
Reproductive Sciences, April 1, 2003; 10(3): 172 - 175.
[Abstract] [PDF]


Home page
Mol Hum ReprodHome page
F. Sata, H. Yamada, T. Kondo, Y. Gong, S. Tozaki, G. Kobashi, E.H. Kato, S. Fujimoto, and R. Kishi
Glutathione S-transferase M1 and T1 polymorphisms and the risk of recurrent pregnancy loss
Mol. Hum. Reprod., March 1, 2003; 9(3): 165 - 169.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
P. Vigano, M. Infantino, D. Lattuada, R. Lauletta, E. Ponti, E. Somigliana, M. Vignali, and A.M. DiBlasio
Intercellular adhesion molecule-1 (ICAM-1) gene polymorphisms in endometriosis
Mol. Hum. Reprod., January 1, 2003; 9(1): 47 - 52.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
F. Wieser, G. Fabjani, C. Tempfer, C. Schneeberger, M. Sator, J. Huber, and R. Wenzl
Analysis of an Interleukin-6 Gene Promoter Polymorphism in Women With Endometriosis Polymorphism in Women With Endometriosis By Pyrosequencing
Reproductive Sciences, January 1, 2003; 10(1): 32 - 36.
[Abstract] [PDF]


Home page
Reproductive SciencesHome page
F. Wieser, G. Fabjani, C. Tempfer, C. Schneeberger, R. Zeillinger, J. C. Huber, and R. Wenzl
Tumor Necrosis Factor-{alpha} Promotor Polymorphisms and Endometriosis
Reproductive Sciences, September 1, 2002; 9(5): 313 - 318.
[Abstract] [PDF]


Home page
Hum ReprodHome page
K. T. Zondervan, L. R. Cardon, and S. H. Kennedy
What makes a good case-control study?: Design issues for complex traits such as endometriosis
Hum. Reprod., June 1, 2002; 17(6): 1415 - 1423.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
N. Kado, J. Kitawaki, H. Obayashi, H. Ishihara, H. Koshiba, I. Kusuki, K. Tsukamoto, G. Hasegawa, N. Nakamura, T. Yoshikawa, et al.
Association of the CYP17 gene and CYP19 gene polymorphisms with risk of endometriosis in Japanese women
Hum. Reprod., April 1, 2002; 17(4): 897 - 902.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
R.M. Hadfield, S. Manek, D.E. Weeks, H.J. Mardon, D.H. Barlow, and S.H. Kennedy
Linkage and association studies of the relationship between endometriosis and genes encoding the detoxification enzymes GSTM1, GSTT1 and CYP1A1
Mol. Hum. Reprod., November 1, 2001; 7(11): 1073 - 1078.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
S. Nakago, R. M. Hadfield, K. T. Zondervan, H. Mardon, S. Manek, D. E. Weeks, D. Barlow, and S. Kennedy
Association between endometriosis and N-acetyl transferase 2 polymorphisms in a UK population
Mol. Hum. Reprod., November 1, 2001; 7(11): 1079 - 1083.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
S.W. Baxter, E.J. Thomas, and I.G. Campbell
GSTM1 null polymorphism and susceptibility to endometriosis and ovarian cancer
Carcinogenesis, January 1, 2001; 22(1): 63 - 66.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
A. B. Spurdle, P. M. Webb, D. M. Purdie, X. Chen, A. Green, and G. Chenevix-Trench
Polymorphisms at the glutathione S-transferase GSTM1, GSTT1 and GSTP1 loci: risk of ovarian cancer by histological subtype
Carcinogenesis, January 1, 2001; 22(1): 67 - 72.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (70)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Baranova, H.
Right arrow Articles by Bruhat, M.A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baranova, H.
Right arrow Articles by Bruhat, M.A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?