Molecular Human Reproduction, Vol. 6, No. 10, 867-872,
October 2000
© 2000 European Society of Human Reproduction and Embryology
Ovary and oogenesis |
Expression of the adrenomedullin gene in epithelial ovarian cancer
1 Department of Obstetrics and Gynecology, Shimane Medical University, Izumo 6938501, 2 Department of Pathology, Institute of Aging and Cancer, Tohoku University, Sendai 980-8575, and 3 Department of Public Health, Faculty of Medicine, Kagoshima University, Kagoshima 890-8520, Japan
Abstract
Adrenomedullin (AM) gene expression was analysed in 60 cases of epithelial ovarian cancer, (29 serous, 14 mucinous, 13 endometrioid, three clear cell, and one undifferentiated) using reverse transcriptionpolymerase chain reaction (RTPCR); 10 of the cases were of low malignant potential; 25 were stage I; three were stage II; 27 were stage III; and five were stage IV. The level of AM gene expression was described in terms of the relative yield of the AM gene to the ß2-microglobulin gene. AM gene expression ranged from 0.04 to 1.57 (median 0.36). The association between histological grade and AM gene expression was significant (P = 0.027), however, the association with other clinicopathological features, i.e. patients' age at diagnosis, stage of disease, residual tumour mass after initial surgery, and histological subtype were not significant. Survival data were available for all patients and univariate Cox regression analysis showed that the AM gene expression was significantly associated with a poor prognosis (P = 0.019). Immunohistochemical studies showed that AM was localized in the outer cell membrane or the cytoplasm of the carcinoma cells and in the endothelial cells of the tumour stroma. The AM gene expression level may play a key role in the biology of epithelial ovarian cancer and may define a more aggressive tumour phenotype.
adrenomedullin/epithelial ovarian cancer/gene expression/RT/PCR
Introduction
In spite of significant advances in surgery and the use of new, more effective chemotherapeutic regimens, the overall 5-year survival of patients with ovarian cancer is only ~30% (Kosary, 1994
). The high mortality rate of ovarian cancer is due predominantly to occult progression of the tumour within the peritoneal cavity with the initial diagnosis usually only being made at an advanced stage (Richardson et al., 1985a
,b
). Modifications in chemotherapy and/or surgery are unlikely in the near future to improve the dismal prognosis that is associated with this disease (Kacinski, 1992
). An improved understanding of the mechanisms regulating the growth of ovarian cancer cells may eventually lead to techniques which facilitate early diagnosis, establish the prognosis, or determine the response to therapy. Eventually, it may even be possible to design effective target therapies which will work by interfering with the biochemical processes which govern the growth of ovarian cancer cells.
Adrenomedullin (AM) is a hypotensive peptide initially isolated from pheochromocytoma (Kitamura et al., 1993
). AM has been shown to elicit a potent and long-lasting hypotensive effect when injected i.v. in anaesthetized rats (Ishiyama et al., 1993
). Endothelial cells produce AM, and patients with hypertension show higher concentrations of plasma AM than normotensive controls, suggesting that AM participates in the regulation of blood pressure and vascular homeostasis (Kitamura et al., 1994
). It has been reported that AM is expressed in a number of human tumours of both pulmonary and neural lineage, including small cell lung carcinoma, adenocarcinoma, bronchoalveolar carcinoma, lung carcinoids ganglioblastoma and neuroblastoma (Martinez et al., 1995
; Satoh et al., 1995
). AM has been shown to induce cAMP production in the target cells (Ishizaka et al., 1994
). It has been previously observed that most of the peptide hormones able to induce cAMP synthesis act as modulators of cell growth (Moody et al., 1993
; Ishizuka et al., 1994
); thus, AM may also function as a growth regulator in tumour proliferation.
In the present study, we used reverse transcriptasepolymerase chain reaction (RTPCR) to examine AM mRNA expression in 60 cases of epithelial ovarian cancer. In addition, AM localization was studied by immunochemistry. The gene expression of this enzyme has been related to clinical and pathological parameters to evaluate further the role of AM in epithelial ovarian cancer.
Materials and methods
Patients
A total of 60 patients (aged 1981 years, median 53 years) with histologically confirmed primary epithelial ovarian cancer were studied (Table I
). No patient received any therapy before surgery. The patients were staged according to criteria recommended by the International Federation of Obstetricians and Gynecologists (FIGO, 1987). The staging system defined by FIGO assumes that an adequate staging operation has been performed (Cannistra, 1993
). The staging operation included collection of ascites or peritoneal washing from the pelvis, gutters and diaphragms for cytological studies; total abdominal hysterectomy with bilateral salpingoophorectomy; infracolic omentectomy and appendectomy; selective pelvic and para-aortic lymphadenectomy; and debulking of all gross diseases. If an obvious macroscopic tumour was not present, the following were performed: biopsy of any lesion suspected of being a tumour metastasis or any adhesion adjacent to the primary tumour; blind biopsy of bladder peritoneum and cul-de-sac, right and left paracolic gutter and pelvic side walls; biopsy or smear of right hemidiaphragm. Survival data were available for all patients (median 24 months, range 2120 months). Of these, 55 patients received cisplatin-containing regimens. Four stage I tumours of low malignant potential and one stage I tumour of mucinous cystadenocarcinoma received no further treatment after surgery.
|
Tissue specimen and RNA preparation
Fresh surgical specimens from all patients were obtained, and the tissues for investigation were prepared carefully under a dissecting microscope to eliminate inappropriate components. The tissue samples were stored at 80°C for subsequent analysis. Total RNA was isolated from frozen tissue using a commercially available extraction method (Isogen; Nippon Gene Inc, Tokyo, Japan). Normal placental tissues were used as positive control for AM gene expression.
RTPCR
RTPCR for determination of AM gene expression was performed according to the method previously described (Arao et al., 1994
; Hata et al., 1999
, 2000
). Briefly, complementary DNA (cDNA) was prepared by random priming from 500 ng of total RNA using a First-Strand cDNA Synthesis kit (Pharmacia-LKB, Uppsala, Sweden). Primers for the AM gene (GenBank accession number D14874) were: ACATGAAGGGTGCCTCTCG (upstream) and GGTAGATCTGGTGTGCCAGC (downstream); and the PCR product was 162 bp. Primers for the human ß2-microglobulin gene (GenBank accession number V00567) were: ACCCCCACTGAAAAAGATGAG (upstream) and ATCTTCAAACCTCCATGATGC (downstream); and the PCR product was 120 bp. PCR was carried out in a Thermal Cycler (Perkin-Elmer Cetus, Northwalk, CT, USA) with a mixture consisting of cDNA derived from 5 ng of RNA, 10 pmol of upstream and downstream primers for the sequences of the AM gene and 5 pmol of primers for the ß2-microglobulin gene, 200 µmol of deoxynucleotide triphosphate, and 0.1 IU of Taq DNA polymerase with reaction buffer (Life Technologies, Rockville, MD, USA) in a final volume of 10 µl. The condition for PCR was denaturation at 94°C for 1 min, annealing at 58°C for 1 min, and extension at 72°C for 1 min. For each specimen, 34 cycles of PCR were performed, and the products were separated on 9% polyacrylamide gels. Then bands were visualized by ethidium bromide staining. National Institute of Health analysis software (version 1.61; National Institute of Health, Bethesda, MD, USA) was used to scan the RTPCR polyacrylamide gels after photographic documentation. This software measures relative mean density over a fixed grey scale range after correction for background. AM expression was described in terms of the relative yield of the AM gene to that of the ß2-microglobulin gene.
Histological grading
Histologically we classified tumours into four grades including a non-invasive grade as previously described (Arao et al., 1994
). The brief concept of grading used in the present study is as follows. A tumour of grade 1 is low malignant potential (LMP), which is non-invasive to surrounding tissues. Tumours of grades 24 correspond to well differentiated, moderately differentiated, and poorly differentiated carcinomas respectively.
Immunochemical staining
Formalin-fixed and paraffin-embedded tissue sections (5 µm) were stained for AM using the DAKO Envision Polymer System, horseradish peroxidase (HRP) method (Dako A/S, Carpinteria, USA). Briefly, tissue sections were dewaxed in xylene, rehydrated in graded alcohol down to water, washed in phosphate-buffered saline (PBS; pH 7.25) for 5 min and quenched in peroxidase blocking reagent for 5 min to remove endogenous peroxidase activity. Subsequently, slides were incubated with the rabbit anti-human AM primary antibody (Peptide Institute Inc, Osaka, Japan) at a 1:20 dilution for 30 min at room temperature. The secondary antibody conjugated with the HRP-labelled polymer was used for 30 min at room temperature following the primary antibody. Finally, bound antibody complexes were stained for 10 minutes with 0.05% diaminobenzidine and 0.01% hydrogen peroxide in 0.05 mol/l TrisHCl buffer (pH 7.6). The slides were washed between each step with PBS (3x10 min). The sections were counter-stained with Methyl Green. A normal placental section was used as positive control. To assess the immunospecificity of each antibody, normal rabbit serum (negative control) was used instead of primary antibodies.
Statistical analysis
MannWhitney U-test and KruskalWallis one-way analysis of variance by ranks were used as appropriate for the evaluation of differences between end-points. KaplanMeier curves were compared by means of homogeneity test and the log-rank test. The Cox proportional hazards model was used in survival analysis. Maximum likelihood parameter estimates and likelihood ratio statistics (LRS) in the Cox proportional hazards models were obtained with the use of a statistical package, EPICURE (Preston et al., 1990
). All P values presented were two-sided; P < 0.05 was considered to be statistically significant.
Results
AM gene expression
To determine the number of PCR cycles appropriate for quantification, PCR was performed from 2240 cycles at increments of two cycles. The expression ratios of AM to ß2-microglobulin were reasonably constant from 2438 cycles (data not shown). Therefore, in the subsequent experiments the values at 34 PCR cycles were defined as the expression of target genes. The representative profile of AM gene expression by RTPCR is shown in Figure 1
. In addition, the sequence of PCR products were analysed and they were identical to the sequence of AM gene.
|
AM gene expression and clinicopathological features
The AM gene expression in ovarian cancer tissues is summarized in Table I
|
|
AM gene expression and prognosis
In a follow-up study of 41 cases after complete resection of the primary tumours by surgical operation, AM gene expression of the nine cases which experienced recurrence (median 0.44, range 0.061.53) was higher than that of 32 cases without recurrence (median 0.24, range 0.041.44), however, the difference was not significant. When the patients are divided into three groups according to the level of AM gene expression, we found that the prognosis of the three groups were different (P = 0.028, LRS test for homogeneity). The prognosis of the patients with medium and high levels of AM gene expression was significantly worse than that of those with low AM gene expression. The P values obtained from log-rank test were 0.018 and 0.02 respectively (Figure 3
|
|
|
Cellular AM expression
To evaluate the localization of AM in tumour tissue, we performed immunochemical staining using the anti-human antibody for AM. AM was localized in the outer cell membrane or the cytoplasm of the carcinoma cells. Moreover the endothelial cells in the tumour stroma were immunoreactive for AM (Figure 4
|
Discussion
This is the first study on AM gene expression determined by RTPCR in epithelial ovarian cancers. AM gene expression was significantly associated with histological grade of the tumour. Elevated AM gene expression was significantly correlated with reduced survival when examined by univariate analysis. Multivariate analysis, however, demonstrated that AM gene expression is not an independent prognostic factor among the clinicopathological parameters studied. Moreover, the AM gene expression level of the cases with recurrence after complete resection was higher than that without recurrence, but no significant difference was noted. It has to be noted that the number of cases was limited. This molecular evaluation indicates that AM gene expression level may define a more aggressive tumour phenotype in epithelial ovarian cancer. One stage I patient (case 46) died 43 months after operation. The AM gene expression was remarkably high at 1.53. The high AM gene expression in this primary ovarian cancer tissue might be an indicator of its poor prognosis, despite the fact that ovarian cancer was at an early clinical stage. Therefore, even in epithelial ovarian cancer presenting with early disease, an extensive surgical treatment does not guarantee a cure. The patient of case 48, whose samples displayed a high AM gene expression, with a similar type and histological stage to that of case 46, is alive. Intensive care is necessary in her surveillance for recurrent disease. New molecular variables, e.g. AM gene expression, correlating with the malignant potential of the cancer cells would be clinically valuable in the identification of high-risk patients in early stage ovarian cancer.
The localization of AM in the endothelium of blood vessels was expected because of the involvement of this peptide in blood pressure regulation (Ishiyama et al., 1993
; Lippton et al., 1994
). The expression of AM in ovarian carcinoma cells suggests possible new roles for this molecule in ovarian cancer, although, to confirm this speculation, further physiological studies are needed to determine the relationships between AM expression and the secretion and distribution of the specific receptors in ovarian cancer. AM expression in rat cultured granulosa cells of the ovary have suggested an autocrine function for AM in these cells (Abe et al., 1998
). One group (Miller et al., 1996
) demonstrated that AM is expressed in a large variety of human tumour cell lines and that it can function as an autocrine growth factor capable of driving a self-perpetuating state in malignant disorders. Responding tumour cell lines were shown to express AM receptors and showed peptide-mediated increases in intracellular cAMP.
The growth and progression of tumours is dependent on the process of angiogenesis. This process begins when a pinpoint colony of tumour cells expands to a size where simple diffusion of nutrients (and wastes) is insufficient. New capillaries are elicited, and the tumour then enters a phase in which perfusion becomes the mechanism by which nutrients arrive and metabolic wastes are carried away (Folkman, 1971
). Therefore, blood supply is a critical factor for the growth and progression of the tumour. An alternative or synergistic survival method might be the production and secretion of vasodilatory substances such as AM to enhance the availability of nutrient factors to the tumour bed. Recently, it has been shown that AM is a novel growth factor for endothelial cells and is angiogenic in vivo in the chick chorioallantoic membrane assay (Zhao et al., 1998
).
This study has shown that AM gene expression might be an indicator of the prognosis of epithelial ovarian cancer, although further study is needed to assess how the expression of this gene is associated with an unfavourable prognosis of this carcinoma. The RTPCR method we used for determination of AM gene expression is convenient because it does not require radioisotopes or relative large amount of tumour tissue. Because even small amount of samples obtained from specimens during the operation are sufficient for the evaluation of AM gene expression, RTPCR detection of AM gene expression may make it possible to identify epithelial ovarian cancer patients with poor prognoses before chemotherapy. In those patients, it is anticipated that anti-AM therapy could be applied in conjunction with the conventional cytotoxic chemotherapy. Indeed, it has been demonstrated that blocking the biological activity of AM by the use of a monoclonal antibody in neoplastic cell lines results in significant suppression of tumour growth (Miller et al., 1996
).
Notes
4 To whom correspondence should be addressed at: Department of Obstetrics and Gynecology, Shimane Medical University, Izumo 693-8501, Japan. E-mail: hata31{at}shimane-med.ac.jp ![]()
References
Abe, K., Minegishi, T., Tano, M. et al. (1998) Expression and effect of adrenomedullin on rat granulosa cell. Endocrinology, 139, 52635266.
Arao, S., Suwa, H., Mandai, M. et al. (1994) Expression of multidrug resistance gene and localization of P-glycoprotein in human primary ovarian cancer. Cancer Res., 54, 13551359.
Cannistra, S.A. (1993) Cancer of the ovary. N. Engl. J. Med., 329, 15501559.
Folkman, J. (1971) Tumor angiogenesis: therapeutic implications. N. Engl. J. Med., 285, 11821186.
Hata, K., Kamikawa, T., Arao, S. et al. (1999) Expression of the thymidine phosphorylase gene in epithelial ovarian cancer. Br. J. Cancer, 79, 18481854.[Web of Science][Medline]
Hata, K., Fujiwaki, R., Nakayama, K. et al. (2000) Expression of TP and TIE2 genes in normal ovary with corpus luteum and in ovarian cancer: correlation with ultrasound-derived peak systolic velocity. Mol. Hum. Reprod., 6, 319323.
International Federation of Gynecology and Obstetrics (FIGO) (1987) Changes in definitions of clinical staging for carcinoma of the cervix and ovary. Am. J. Obstet. Gynecol., 156, 263264.[Medline]
Ishiyama, Y., Kitamura, K., Ichiki, Y. et al. (1993) Hemodynamic effects of a novel hypotensive peptide, human adrenomedullin, in rats. Eur. J. Pharmacol., 241, 271273.[Web of Science][Medline]
Ishizaka, Y., Ishizaka, Y., Tanaka, M. et al. (1994) Adrenomedullin stimulates cyclic AMP formation in rat vascular smooth muscle cells. Biochem. Biophys. Res. Commun., 200, 642646.[Web of Science][Medline]
Ishizuka, J, Townsend C.M., Bold, R.J. et al. (1994) Effects of gastrin on 3', 5'-cyclic adenosine monophosphate, intracellular calcium, and phosphatidylinositol hydrolysis in human colon cancer cells. Cancer Res., 54, 21292135.
Kacinski, B.M. (1992) CSF-1 and its receptor in ovarian and other gynaecological neoplasms. In Sharp et al. (eds), Ovarian Cancer. Vol. 2. Biology, Diagnosis and Management. Chapman & Hall Medical, London, UK, 115 pp.
Kitamura, K., Kawamoto, M., Ichiki, Y. et al. (1993) Adrenomedullin: a novel hypotensive peptide isolated from human pheochromocytoma. Biochem. Biophys Res. Commun., 192, 553560.[Web of Science][Medline]
Kitamura, K., Ichiki, Y., Tanaka, M. et al. (1994) Immunoreactive adrenomedullin in human plasma. FEBS Letts., 341: 288290.[Web of Science][Medline]
Kosary, C.L. (1994) FIGO stage, histologic grade, age, and race as prognostic factors in determining survival for cancers of the female gynecological system: an analysis of 197387 SEER cases of cancers of the endometrium, cervix, ovary, vulva, and vagina. Semin. Surg. Oncol., 10, 3146.[Web of Science][Medline]
Lippton, H., Chang, J., Hao, Q. et al. (1994) Adrenomedullin dilates the pulmonary vascular bed in vivo. J. Appl. Physiol., 76, 21542156.
Martinez, A., Miller, M.J., Unsworth, E.J. et al. (1995) Expression of adrenomedullin in normal human lung and in pulmonary tumours. Endocrinology, 136, 40994105.[Abstract]
Miller, M.J., Martinez, A., Unsworth, E.J. et al. (1996) Adrenomedullin expression in human tumor cell lines. J. Biol. Chem., 271, 2334523351.
Moody, T.W., Zia, F., Draoui, M. et al. (1993) A vasoactive intestinal peptide antagonist inhibits non-small cell lung cancer growth. Proc. Natl Acad. Sci. USA, 90, 43454349.
Preston, D.L., Lubin, J.H. and Pierce, D.A. (1990) EPICURE: risk regression and data analysis software. HiroSoft International Corporation, Seattle, USA.
Richardson, G.S., Scully, R.E., Nikrui, N. et al. (1985a) Common epithelial cancer of the ovary. Part 1. N. Engl J. Med., 312, 415424.[Web of Science][Medline]
Richardson, G.S., Scully, R.E., Nikrui, N. et al. (1985b) Common epithelial cancer of the ovary. Part 2. N. Engl. J. Med., 312, 415424.
Satoh, F., Takahashi, K., Murakami, O. et al. (1995) Adrenomedullin in human brain, adrenal glands and tumor tissues of pheochromocytoma, ganglioneuroblastoma and neuroblastoma. J. Clin. Endocrinol. Metab., 80, 17501752.
Zhao, Y., Hague, S., Manek, S. et al. (1998) PCR display identifies tamoxifen induction of the novel angiogenic factor adrenomedullin by a non estrogenic mechanism in the human endometrium. Oncogene, 16, 409415.[Web of Science][Medline]
Submitted on January 17, 2000; accepted on July 11, 2000.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
D. Ribatti, M. T. Conconi, and G. G. Nussdorfer Nonclassic Endogenous Novel Regulators of Angiogenesis Pharmacol. Rev., June 1, 2007; 59(2): 185 - 205. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Zudaire, A. Martinez, M. Garayoa, R. Pio, G. Kaur, M. R. Woolhiser, D. D. Metcalfe, W. A. Hook, R. P. Siraganian, T. A. Guise, et al. Adrenomedullin Is a Cross-Talk Molecule that Regulates Tumor and Mast Cell Function during Human Carcinogenesis Am. J. Pathol., January 1, 2006; 168(1): 280 - 291. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Frede, P. Freitag, T. Otto, C. Heilmaier, and J. Fandrey The Proinflammatory Cytokine Interleukin 1{beta} and Hypoxia Cooperatively Induce the Expression of Adrenomedullin in Ovarian Carcinoma Cells through Hypoxia Inducible Factor 1 Activation Cancer Res., June 1, 2005; 65(11): 4690 - 4697. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Iimuro, T. Shindo, N. Moriyama, T. Amaki, P. Niu, N. Takeda, H. Iwata, Y. Zhang, A. Ebihara, and R. Nagai Angiogenic Effects of Adrenomedullin in Ischemia and Tumor Growth Circ. Res., August 20, 2004; 95(4): 415 - 423. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Finley, N. Arora, B. Zhu, L. Gallagher, and T. J. Fahey III Molecular Profiling Distinguishes Papillary Carcinoma from Benign Thyroid Nodules J. Clin. Endocrinol. Metab., July 1, 2004; 89(7): 3214 - 3223. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. B. Barden, K. W. Shister, B. Zhu, G. Guiter, D. Y. Greenblatt, M. A. Zeiger, and T. J. Fahey III Classification of Follicular Thyroid Tumors by Molecular Signature: Results of Gene Profiling Clin. Cancer Res., May 1, 2003; 9(5): 1792 - 1800. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Martinez, M. Vos, L. Guedez, G. Kaur, Z. Chen, M. Garayoa, R. Pio, T. Moody, W. G. Stetler-Stevenson, H. K. Kleinman, et al. The Effects of Adrenomedullin Overexpression in Breast Tumor Cells J Natl Cancer Inst, August 21, 2002; 94(16): 1226 - 1237. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hata, R. Fujiwaki, K. Nakayama, and K. Miyazaki Expression of the Endostatin Gene in Epithelial Ovarian Cancer Clin. Cancer Res., August 1, 2001; 7(8): 2405 - 2409. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||









