Molecular Human Reproduction, Vol. 6, No. 11, 999-1004,
November 2000
© 2000 European Society of Human Reproduction and Embryology
Embryo development |
Oct-4 expression in inner cell mass and trophectoderm of human blastocysts
Program for In vitro Fertilization, Reproductive Surgery and Infertility, New York University Medical Center, 660 First Ave, 5th floor, New York, NY 10016, USA
Abstract
The expression of the transcription factor Oct-4 is thought to be one of the decisive factors that maintain totipotency in embryonic and germ cells. In mice, oct-4 is exclusively expressed in germ cells and totipotent cells of the embryo. In humans, Oct-4 is expressed in germ cells, embryonic stem cells and whole embryos at various stages of development. However, there is limited information about the distribution of Oct-4 expression in human embryos. In an attempt to address this issue, the inner cell mass (ICM) and trophectoderm (TE) of 17 human blastocysts were separated and Oct-4 mRNA expression individually assessed by reverse transcriptionpolymerase chain reaction (RTPCR). In discarded blastocysts that developed from two pronuclear zygotes, the mean Oct-4 expression was 31 times higher in totipotent ICM cells than in differentiated TE cells. This finding suggests that, in accordance with data from the mouse, Oct-4 is highly expressed in human ICM cells as opposed to TE cells; this in turn supports the hypothesis that Oct-4 plays a similar role to maintain totipotency in these two species.
blastocyst/embryogenesis/inner cell mass/Oct-4/totipotency
Introduction
Oct-4, also named Oct-3 (Scholer et al., 1990
; Okamoto et al., 1990
; Rosner et al., 1990
), is a transcription factor which belongs to the POU (Pit, Oct, Unc) family of domain transcription factors. Oct-4 belongs to the sub-group of octamer-binding proteins which bind by the POU domain to promoter and enhancer regions of various genes. Almost all POU domain transcription factors are developmentally-regulated in mice.
In humans, Oct-4 is the product of the OTF3 gene, which consists of five exons and is located on chromosome 6 near the major histocompatability complex (MHC) (Takeda et al., 1992
; Abdel-Rahman et al., 1995
). It encodes two splicing variants, one of which shares 87% sequence identity with mouse oct-4 (Takeda et al., 1992
). In addition to the OTF3 gene, there is a related OTF3C gene which is a retroposon and localized at chromosome 8 (Takeda et al., 1992
).
In mice, oct-4 is exclusively found in totipotent embryonic cells and germ cells (Palmieri et al., 1994
). While not found in adult tissues of the cow, the bovine oct-4 homologue bPOU5F1 is expressed in oocytes and, in contrast to mice, in all embryonic cells, i.e. trophectoderm (TE) cells, until day 10 of development (van Eijk et al., 1999
). In humans, Oct-4 is present throughout all stages from the unfertilized oocyte to blastocysts, as detected by reverse transcriptionpolymerase chain reaction (RTPCR) (Abdel-Rahman et al., 1995
) and by PCR of cDNA libraries (Verlinsky et al., 1998
). Oct-4 is also present in embryonic stem (ES) cells of humans (Reubinoff et al., 2000
) and mice (Rosner et al., 1990
) as well as in human embryonal carcinoma (EC) cells (Pera and Herszfeld, 1998
) and murine EC cells (Okamoto et al., 1990
).
Oct-4 is proposed to be one of the key factors that allows cells to remain in the cycle of totipotency: some totipotent embryonic cells form totipotent germ cells, which in turn give rise to new totipotent embryonic cells after fertilization. In mice, oct-4 is immediately down-regulated after cell differentiation (Palmieri et al., 1994
); oct-4 has also been shown to be essential for the development of pluripotent inner cell mass (ICM) cells in murine embryogenesis (Nichols et al., 1998
).
In an attempt to clarify the distribution pattern of Oct-4 in human embryos, Oct-4 mRNA expression was assessed by RTPCR in the ICM and TE of blastocysts. In accordance with the hypothesis established in mice, a high expression in totipotent ICM cells and a low expression in differentiated TE cells was found.
Materials and methods
Embryo selection and culture
Blastocysts were donated to research with patient consent. A total of 18 blastocysts [14 with two pronuclei (PN), two with 3PN, one with no PN, and one with no ICM] were discarded by 11 patients. From retrieval to fertilization check the next day (day 1) the embryos were cultured in human tubal fluid medium (HTF; Irvine Scientific, Santa Ana, CA, USA), then transferred to G1.2 or HTF media from days 1 to 3 and to G2.2 from day 3 to 7 (IVF Science Scandinavia, Gothenburg, Sweden) with a media change at day 5. Between each media change, embryos were washed in 4 drops of the appropriate media. Blastocysts were chosen for experiments when the ICM was clearly distinguishable from the TE. Selected blastocysts formed late after 6 or more days of culture and displayed an anomalous morphology indicating a poor prognosis for pregnancy outcome. As such they were appropriate for use in an Institutional Review Board-approved study (H-6902) to develop genetic procedures using discarded IVF tissues.
Isolation of trophectoderm and ICM
Blastocysts were transferred to a preincubated fresh drop of G2.2 media and placed under a micromanipulator (Nikon Narishige, Tokyo, Japan). Blastocysts were then halved by means of a razorblade fragment attached to the micromanipulator by a plastic pipe. A second pipette was used to navigate the embryo. Great care was taken to avoid any ICM cell contamination in the TE fraction by leaving some space between the ICM cells and the cut and by washing the razorblade with 70% ethanol after each dissection. The razorblade was moved back and forth several times until the two halves appeared totally separated (Figures 1 and 2![]()
). The ICM and TE halves were then moved to different parts of the drop by the pipette and sucked individually into a suction pipette. The suction pipette was preloaded with 4 mol/l guanidium isothiocyanate (GuSCN) denaturing solution which was separated from the media by an air bubble; different pipettes were used for each half. The suction pipette with the ICM or TE fraction was then removed from the pipette holder of the micromanipulator and the entire content flushed several times into a tube containing 100 µl 4 mol/l GuSCN, 0.5% sarcosyl, 20 µl ribosomal RNA (Roche Diagnostics, Mannheim, Germany) and 1% ß mercapto-ethanol denaturing solution. One blastocyst with no ICM (`empty blastocyst') was directly sucked by the suction pipette and transferred to the denaturing solution without any manipulation (Figure 3
). Some media samples were saved as negative controls for the PCR.
|
|
|
RNA isolation
RNA isolation was carried out as described (Rappolee et al., 1989
cDNA synthesis
The RNA was resolved in 1.9 µl DEPC water, 0.2 µg random oligo primer and 1 µl 10x reaction buffer (SuperScript Preamplification System; Life Technologies, Rockville, MD, USA) and heated to 70°C for 5 min. Samples were then placed on ice, centrifuged and 2.6 µl of a mix of 2.5 mmol/l MgCl2, 10 mmol/l dithiothreitol, 0.5 mmol/l NTP and 5 IU RNAse inhibitor (Promega, Madison, WI, USA) added. After incubation for 10 min at room temperature 100 IU Superscript II Reverse Transcriptase were pipetted to the sample and the cDNA synthesis carried out at room temperature for 5 min and 42°C for 50 min. The reaction was stopped at 95°C for 5 min. DNA content and purity was determined by spectrophotometric analysis of 0.3 µl diluted in 50 µl H2O (Beckman DU-600).
PCR
The first PCR for Oct-4 was carried out with 400 ng cDNA template, 50 nmol/l modified outer primer (Abdel-Rahman et al., 1995
) consisting of 3' primer GGAAAGGCTTCCCCCTCAGGGAAAGG and 5' primer AAGAACATGTGTAAGCTGCGGCCC), 6 µmol/l NTP (Life Technologies) and 2 mmol/l MgCl2. The second nested PCR used 2 µl of the first PCR, 500 nmol/l modified inner primer consisting of 3' primer TTCTGGCGCCGGTTACAGAACCA and 5' primer GACAACAATGAGAACCTTCAGGAGA, 20 µmol/l NTP and 2 mmol/l MgCl2. Both PCRs used a `hot start' with 1 IU Taq DNA polymerase (Roche Diagnostics) at 94°C for 4 min followed by 20 cycles (first PCR) or 30 cycles (second PCR) of 94°C for 15 s, 62°C for 30 s, and 72°C for 30 s in a GeneAmp 9600 (Perkin Elmer, Norwalk, CT, USA). Final extension was 72°C for 10 min. Positive control reactions for ß-actin were routinely carried out as the first PCR for Oct-4 with 0.2 µl template except for 50 cycles instead of 20 (3' primer CGTGGGGCGCCCCAGGCACCA, 5' primer TTGGCCTTGGGGTTCAGGGGGG). Water and media samples served as negative controls. The PCR products were analysed on a 2% agarose gel with 0.5x Tris/borate/EDTA (TBE) buffer. The usual precautions to avoid contamination were followed. A 50 bp ladder marker (100 ng, marker XIII, Roche Diagnostics) was routinely used as reference to estimate PCR product size.
Titration
In a first titration, 40025 ng (ICM) or 4002400 ng (TE) were subjected to the above-described PCR conditions to determine the sensitivity of the PCR and the relative expression levels of Oct-4 in ICM and TE fractions. In a second titration, a more sensitive PCR with 500 nmol/l outer primer, 40 µmol/l NTP and 50 cycles in the first PCR and 500 mmol/l inner primer, 20 µmol/l NTP and 25 cycles in the second PCR, was applied to 10602 ng of ICM and TE fractions to confirm relative expression levels.
Digestion
To confirm sequence identity, 9 µl of PCR samples of Oct-4-positive ICM fractions were incubated with 1 µl HaeIII (NEB, Beverly, MA, USA) at 37°C for 2h and the digestion pattern was analysed on a 4% low melting agarose gel.
Software analysis of PCR bands
PCR bands were analysed by a GelDoc 2000 system with Quantity One 4.1.0 software (Bio-Rad, Hercules, CA, USA) to compare the relative intensities of the Oct-4-positive bands.
Results
In all, 18 blastocysts were examined for Oct-4 expression: 14 blastocysts originated from 2PN zygotes (Figure 1
), two blastocysts from 3PN zygotes and one from a 0PN zygote (Figure 2
); another blastocyst had no visible ICM (empty blastocyst; Figure 3
). Regardless of their pronuclear status, all blastocysts showed a markedly higher level of Oct-4 mRNA in the ICM fraction compared with the TE fraction (Figure 4a
and c). Control reactions for ß-actin mRNA were positive in all embryo samples; control reactions for water and media were negative (Figure 4b
).
|
In the nested PCR 455bp products of the first round (data not shown) were subjected to the second round and yielded products of 218 bp (Figure 4a
|
Oct-4 expression levels were compared between ICM and TE cells of 4 blastocysts (Figure 6
|
The relative expression levels were confirmed with the same four blastocysts in a highly sensitive PCR (down to 8 ng) with Oct-4 being, at an average, 29 times higher in ICM than in TE fractions (range: 21x to 33x; Figure 6b
Computerized analysis of the bands on the gel revealed variable levels of Oct-4 mRNA in the ICM of different 2PN blastocysts (Figure 7
). Comparison (by observation) with the pictures of the blastocysts suggested a positive correlation between Oct-4 mRNA levels and the approximate number of ICM cells (range 815 cells). This was consistent with a report showing a mean of 13.6 cells in the ICM of a day 6 blastocyst with poor morphology and derived from a 2PN zygote (Evsikov and Verlinsky, 1998
). An exception was the ICM of the 0PN blastocyst (Figure 2
), which showed an abnormally strong signal despite a small number of ICM cells (~8). Similar variations for ß-actin mRNA were not observed because the PCR presumably reached a plateau for all reactions after 50 cycles.
|
While the ICM of the 0PN blastocyst showed a relative 1.37 fold increase in Oct-4 mRNA levels compared to the mean value for other ICM samples (Figure 4
Discussion
Several lines of evidence strongly suggest that our experimental procedures monitored Oct-4 mRNA levels in human embryos: the primers were successfully used in previous experiments to clone and sequence human Oct-4 cDNA (Abdel-Rahman et al., 1995
), the nested PCR greatly increased specificity of the reactions, the products of the nested PCR were of the expected size of 455 and 218 bp after the first and second rounds respectively, digestion with the enzyme HaeIII created products of the expected molecular size of 52 and 166 bp, and additional bands after the second round of the nested PCR were never observed. Using the same conditions for cDNA synthesis and PCR and the same amount of cDNA template in both ICM and TE fractions in the same experiment, we quantified Oct-4 mRNA levels in ICM and TE of human blastocysts. We found that the Oct-4 mRNA levels are, on average, 31 times higher in ICM than in TE of human blastocysts derived from 2PN zygotes. However, since we consistently observed contamination of the ICM fraction by trophectoderm cells when these blastocysts were bisected, this 31-fold difference may well be a minimum value which is slightly higher in reality. Since all TE fractions were positive for ß-actin expression, their negative signals in the Oct-4 PCR were not due to failure of cDNA synthesis. Positive ß-actin mRNA signals also ensured that the RNA was not severely degraded during the process of cutting the embryo. Negative water and media controls ensured the absence of Oct-4 and ß-actin contamination. All experiments were repeated and the results confirmed.
The variation of Oct-4 mRNA levels between ICM and TE fractions were established by two titration studies. Since the titrations were standardized to absolute amounts of cDNA template, (small) differences in the cell number of the ICM and TE fractions tested should not have played a role. Although displaying different Oct-4 mRNA levels in the ICM fractions, all four blastocysts examined generated a very similar induction factor between ICM and TE cells, varying only by a maximum of 1.8-fold. Also the differences between the two titration PCRs, the second being 4.1 times more sensitive, are minimal with 28x induction of Oct-4 for the second, compared with 34x for the first, PCR.
The variations in Oct-4 mRNA levels in the ICM of the blastocysts from 2PN zygotes were well correlated with the size of the ICM; i.e. the more ICM cells, the more total Oct-4 was detected. According to these observations, the levels in each individual ICM cell would appear to be rather similar. This hypothesis agrees with the recent findings (Niwa et al., 2000
) that describe the close regulation of Oct-4 expression in murine ES cells. A relative expression level of 0.5, 1.0 and 1.5 was found to direct the cells to trophectoderm, ICM and primitive endoderm and mesoderm respectively. In contrast, our results differ from recent findings that describe oct-4 expression in bovine embryos at a similar level in both ICM and TE cells until day 10 of embryonic development (van Eijk et al., 1999
).
The 3PN blastocysts showed a decreased relative level of Oct-4 mRNA compared with 2PN blastocysts, while the 0PN blastocyst exhibited increased level. This finding is rather unexpected since one would assume that an extra copy of all chromosomes leads to an increased Oct-4 expression while loss of chromosomes results in decreased expression. An explanation could be that transcription factors, which regulate Oct-4 in a negative way, are over-expressed by an additional set of chromosomes.
Information about oct-4 repression is limited and seems to involve a retinoic acid responsive element (Pikarsky et al., 1994
). Other described mechanisms, e.g. changes in chromatin structure (Minucci et al., 1996
) and de-novo methylation (Ben-Shushan et al., 1993
) could also be induced by over-expression of the responsible genes. The question of which physiological processes trigger Oct-4 down-regulation is still open; several hypotheses are discussed including the location of cells in the embryo and formation of specific cellcell contacts, e.g. a signal cascade from E-cadherin to ß-catenin to lymphoid enhancer factor (LEF-1) (Pesce et al., 1998
).
Candidate genes for the activation of Oct-4 expression are the transcription factors Sp1 and Sp3 (Sylvester and Scholer, 1994
; Pesce et al., 1999
) and SF1 (Barnea and Bergman 2000
). Oct-4 activation occurs prior to any changes in known transcription factor levels in mice (Brehm et al., 1997
), which supports the hypothesis of an initial high level of oct-4 with a subsequent down-regulation in mammalian embryogenesis. In human oocytes, Oct-4 is also abundant (C.Hansis; unpublished data). So far, approximately nine known and several unknown genes have been found to contain Oct-4 binding sites, some of them being positively and negatively regulated by Oct-4 (Ovitt and Scholer, 1998
) such as repression of
and ß subunits of human chorionic gonadotrophin (HCG) and activation of the platelet-derived growth factor (PDGF)
receptor.
An abnormal pronuclear status does not seem to prevent ICM cells from expressing Oct-4. Since the embryo diagnosed as 0PN at day 1 still developed into a blastocyst, it should have contained chromosomes and experienced the genetic activation around the 4-cell stage that is required for further embryonic development. Zygotes with 0PN rarely develop into a blastocyst in our IVF programme; however, it is possible that the pronuclei were missed during the fertilization check due to an abnormal timing of pronuclear formation.
Significantly, Oct-4 mRNA was not detected in an `empty blastocyst' lacking an ICM. One elegant explanation for such a blastocyst is that Oct-4 expression in the ICM progenitor blastomeres is disturbed and a proper ICM cannot be formed. Such a hypothesis is based on murine studies in which pluripotent ICM formation was shown to depend on Oct-4 expression (Nichols et al., 1998
).
The 31-fold higher level of Oct-4 mRNA expression in the ICM fraction, compared with the TE fraction, of human 2PN blastocysts is a strong indication that Oct-4 has a similar function in retaining totipotency as has been established in murine cells (Pesce et al., 1998
). Nevertheless, more proof is needed that the biological function of Oct-4 is the same in humans and mice. As in mice, a high Oct-4 expression could allow human ICM cells to remain totipotent, while Oct-4 down-regulation would initiate differentiation into TE cells. Oct-4 is also detectable in human TE cells, but this might be due to a low background expression or slowly declining Oct-4 mRNA levels in newly differentiated cells.
These experiments establish for the first time the relative differences in Oct-4 expression between human ICM and TE cells. Oct-4 might thus play a similar role to maintain totipotency in humans as it does in mice. Consistent with the presented data, Oct-4 expression was recently detected in ICM-derived human ES cells (Reubinoff et al., 2000
). In the future, induction of Oct-4 expression might be a useful tool to produce and maintain human ES cells.
Acknowledgments
We would like to thank Ya-Xu Tang for long and useful discussions of the project, Ling Chi for her help with the patient records, and Caroline McCaffrey for collecting and assessing the embryos.
Notes
1 To whom correspondence should be addressed at: Program for In Vitro Fertilization, Reproductive Surgery and Infertility, New York University Medical Center, 660 First Ave, 5th floor, New York, NY 10016, USA. ChrHansis{at}aol.com ![]()
References
Abdel-Rahman, B., Fiddler, M., Rappolee, D. et al. (1995) Expression of transcription regulating genes in human preimplantation embryos. Mol. Hum. Reprod., 1, see Hum. Reprod., 10, 27872792.
Barnea, E. and Bergman, Y. (2000) Synergy of SF1 and RAR in activation of Oct-3/4 promoter. J. Biol. Chem., 275, 66086619.
Ben-Shushan, E., Pikarsky, E., Klar, A. et al. (1993) Extinction of Oct3/4 gene expression in embryonal carcinomaxfibroblast somatic cell hybrids is accompanied by changes in the methylation status, chromatin structure and transcriptional activity of the Oct3/4 upstream region. Mol. Cell. Biol., 13, 891901.
Brehm, A., Ohbo, K., Scholer, H.R. et al. (1997) The carboxy-terminal transactivation domain of Oct-4 acquires cell specificity through the POU domain. Mol. Cell. Biol., 17, 154162.[Abstract]
Evsikov, S. and Verlinsky, Y. (1998) Mosaicism in the inner cell mass of human blastocysts. Hum. Reprod., 13, 31513155.
Minucci, S., Botquin, V., Yeom, Y.I. et al. (1996) Retinoic acid-mediated down-regulation of Oct3/4 coincides with the loss of promoter occupancy in vivo. EMBO J., 15, 888899.[Web of Science][Medline]
Nichols, J., Zevnik, B., Anastassiadis, K. et al. (1998) Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell 95, 379391.[Web of Science][Medline]
Niwa, H., Miyazaki, J. and Smith, A.G. (2000) Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nature Genet., 24, 372376.[Web of Science][Medline]
Okamoto, K., Okazawa, H., Okuda, A. et al. (1990) A novel octamer binding transcription factor is differentially expressed in mouse embryonic cells. Cell, 60, 461472.[Web of Science][Medline]
Ovitt, C.E. and Scholer, H.R. (1998) The molecular biology of Oct-4 in the early mouse embryo. Mol. Hum. Reprod., 4, 10211031.
Palmieri, S., Peter, W., Hess, H. et al. (1994) Oct-4 transcription factor is differentially expressed in the mouse embryo during establishment of the first two extraembryonic cell lineages involved in implantation. Dev. Biol., 166, 259267.[Web of Science][Medline]
Pera, M.F. and Herszfeld, D. (1998) Differentiation of human pluripotent teratocarcinoma stem cells induced by bone morphogenetic protein-2. Reprod. Fertil. Dev., 10, 551555.[Medline]
Pesce, M., Gross, M.K. and Scholer, H.R. (1998) In line with our ancestors: Oct-4 and the mammalian germ. Bioessays, 20, 722732.[Web of Science][Medline]
Pesce, M., Marin, Gomez M., Philipsen, S. et al. (1999) Binding of Sp1 and Sp3 transcription factors to the Oct-4 gene promoter. Cell. Mol. Biol. (Noisy-le-grand), 45, 709716.[Medline]
Pikarsky, E., Sharir, H., Ben-Shushan, E. et al. (1994) Retinoic acid represses Oct-3/4 gene expression through several retinoic-acid responsive elements located in the promoter-enhancer region. Mol. Cell. Biol., 14, 10261038.
Rappolee, D.A., Wang, A., Mark, D. et al. (1989) Novel method for studying mRNA phenotypes in single or small numbers of cells. J. Cell. Biochem., 39, 111.[Web of Science][Medline]
Reubinoff, B.E., Pera, M.F., Fong, C.Y. et al. (2000) Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nat. Biotechnol., 18, 399404.[Web of Science][Medline]
Rosner, M.H., Vigano, M.A., Ozato, K. et al. (1990) A POU-domain transcription factor in early stem cells and germ cells of the mammalian embryo. Nature, 345, 686692.[Medline]
Scholer, H.R., Dressler, G.R., Balling, R. et al. (1990) Oct-4: a germline-specific transcription factor mapping to the mouse t-complex. EMBO J., 9, 21852195.[Web of Science][Medline]
Sylvester, I. and Scholer, H.R. (1994) Regulation of the Oct-4 gene by nuclear receptors. Nucleic Acids Res., 22, 901911.
Takeda, J., Seino, S. and Bell, G.I. (1992) Human Oct3 gene family: cDNA sequences, alternative splicing, gene organization, chromosomal location, and expression at low levels in adult tissues. Nucleic Acids Res., 20, 46134620.
van Eijk, M.J., van Rooijen, M.A., Modina, S. et al. (1999) Molecular cloning, genetic mapping, and developmental expression of bovine POU5F1. Biol. Reprod., 60, 1093103.
Verlinsky, Y., Morozov, G., Verlinsky, O. et al. (1998) Isolation of cDNA libraries from individual human preimplantation embryos. Mol. Hum. Reprod., 4, 571575.
Submitted on April 27, 2000; accepted on August 1, 2000.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
Y H Choi, H D Harding, D L Hartman, A D Obermiller, S Kurosaka, K J McLaughlin, and K Hinrichs The uterine environment modulates trophectodermal POU5F1 levels in equine blastocysts Reproduction, September 1, 2009; 138(3): 589 - 599. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C. Douglas, C. A. VandeVoort, P. Kumar, T.-C. Chang, and T. G. Golos Trophoblast Stem Cells: Models for Investigating Trophectoderm Differentiation and Placental Development Endocr. Rev., May 1, 2009; 30(3): 228 - 240. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Monk, M. Hitchins, and S. Hawes Differential expression of the embryo/cancer gene ECSA(DPPA2), the cancer/testis gene BORIS and the pluripotency structural gene OCT4, in human preimplantation development Mol. Hum. Reprod., June 1, 2008; 14(6): 347 - 355. [Abstract] [Full Text] [PDF] |
||||
![]() |
S J Kimber, S F Sneddon, D J Bloor, A M El-Bareg, J A Hawkhead, A D Metcalfe, F D Houghton, H J Leese, A Rutherford, B A Lieberman, et al. Expression of genes involved in early cell fate decisions in human embryos and their regulation by growth factors Reproduction, May 1, 2008; 135(5): 635 - 647. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Kerr, C. M. Hill, P. D. Blumenthal, and J. D. Gearhart Expression of pluripotent stem cell markers in the human fetal ovary Hum. Reprod., March 1, 2008; 23(3): 589 - 599. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. T. Rodriguez, J. M. Velkey, C. Lutzko, R. Seerke, D. B. Kohn, K. S. O'Shea, and M. T. Firpo Manipulation of OCT4 Levels in Human Embryonic Stem Cells Results in Induction of Differential Cell Types Experimental Biology and Medicine, November 1, 2007; 232(10): 1368 - 1380. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Byrne, S. M. Mitalipov, L. Clepper, and D. P. Wolf Transcriptional Profiling of Rhesus Monkey Embryonic Stem Cells Biol Reprod, December 1, 2006; 75(6): 908 - 915. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lee, H. K. Kim, J.-Y. Rho, Y.-M. Han, and J. Kim The Human OCT-4 Isoforms Differ in Their Ability to Confer Self-renewal J. Biol. Chem., November 3, 2006; 281(44): 33554 - 33565. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Stoop, F. Honecker, M. Cools, R. de Krijger, C. Bokemeyer, and L.H.J. Looijenga Differentiation and development of human female germ cells during prenatal gonadogenesis: an immunohistochemical study Hum. Reprod., June 1, 2005; 20(6): 1466 - 1476. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Cauffman, H. Van de Velde, I. Liebaers, and A. Van Steirteghem Oct-4 mRNA and protein expression during human preimplantation development Mol. Hum. Reprod., March 1, 2005; 11(3): 173 - 181. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Vejlsted, B. Avery, M. Schmidt, T. Greve, N. Alexopoulos, and P. Maddox-Hyttel Ultrastructural and Immunohistochemical Characterization of the Bovine Epiblast Biol Reprod, March 1, 2005; 72(3): 678 - 686. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. D. Jones, T. M. Ulbright, J. N. Eble, and L. Cheng OCT4: A Sensitive and Specific Biomarker for Intratubular Germ Cell Neoplasia of the Testis Clin. Cancer Res., December 15, 2004; 10(24): 8544 - 8547. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kurosaka, S. Eckardt, and K. J. McLaughlin Pluripotent Lineage Definition in Bovine Embryos by Oct4 Transcript Localization Biol Reprod, November 1, 2004; 71(5): 1578 - 1582. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Rajpert-De Meyts, R. Hanstein, N. Jorgensen, N. Graem, P. H. Vogt, and N. E. Skakkebaek Developmental expression of POU5F1 (OCT-3/4) in normal and dysgenetic human gonads Hum. Reprod., June 1, 2004; 19(6): 1338 - 1344. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. T. Clark, M. S. Bodnar, M. Fox, R. T. Rodriquez, M. J. Abeyta, M. T. Firpo, and R. A. R. Pera Spontaneous differentiation of germ cells from human embryonic stem cells in vitro Hum. Mol. Genet., April 1, 2004; 13(7): 727 - 739. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Mitalipov, H.-C. Kuo, J. D. Hennebold, and D. P. Wolf Oct-4 Expression in Pluripotent Cells of the Rhesus Monkey Biol Reprod, December 1, 2003; 69(6): 1785 - 1792. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. H. J. Looijenga, H. Stoop, H. P. J. C. de Leeuw, C. A. de Gouveia Brazao, A. J. M. Gillis, K. E. P. van Roozendaal, E. J. J. van Zoelen, R. F. A. Weber, K. P. Wolffenbuttel, H. van Dekken, et al. POU5F1 (OCT3/4) Identifies Cells with Pluripotent Potential in Human Germ Cell Tumors Cancer Res., May 1, 2003; 63(9): 2244 - 2250. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wang, Y. Wen, S. Mooney, B. Behr, and M. L. Polan Phospholipase A2 and Cyclooxygenase Gene Expression in Human Preimplantation Embryos J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2629 - 2634. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Hansis, Y. Tang, J. A. Grifo, and L. C. Krey Analysis of Oct-4 expression and ploidy in individual human blastomeres Mol. Hum. Reprod., February 1, 2001; 7(2): 155 - 161. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

















