Molecular Human Reproduction, Vol. 5, No. 9, 866-873,
September 1999
© 1999 European Society of Human Reproduction and Embryology
Molecular events in the endometrium |
Regulation of HOXA-10 and its expression in normal and abnormal endometrium
Department of Obstetrics and Gynecology, Division of Reproductive Endocrinology and Infertility, University of North Carolina, Chapel Hill, NC, USA
Abstract
HOXA-10 is a member of a family of genes that serve as transcription factors during development and have been shown to be important for uterine function. Using immunohistochemistry and RNAse protection assays (RPA), HOXA-10 was shown to be expressed in both epithelial and stromal cells with increased expression during the window of implantation. By in-vitro culture of isolated endometrial epithelium or stroma, HOXA-10, expression was increased after treatment with oestradiol (108 mol/l) with or without progesterone (106 mol/l). In stromal cells, oestradiol and progesterone both appeared to increase HOXA-10 expression and were additive. Relaxin (30 ng/ml) appeared to further increase stromal HOXA-10 expression. HOXA-10 expression during the window of implantation was compared in normal menstrual cycles to endometrium from women with endometriosis and suspected defects in uterine receptivity. Little or no difference was seen in luminal, glandular or endothelial HOXA-10 expression but a significant reduction in stroma HOXA-10 expression was noted in women with endometriosis. In conclusion, HOXA-10 is a hormone-regulated endometrial transcription factor that appears to be responsive to both ovarian steroids and relaxin. The appearance of this nuclear protein during the window of implantation in epithelium and stroma may offer new insight into the regulation of uterine receptivity and assist in the identification of other genes that are critical to the establishment of a successful pregnancy.
endometriosis/HOXA-10/implantation/integrins/relaxin
Introduction
HOXA-10 is a member of the `posterior' abdominal B-related (AbdB) subclass of homeobox genes, first described in Drosophila melanogaster (Lewis, 1978
). These genes are characterized by a conserved region of 183 bp known as the homeobox (Gehring, 1987
). The products of these genes function as transcription factors that regulate a myriad of other developmental genes. The HOXA family of genes is responsible for segmental development and the genes are expressed in restricted domains from the rostral to the caudal portions of the embryo (Favier and Dollé, 1997
). The mammalian AbdB HOXA family of genes consists of 16 separate genes, of which HOXA-10 is a member. This gene has attracted attention recently for its role in the development of the uterus. Targeted mutation of this gene in mice has shown a failure of implantation associated with the loss of this gene (Satokata et al., 1995
). Characterization of these mice have shown morphological changes in the proximal oviduct and a defect in the uterine decidual response (Benson et al., 1996
). Furthermore, developmental defects, such as those associated with in-utero exposure to diethylstilboestrol may be tied to the inappropriate expression of this homeobox gene (Ma et al., 1998
). More recently, HOXA-10 was shown to be expressed in the human endometrium and to be regulated by ovarian steroids (Taylor et al., 1998
). Peak expression occurred during the window of implantation in the human endometrium and suggests a potential role for this gene product in implantation and as a potential marker of uterine receptivity.
We have been interested in the role of endometrial proteins in the regulation of uterine receptivity (Lessey et al., 1992
; Ilesanmi et al., 1993
). During a 28 day cycle, implantation is thought to occur at or around cycle day 20, based on studies from the 1950s (Hertig et al., 1956
) and more recent data from assisted reproductive technology studies (Bergh and Navot, 1992
). An increasing number of proteins have been shown to be expressed during the window of implantation and/or to be critical to the implantation process, including leukaemia inhibitory factor (LIF) (Stewart et al., 1992
; Cullinan et al., 1996
), integrins (Lessey et al., 1992
, 1994a
; Tabibzadeh, 1992
), Cox-2 (Chakraborty et al., 1996
; Lim et al., 1997
), calcitonin (Kumar et al., 1998
; Zhu et al., 1998
), trophinin (Fukuda et al., 1995
), and others (Ilesanmi et al., 1993
). As a developmental and regulatory transcription factor, it was of interest to further examine the expression of HOXA-10 in human endometrium and compare it with another developmentally-regulated product, the
vß3 integrin which is an increasingly accepted marker of uterine receptivity in the human (Lessey, 1997
). The loss of uterine receptivity has been classified into at least two distinct subtypes. In type I defects, the absence of appropriate markers relates to histological delay due to hormone insufficiency or luteal phase defect (LPD; Lessey et al., 1992
, 1996b
), while type II defects have been described in certain infertile patients, including those with endometriosis (Lessey et al., 1994b
), hydrosalpinges (Meyer et al., 1997
), and unexplained infertility (Lessey et al., 1995
). In the latter, the histological progression of the endometrium is normal and `in phase' with an inappropriate delay or loss of this marker of receptivity.
Both HOXA-10 and
vß3 have been reported to appear at the time of implantation in the human endometrium (Lessey et al., 1992
; Taylor et al., 1998
) and both have been reported to be decreased in women with endometriosis and infertility (Lessey et al., 1994b
; Taylor et al., 1997). During the transition from the early to mid-secretory phases of the menstrual cycle there is a cell-specific decrease in oestrogen and progesterone receptors (ER and PR respectively) on the endometrial epithelium (Garcia et al., 1988
; Lessey et al., 1988
; Press et al., 1988
). This putative loss of epithelial responsiveness to ovarian steroids is associated with the expression of other implantation specific markers such as
vß3, and a delay in the loss of ER and PR due to hormonal inadequacy may postpone the appearance of such markers (Lessey et al., 1996b
). While the expression of some endometrial proteins follow the expression of ER and PR (Hild-Petito et al., 1996
), other peptides thought to be regulated by oestrogen and/or progesterone, paradoxically appear on the endometrial epithelium beyond cycle day 20 when epithelial ER and PR have all but disappeared. Such observations suggest a paracrine role for the stroma in regulation of key implantation events (Cooke et al., 1997
). Based on the hypothesis that both ovarian steroids and proteins regulate implantation through endocrine and paracrine mechanisms, we examined the regulation of HOXA-10 in the human endometrium and examined its expression during the window of implantation in normal and abnormal menstrual cycles.
Materials and methods
Endometrial samples
Human endometrium was obtained by pipelle suction curettage from healthy volunteers and from women with infertility, timed in their cycle using urinary luteinizing hormone (LH) surge prediction kits (Ovuquik; Quidel, San Diego, USA). Additional endometrial samples were obtained from women undergoing hysterectomy or at the time of bilateral tubal ligation. A total of 73 endometrial samples were evaluated from various times in the menstrual cycle including 65 samples timed to the window of implantation from normal cycles (n = 17; in phase histology with normal integrin expression), type I defects (histological delay consistent with LPD; n = 7) and type II defects (in phase histology with absent
vß3 integrin expression; n = 41). All 41 patients with type II defects had been diagnosed with endometriosis. Thirty-five samples from women without known endometriosis were obtained throughout the menstrual cycle including five from the proliferative phase, 27 from the secretory phase and three from early pregnancy. All tissue was obtained in accordance with the Committee for the Protection of Human Subjects at the University of North Carolina. Samples of endometrium were either snap-frozen in liquid nitrogen and stored for RNA isolation or immunohistochemistry or placed in 10% buffered formalin prior to embedding in paraffin. Paraffin sections were sectioned and stained with haematoxylin and eosin and dated according to established criteria (Noyes et al., 1950
).
Immunohistochemistry
Serial sections (8 µm) of frozen endometrium were placed on glass slides. Cryosections were lightly fixed in 3.7% formaldehyde in phosphate-buffered saline. Immunohistochemistry was performed using Vectastain Elite® ABC kits (Vector Laboratories, Burlingame, CA, USA) as previously described (Lessey et al., 1992
, 1994a
). Polyclonal antibodies to HOXA-10 (BabCo, Richmond, CA, USA) and monoclonal antibodies to the ß3 integrin subunit (SSA6) were used at concentrations determined by limiting dilution.
The resulting staining was evaluated on a Nikon microscope, by a single blinded observer (BAL). The HSCORE was calculated using the following equation:
|
|
Isolation and culture of human endometrial stromal and epithelial cells
Reagents were obtained from the Sigma Chemical Company (St Louis, MO, USA) except where otherwise specified. Human endometrium obtained from normally cycling women undergoing hysterectomy for benign disease was finely minced and digested with collagenase (Type 1A, 0.1 mg/ml; Sigma) for 2 h at 37°C in Dulbecco's modified Eagle's medium (DMEM)/F12 (Gibco Laboratories, Grand Island, NY, USA) supplemented with 5% heat-inactivated fetal calf serum (FCS) (Flow Laboratories, Mclean, VA, USA) and penicillin/streptomycin. The digested material was added to a stacked sterile wire sieve assembly with #100 wire cloth sieve (140 µm size; USA Standard Sieve Series, Newark Wire Cloth Company, Newark, NJ, USA) followed by passing through a #400 wire sieve (37 µm). The epithelial cells and glands were retained in the #100 and #400 sieves while the stromal cells passed through to the receptacle below. The stromal cells remaining with the glands and epithelial cells were further separated by selective adherence to plastic tissue culture dishes for 1 h.
Stromal cells were collected from the lower receptacle and centrifuged at 400 g for 8 min, and the pellet was resuspended in 1 ml of fresh medium. The volume was carefully placed on 3 ml of FicollPaque (Pharmacia LKB Biotechnology, Piscataway, NJ, USA) and centrifuged at 400 g for 10 min. The interface contained an enriched fraction of endometrial stromal cells depleted of erythrocytes. Stromal and epithelial cells were resuspended in DMEM/F12, plated in 100 mm dishes (Nunc, Roskilde, Denmark) and grown to confluence at 37°C in 5% CO2 and 95% air. The culture media were changed every 3 days.
Hormone treatments
Isolated endometrial stromal or epithelial cells were cultured in the presence or absence of exogenous hormones. Control media consisted of DMEM/F12 Phenol Red-free media with 5% heat inactivated charcoal-stripped FCS (Flow Laboratories). Other cells received oestradiol-17ß (108 mol/l), progesterone (106 mol/l), or relaxin (30 ng/ml), alone or in combination for 114 days. In the time-course studies, all samples including the controls were cultured for the same number of days, though the time of exposure to hormones varied. In some experiments cells were incubated in the presence of ovarian steroids and antagonists of oestradiol and progesterone including ICI 182780 (107 mol/l) or RU 486 (105 mol/l).
PCR cloning of cDNA fragment of human HOXA-10 and integrin subunit ß3
Total RNA was isolated from Ishikawa cells, a well-differentiated human endometrial cell line with functional oestrogen and progesterone receptors (Lessey et al., 1996a
), using TRI REAGENT (Molecular Research Center, Cincinnati, OH, USA). First-strand complementary DNA was synthesized from total RNA with cDNA Cycle Kit (Invitrogen, San Diego, CA, USA). Reverse transcriptionpolymerase chain reaction (RTPCR) was performed in a Perkin-Elmer Cetus PCR Thermocycler under the following conditions: 95°C for 1 min, 60°C for 2 min and 72°C for 3 min for 30 cycles. The primers were, for integrin ß3 subunit: GGAAAGATTGGCTGGAGGAA (sense) and GGCATACCCCACACTCAAAG (antisense); for HOXA-10: AGCCCCTTTCTCCCTCCCACAC (sense) and AAACACAGCCCAGCACTCCAGG (antisense). The expected sizes obtained for both the ß3 integrin subunit and HOXA-10 were 683 and 395 bp respectively.
The PCR products of integrin ß3 and HOXA-10 were extracted from 1% agarose gel with QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloned into pCR 2.1 vector with Original TA Cloning Kit (Invitrogen). Positive bacterial colonies was selected with X-gal plates. Restriction analysis and sequencing confirm its inserting orientation. The sense plasmid containing cDNA fragment of ß3 and HOXA-10 was linearized with BamHI as the DNA template for RNA riboprobe synthesis.
Ribonuclease protection assay (RPA)
The in-vitro transcription and labelling reaction was carried out using 80 µCi [
-32P]-UTP (Amersham Life Science Inc, Arlington Heights, IL, USA) and the Maxiscript T7 polymerase Kit (Ambion, Austin, TX, USA). To isolate the probe, it was run on a 5% polyacrylamide 8 mol/l urea gel. The band containing the full-length probe was excised and eluted from the gel in 350 µl of elution buffer (Ambion) by incubation overnight at 37°C. A riboprobe for ß-actin (Ambion) was used as the internal standard against which to compare integrin ß3 and HOXA-10 mRNA concentrations. The century RNA marker plus from Ambion was used as the molecular weight marker.
Total RNA from endometrial tissues, stromal and epithelial cells was isolated with RNAgent Total RNA Isolation System (Promega, Madison, WI, USA). A Ribonuclease Protection Assay Kit (Ambion) was used to quantify the fluctuation of integrin ß3 and HOXA-10 mRNA in endometrial stromal cells treated with steroids or tissues during the menstrual cycle. Equal amounts of total RNA (30100 µg) from endometrial tissues and cells were hybridized in hybridization buffer containing ~2x105 c.p.m. of [
-32P]-labelled integrin ß3 or HOXA-10 and 5x104 c.p.m. of [
-32P]-labelled ß-actin probe by incubation overnight at 45°C. After hybridization, single-stranded RNA was digested with RNase A/T at 37°C for 30 min. The remaining RNA duplexes were separated on 5% polyacrylamide 8 mol/l urea gel. The hybridization signal was detected by autoradiography.
Western blot assay
For Western blotting, stromal cells were homogenized in RIPA buffer [10 mm TrisHCl, pH 8.0, 10 mmol/l EDTA, pH 8.0, 0.15 mol/l NaCl, 1% NP40, 0.5% sodium dodecyl sulphate (SDS), 1 µg/ml Aprotinin, 1 mmol/l phenyl methyl sulphonyl fluoride (PMSF)]. The homogenate was clarified by centrifugation at 15 000 g for 15 min and the concentration of protein in homogenates was determined by the Bio-Rad protein assay (Bio-Rad Laboratories, Hercules, CA, USA). Aliquots (30 µg) of homogenate protein were separated by discontinuous 8% SDSpolyacrylamide gel electrophoresis (SDSPAGE). The separated proteins were electroblotted onto a Hybond ECL nitrocellulose membrane (Amersham) at 200 mA for 2 h.
After blocking the non-specific binding sites with non-fat dry milk in TBST buffer (5 mmol/l TrisHCl, pH 7.4, 136 mmol/l NaCl, 0.1% Tween 20) for 1 h at room temperature, the blots were incubated overnight at 4°C with a 1:1000 dilution of polyclonal antibody against HOXA-10 (BabCo). The blots were then washed three times with TBST buffer, incubated for 2 h at room temperature with horseradish peroxidase-linked sheep anti-rabbit immunoglobulin G (IgG) (Santa Cruz Biotechnology Inc, Santa Cruz, CA, USA) at a dilution of 1:5000 and, after further washing, the immunoreactive proteins were revealed using the ECL reagents (Amersham) and quantified by densitometry.
Statistical analysis
Western blots were scanned and densitometry readings used to compare the relative intensity of each treatment group, in duplicate. Results of immunohistochemical HSCORE and Western blotting were compared using analysis of variance with Scheffé's correction when making multiple comparisons with significance based on the 95th percentile confidence intervals.
Results
HOXA-10 expression during the menstrual cycle
HOXA-10 protein was examined in 35 endometrial samples throughout the menstrual cycle using immunohistochemistry. As shown in Figure 1A
, epithelial HOXA-10 expression was low during the proliferative phase, similar to a negative control immunostained with preimmune serum (Figure 1B
). Expression of HOXA-10 increased in the secretory phase on both luminal (arrowhead) and epithelial cells (arrow) (Figure 1C
). Comparison of HSCOREs showed a significant increase in the secretory phase (P < 0.05). There was strong positive immunostaining seen on the endothelium (asterisk) in both the proliferative and secretory phase (Figure 1A and D
) that did not appear to change during the menstrual cycle. Stromal cells appeared to express this transcription factor throughout the menstrual cycle but increased expression was noted in the pseudodecidual cells of the secretory phase and in the decidua of early pregnancy (not shown). Using the RNase protection assay (RPA), expression of mRNA for HOXA-10 was examined throughout the cycle comparing it with the expression of another cycle-dependent endometrial protein, the ß3 integrin subunit. HOXA-10 appears to increase in the early secretory phase with peak expression during the mid-secretory phase, concomitant with maximal expression of ß3 expression (Figure 2
).
|
|
Comparison of HOXA-10 expression during the window of implantation in normal and abnormal endometrium
Expression of HOXA-10 by glandular and luminal epithelium, stroma and endothelial cells was studied during the window of implantation in normal and abnormal endometrium from normal fertile women and women with infertility, using RPA and immunohistochemistry. By RPA, mRNA isolated from similar samples of normal versus type II defects showed a significant decrease in ß3 expression but overall the change in HOXA-10 expression was less evident (Figure 3
vß3 integrin, as previously described (Lessey et al., 1992
3 days relative to the known time of biopsy, consistent with LPD (type I defects) and samples without histological delay lacking
vß3 expression in women with endometriosis (type II defects). There was no apparent difference in the expression of glandular or luminal epithelium (arrows, Figure 4A,B
|
|
In-vitro regulation of epithelial and stromal HOXA-10 expression
To investigate the factors that could account for the observed cycle-dependent HOXA-10 expression in vivo, primary epithelial cells were isolated from proliferative endometrium and cultured on plastic surfaces. Cells were treated with either no hormones (no Tx) or oestradiol, progesterone or a combination of oestradiol and progesterone. HOXA-10 mRNA expression was determined in each group using RPA (Figure 5
|
Stromal cells were treated in a similar manner with or without oestradiol and progesterone and with or without relaxin. Similar to epithelial cells, oestradiol and progesterone both increased HOXA-10 mRNA expression by RPA (Figure 6
|
|
|
Discussion
There is increasing interest in the role of the endometrium and uterine receptivity in the early events of implantation. Understanding the biochemical basis for the establishment of a successful pregnancy requires an appreciation of the role of many endometrial peptides during the menstrual cycle. In the present study we have investigated the temporal and spatial distribution of the HOXA-10 gene in human endometrium. Using both RPA and immunohistochemistry we have shown that this transcription factor is regulated during the menstrual cycle with peak expression prior to, and during, the window of implantation. As a hormonally stimulated transcription factor, HOXA-10 is an excellent candidate protein to study as a pivotal regulator of endometrial function. Evidence points to such a role for this peptide during embryonic development (Satokata et al., 1995
) and as a critical element for implantation (Benson et al., 1996
).
Steroid regulation of HOXA-10 by oestrogen and progesterone has been demonstrated in the mouse uterus (Ma et al., 1998
). It now appears that the HOXA-10 is also expressed in a hormone-dependent manner in human endometrium and that its appearance is correlated with the time of implantation in women (Taylor et al., 1998
). These authors have shown that HOXA-10 is expressed during the mid-secretory phase, in agreement with the present study. In addition, using primary stromal cells they reported an increase in HOXA-10 expression in response to both oestrogen and progesterone. Studies were not performed in primary epithelial cells, however, using instead the well differentiated (Ishikawa) cell line. Results using either primary epithelial cells or Ishikawa cells were generally comparable.
In this study, we confirmed that HOXA-10 is also regulated in human endometrial stromal cells by both oestradiol and progesterone, with the greatest effect by progesterone in a dose dependent process. Interestingly, a greater effect on HOXA-10 expression was seen when relaxin was added to the oestrogen and progesterone treatment. Relaxin, a peptide hormone produced by the corpus luteum (Seppälä and Tiitinen, 1995
) had no apparent effect when administered by itself. These data argue that oestrogen and progesterone priming may sensitize the stromal cells to the effects of relaxin, perhaps through induction of the putative relaxin receptor. Similar results have been reported for prolactin, another marker of decidualization (Huang et al., 1987
). A time-course of these effects suggest that maximal induction of HOXA-10 was seen by 7 days of treatment. The effects of ovarian steroids on HOXA-10 expression in vitro could be antagonized by specific steroid antagonists, including ICI 182780 and RU 486. In each case, the effects of oestradiol and progesterone or their combination were blocked by the addition of the appropriate antagonist, demonstrating the direct effect of steroids on stromal HOXA-10 expression.
Primary endometrial epithelium also demonstrated hormonal regulatation of HOXA-10 expression in vivo and in vitro. Progesterone appeared to have the dominant effect though the combination of oestradiol and progesterone had the greatest effect on HOXA-10 expression. The expression of HOXA-10 changed in normal endometrium throughout the cycle, demonstrating temporal and spatial differences between endometrial epithelium and stroma. Since both ER and PR have been shown to decrease at the time of implantation (Garcia et al., 1988
; Lessey et al., 1988
), the continued expression of epithelial HOXA-10 expression was somewhat surprising. The strong expression in luminal and glandular epithelium at this time argues for other factors, e.g. epidermal growth factor (EGF) or EGF-like molecules (e.g. heparin binding-EGF), that may regulate this gene, similar to that noted for the endometrial
vß3 integrin (Somkuti et al., 1997
).
In the mouse, null mutants for HOXA-10 are infertile, exhibiting a phenotype of implantation failure (Satokata et al., 1995
; Benson et al., 1996
). We questioned whether women with otherwise unexplained infertility and suspected defects in uterine receptivity might also exhibit reduced or absent HOXA-10 expression during the window of receptivity. To test this hypothesis we examined LH-timed endometrial samples from normal women and compared these with endometrial biopsies from women with infertility, endometriosis and lack of endometrial expression of another marker of uterine receptivity,
vß3. This integrin has been extensively described in cycling endometrium (Lessey et al., 1992
, 1994a
; Albers et al., 1995
; Rai et al., 1996
) and was found to be aberrantly expressed in women with endometriosis (Lessey et al., 1994b
), hydrosalpinges (Meyer et al., 1997
), and unexplained infertility (Lessey et al., 1995
). In the present study we found that stromal HOXA-10 was indeed decreased in the endometrium from women with type II defects and endometriosis, but found little difference in the expression in samples from women with absent
vß3 integrin due to histological delay (type I defects). These data support our hypothesis that occult defects in uterine receptivity exist and are associated with various diagnoses including endometriosis, hydrosalpinges and unexplained infertility. These data, coupled with the finding that HOXA-10 null mutant female mice fail to decidualize, suggest that stromal HOXA-10 may be critical to both stromal and epithelial differentiation, through autocrine and paracrine mechanisms. Specific gene products that result from HOXA-10 activity may be responsible for these down-stream events.
HOXA-10 is a transcription factor that appears to be critical for the programmed expression of proteins in the endometrium during development and during the menstrual cycle. It is currently not known which genes are regulated by this nuclear protein, but based on these studies there may be a role for stromal HOXA-10 in the expression of other cycle-specific markers. In mice, both heparin-binding EGF and LIF expression were found to be normal in HOXA-10 null mutants (Benson et al., 1996
). These are two other endometrial proteins that appear to be critical for implantation and expressed proximal to the time of uterine receptivity in both mice (Stewart et al., 1992
; Das et al., 1994
) and humans (Cullinan et al., 1996
; Yoo et al., 1997
). Future studies will be needed to extend our understanding of HOXA-10 or HOXA-11 (another similar gene that appears critical for implantation) and the HOXA-dependent genes that are expressed in the human endometrium at the time of implantation.
Acknowledgments
Supported by grants HD 35041 and HD 34824 (BL).These studies were funded in part by the National Cooperative Program on Markers of Uterine Receptivity for Blastocyst Implantation and the Fogerty International Fellowship.
Notes
1 To whom correspondence should be addressed ![]()
References
Albers, A., Thie, M., Hohn, H.P. and Denker, H.W. (1995) Differential expression and localization of integrins and CD44 in the membrane domains of human uterine epithelial cells during the menstrual cycle. Acta Anat. (Basel), 153, 219.
Benson, G.V., Lim, H.J., Paria, B.C. et al. (1996) Mechanisms of reduced fertility in HOXA-10 mutant mice: Uterine homeosis and loss of maternal HOXA-10 expression. Development, 122, 26872696.[Abstract]
Bergh, P.A. and Navot, D. (1992) The impact of embryonic development and endometrial maturity on the timing of implantation. Fertil. Steril., 58, 537542.[Web of Science][Medline]
Budwit-Novotny, D.A., McCarty Sr, K.S., Cox, E.B. et al. (1986) Immunohistochemical analyses of estrogen receptor in endometrial adenocarcinoma using a monoclonal antibody. Cancer Res., 46, 54195425.
Chakraborty, I., Das, S.K., Wang, J. and Dey, S.K. (1996) Developmental expression of the cyclo-oxygenase-1 and cyclo-oxygenase-2 genes in the peri-implantation mouse uterus and their differential regulation by the blastocyst and ovarian steroids. J. Mol. Endocrinol., 16, 107122.
Cooke, P.S., Buchanan, D.L., Young, P. et al. (1997) Stromal estrogen receptors mediate mitogenic effects of estradiol on uterine epithelium. Proc. Natl. Acad. Sci. USA, 94, 65356540.
Cullinan, E.B., Abbondanzo, S.J., Anderson, P.S. et al. (1996) Leukemia inhibitory factor (LIF) and LIF receptor expression in human endometrium suggests a potential autocrine paracrine function in regulating embryo implantation. Proc. Natl. Acad. Sci. USA, 93, 31153120.
Das, S.K., Wang, X.-N., Paria, B.C. et al. (1994) Heparin-binding EGF-like growth factor gene is induced in the mouse uterus temporally by the blastocyst solely at the site of its apposition: A possible ligand for interaction with blastocyst EGF-receptor in implantation. Development, 120, 10711083.[Abstract]
Favier, B. and Dollé, P. (1997) Developmental functions of mammalian Hox genes. Mol. Hum. Reprod., 3, 115131.
Fukuda, M.N., Sato, T., Nakayama, J. et al. (1995) Trophinin and tastin, a novel cell adhesion molecule complex with potential involvement in embryo implantation. Genes Dev., 9, 11991210.
Garcia, E., Bouchard, P., De Brux, J. et al. (1988) Use of immunoctyochemistry of progesterone and estrogen receptors for endometrial dating. J. Clin. Endocrinol. Metab., 67, 8087.
Gehring, W.J. (1987) Homeoboxes in the study of development. Science, 236, 12451252.
Hertig, A.T., Rock, J. and Adams, E.C. (1956) A description of 34 human ova within the first 17 days of development.. Am. J. Anat., 98, 435493.
Hild-Petito, S., Fazleabas, A.T., Julian, J. and Carson, D.D. (1996) Mucin (Muc-1) expression is differentially regulated in uterine luminal and glandular epithelia of the baboon (Papio anubis) Biol. Reprod., 54, 939947.[Abstract]
Huang, J.R., Tseng, L., Bischof, P. and Janne, O.A. (1987) Regulation of prolactin production by progestin, estrogen, and relaxin in human endometrial stromal cells. Endocrinology, 121, 20112017.
Ilesanmi, A.O., Hawkins, D.A. and Lessey, B.A. (1993) Immunohistochemical Markers of Uterine Receptivity in the Human Endometrium. Microscopy Res. Techn., 25, 208222.
Kumar, S., Zhu, L.-J., Polihronis, M. et al. (1998) Progesterone induces calcitonin gene expression in human endometrium within the putative window of implantation. J. Clin. Endocrinol. Metab., 83, 44434450.
Lessey, B.A. (1997) Integrins and the endometrium: New markers of uterine receptivity. Ann. N.Y. Acad. Sci., 828, 111122.[Web of Science][Medline]
Lessey, B.A., Killam, A.P., Metzger, D.A. et al. (1988) Immunohistochemical analysis of human uterine estrogen and progesterone receptors throughout the menstrual cycle. J. Clin. Endocrinol. Metab., 67, 334340.
Lessey, B.A., Damjanovich, L., Coutifaris, C. et al. (1992) Integrin adhesion molecules in the human endometrium. Correlation with the normal and abnormal menstrual cycle. J. Clin. Invest., 90, 188195.
Lessey, B.A., Castelbaum, A.J., Buck, C.A. et al. (1994a) Further characterization of endometrial integrins during the menstrual cycle and in pregnancy. Fertil. Steril., 62, 497506.[Web of Science][Medline]
Lessey, B.A., Castelbaum, A.J., Sawin, S.J. et al. (1994b) Aberrant integrin expression in the endometrium of women with endometriosis. J. Clin. Endocrinol. Metab., 79, 643649.[Abstract]
Lessey, B.A., Castelbaum, A.J., Sawin, S.J. and Sun, J. (1995) Integrins as Markers of Uterine Receptivity in Women with Primary Unexplained Infertility. Fertil. Steril., 63, 535542.[Web of Science][Medline]
Lessey, B.A., Ilesanmi, A.O., Castelbaum, A.J. et al. (1996a) Characterization of the functional progesterone receptor in an endometrial adenocarcinoma cell line (Ishikawa): Progesterone-induced expression of the
1 integrin. J. Steroid Biochem. Mol. Biol., 59, 3139.[Web of Science][Medline]
Lessey, B.A., Yeh, I.T., Castelbaum, A.J. et al. (1996b) Endometrial progesterone receptors and markers of uterine receptivity in the window of implantation. Fertil. Steril., 65, 477483.[Web of Science][Medline]
Lewis, E.B. (1978) A gene complex controlling segmentation in Drosophila. Nature, 276, 565570.[Medline]
Lim, H., Paria, B.C., Das, S.K. et al. (1997) Multiple female reproductive failures in cyclooxygenase 2-deficient mice. Cell, 91, 197208.[Web of Science][Medline]
Ma, L., Benson, G.V., Lim, H.J. et al. (1998) Abdominal B (AbdB) Hoxa genes: Regulation in adult uterus by estrogen and progesterone and repression in Müllerian duct by the synthetic estrogen diethylstilbestrol (DES) Dev. Biol., 197, 141154.[Web of Science][Medline]
Meyer, W.R., Castelbaum, A.J., Somkuti, S. et al. (1997) Hydrosalpinges adversely affect markers of endometrial receptivity. Hum. Reprod., 12, 13931398.
Noyes, R.W., Hertig, A.I. and Rock, J. (1950) Dating the endometrial biopsy. Fertil. Steril., 1, 325.
Press, M.F., Udove, J.A. and Greene, G.L. (1988) Progesterone receptor distribution in the human endometrium. Analysis using monoclonal antibodies to the human progesterone receptor. Am. J. Pathol., 131, 112124.[Abstract]
Rai, V., Hopkisson, J., Kennedy, S. et al. (1996) Integrins alpha 3 and alpha 6 are differentially expressed in endometrium and endometriosis. J. Pathol., 180, 181187.[Web of Science][Medline]
Satokata, I., Benson, G. and Maas, R. (1995) Sexually dimorphic sterility phenotypes in HOXA-10 deficient mice. Nature, 374, 460463.[Medline]
Seppälä, M. and Tiitinen, A. (1995) Endometrial responses to corpus luteum products in cycles with induced ovulation: Theoretical and practical considerations. Hum. Reprod., 10 (Suppl. 2), 6776.
Somkuti, S.G., Yuan, L.W., Fritz, M.A. and Lessey, B.A. (1997) Epidermal growth factor and sex steroids dynamically regulate a marker of endometrial receptivity in Ishikawa cells. J. Clin. Endocrinol. Metab., 82, 21922197.
Stewart, C.L., Kaspar, P., Brunet, L.J. et al. (1992) Blastocyst implantation depends on maternal expression of leukaemia inhibitory factor. Nature, 359, 7679.[Medline]
Tabibzadeh, S. (1992) Patterns of expression of integrin molecules in human endometrium throughout the menstrual cycle. Hum. Reprod., 7, 876882.
Taylor, H.S. (1997) [Abstr.] Soc. Gyn. Invest.,
Taylor, H.S., Arici, A., Olive, D. and Igarashi, P. (1998) Hoxa10 is expressed in response to sex steroids at the time of implantation in the human endometrium. J. Clin. Invest., 101, 13791384.[Web of Science][Medline]
Yoo, H.J., Barlow, D.H. and Mardon, H.J. (1997) Temporal and spatial regulation of expression of heparin-binding epidermal growth factor-like growth factor in the human endometrium: A possible role in blastocyst implantation. Dev. Genet., 21, 102108.[Web of Science][Medline]
Zhu, L.J., Bagchi, M.K. and Bagchi, I.C. (1998) Attenuation of calcitonin gene expression in pregnant rat uterus leads to a block in embryonic implantation. Endocrinology, 139, 330339.
Submitted on January 11, 1999; accepted on May 28, 1999.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
B. Lee, H. Du, and H. S. Taylor Experimental Murine Endometriosis Induces DNA Methylation and Altered Gene Expression in Eutopic Endometrium Biol Reprod, January 1, 2009; 80(1): 79 - 85. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Borghese, F. Mondon, J.-C. Noel, I. Fayt, T.-M. Mignot, D. Vaiman, and C. Chapron Research Resource: Gene Expression Profile for Ectopic Versus Eutopic Endometrium Provides New Insights into Endometriosis Oncogenic Potential Mol. Endocrinol., November 1, 2008; 22(11): 2557 - 2562. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Penna, H. Du, R. Ferriani, and H. S. Taylor Calpain5 expression is decreased in endometriosis and regulated by HOXA10 in human endometrial cells Mol. Hum. Reprod., October 1, 2008; 14(10): 613 - 618. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Lu, J. Hardt, and J.J. Kim Global analysis of genes regulated by HOXA10 in decidualization reveals a role in cell proliferation Mol. Hum. Reprod., June 1, 2008; 14(6): 357 - 366. [Abstract] [Full Text] [PDF] |
||||
![]() |
G B Godbole, D N Modi, and C P Puri Regulation of homeobox A10 expression in the primate endometrium by progesterone and embryonic stimuli Reproduction, September 1, 2007; 134(3): 513 - 523. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.J. Kim, H.S. Taylor, Z. Lu, O. Ladhani, J.M. Hastings, K.S. Jackson, Y. Wu, S.W. Guo, and A.T. Fazleabas Altered expression of HOXA10 in endometriosis: potential role in decidualization Mol. Hum. Reprod., May 1, 2007; 13(5): 323 - 332. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Jackson, A. Brudney, J. M. Hastings, P. A. Mavrogianis, J. J. Kim, and A. T. Fazleabas The Altered Distribution of the Steroid Hormone Receptors and the Chaperone Immunophilin FKBP52 in a Baboon Model of Endometriosis Is Associated With Progesterone Resistance During the Window of Uterine Receptivity Reproductive Sciences, February 1, 2007; 14(2): 137 - 150. [Abstract] [PDF] |
||||
![]() |
Z.-M. Cai, Y.-T. Gui, X. Guo, J. Yu, L.-D. Guo, L.-B. Zhang, H. Wang, and J. Yu Low Expression of Glycoprotein Subunit 130 in Ejaculated Spermatozoa from Asthenozoospermic Men J Androl, September 1, 2006; 27(5): 645 - 652. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Hastings, K. S. Jackson, P. A. Mavrogianis, and A. T. Fazleabas The Estrogen Early Response Gene FOS Is Altered in a Baboon Model of Endometriosis Biol Reprod, August 1, 2006; 75(2): 176 - 182. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. D. Sherwood Relaxin's Physiological Roles and Other Diverse Actions Endocr. Rev., April 1, 2004; 25(2): 205 - 234. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Luna, A. Riesewijk, J. A. Horcajadas, R. d. van Os, F. Dominguez, S. Mosselman, A. Pellicer, and C. Simon Gene expression pattern and immunoreactive protein localization of LGR7 receptor in human endometrium throughout the menstrual cycle Mol. Hum. Reprod., February 1, 2004; 10(2): 85 - 90. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Kim, H. S. Taylor, G. E. Akbas, I. Foucher, A. Trembleau, R. C. Jaffe, A. T. Fazleabas, and T. G. Unterman Regulation of Insulin-Like Growth Factor Binding Protein-1 Promoter Activity by FKHR and HOXA10 in Primate Endometrial Cells Biol Reprod, January 1, 2003; 68(1): 24 - 30. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. B. C. Apparao, M. J. Murray, M. A. Fritz, W. R. Meyer, A. F. Chambers, P. R. Truong, and B. A. Lessey Osteopontin and Its Receptor {alpha}v{beta}3 Integrin Are Coexpressed in the Human Endometrium during the Menstrual Cycle But Regulated Differentially J. Clin. Endocrinol. Metab., October 1, 2001; 86(10): 4991 - 5000. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hombach-Klonisch, S. Seeger, G. Tscheudschilsuren, J. Buchmann, B. Huppertz, G. Seliger, B. Fischer, and T. Klonisch Cellular localization of human relaxin-like factor in the cyclic endometrium and placenta Mol. Hum. Reprod., April 1, 2001; 7(4): 349 - 356. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
















