Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (9)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Jézéquel, P.
Right arrow Articles by David, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jézéquel, P.
Right arrow Articles by David, V.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Human Reproduction, Vol. 6, No. 12, 1063-1067, December 2000
© 2000 European Society of Human Reproduction and Embryology


Testis and spermatogenesis

Molecular screening of the CFTR gene in men with anomalies of the vas deferens: identification of three novel mutations

Pascal Jézéquel1,5, Christèle Dubourg1, Dominique Le Lannou2, Sylvie Odent3, Jean-Yves Le Gall1, Martine Blayau1, André Le Treut4 and Véronique David1

1 Laboratoire de Génétique Moléculaire et Hormonologie, et UPR 41 CNRS, CHU Pontchaillou, F-35033 Rennes cedex, 2 Unité de Biologie de la Reproduction, CECOS de l'Ouest, CHU Hôtel-Dieu, F-35000 Rennes cedex, 3 Service de Pédiatrie-Génétique Médicale, CHU Pontchaillou, F-35033 Rennes cedex, and 4 Laboratoire de Biochimie Générale et Enzymologie, CHU Pontchaillou, F-35033 Rennes cedex, France

Abstract

Many studies have shown that congenital absence of the vas deferens (CAVD) is a genital cystic fibrosis transmembrane conductance regulator (CFTR)-mediated phenotype, with a broad spectrum of abnormalities causing male infertility. The genotype of these patients includes mutations in the CFTR gene, e.g. {Delta}{Delta}F508, R117H and the T5 allele; all of which are commonly found in CAVD. In this study we have screened the entirety of CFTR gene in 47 males with anomalies of the vas deferens: 37 cases of congenital bilateral absence of the vas deferens, three cases of congenital unilateral absence of the vas deferens and seven cases of obstructive azoospermia with hypoplastic vas deferens. Among the 94 chromosomes studied, 65 mutations, of which three are novel (2789+2insA, L1227S, 4428insGA), were identified. The majority of patients (63.8%) had two detectable CFTR gene mutations. Furthermore, high frequencies of the {Delta}{Delta}F508 mutation (44.7%), the T5 allele (36.2%) and R117H mutation (19.1%) were observed.

CAVD/CFTR/cystic fibrosis/gene mutations/male infertility

Introduction

Congenital absence of the vas deferens (CAVD) is a frequent cause of obstructive azoospermia and accounts for ~1.5% of male infertility (Jequier et al., 1985Go). This type of sterility represents one of the phenotypic manifestations of cystic fibrosis (CF) in the vast majority (97–98%) of male patients (Kaplan et al., 1968Go; Landing et al., 1969Go). In CF, mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene leads to dysfunction of the lungs, pancreas, sweat glands and vas deferens. The CFTR gene encodes a 1480 amino acid protein that functions as a cAMP-regulated chloride channel in the apical membrane of epithelial cells. It is organized in two membrane spanning domains, TMD1 and TMD2, each containing six transmembrane segments designated m1–m12, two nucleotide binding domains, NBD1 and NBD2 (Riordan et al., 1989Go), and a cytoplasmic regulatory domain, R, which is required, in part, for the protein kinase A sensitivity of channel gating (Cheng et al., 1991Go).

A genetic link between CF and CAVD was suggested in 1990 when an increased frequency of heterozygotes for the CFTR gene mutation, {Delta}F508, was reported (Dumur et al., 1990Go). In 1992, the first observation of compound heterozygosity for the CF gene in a patient with CBAVD was described (Anguiano et al., 1992Go). These results were subsequently confirmed in many studies (Meschede et al., 1993Go; Patrizio et al., 1993Go). At the present time, CAVD and CF are regarded as different CFTR-mediated clinical syndromes. Increased frequencies of CFTR mutations in men with obstructive azoospermia with the presence of the vas deferens, have also been reported (Meschede et al., 1995Go; Van der Ven et al., 1996Go; Kanavakis et al., 1998Go).

The pathogenic mechanism of such reproductive tract defects has long been debated. A secondary obstruction with abnormal viscous secretion (Di Sant'Agnese, 1968Go), as is the case for pancreatic ducts in CF, or a primary malformation of the genital tract (Holsclaw et al., 1971Go) have been proposed as possible causes. As previously shown (Gaillard et al., 1997Go), the normal organogenesis of the vas deferens in the fetus, together with a higher proportion of normal ducts reported for prepubertal CF males than for CF adults, support the hypothesis that infertility in adults with CF mutations is probably due to degeneration of the reproductive ducts.

The most common mutations found in isolated CAVD phenotypes are {Delta}F508, R117H and the T5 allele (IVS8-T5) (Chillon et al., 1995Go; Jarvi et al., 1995Go). The poly-T tract (Tn), near a poly-TG loci [(TG)m], in the branch/acceptor splicing site of intron 8 exists in three variants with 5, 7 or 9 thymidines (the T5, T7 and T9 alleles respectively) (Kiesewetter et al., 1993Go). The T7 and T9 alleles generate a predominantly normal transcript, whereas the T5 variant generates two transcripts, one normal with exon 9 intact and the other with an in-frame deletion of exon 9. The translated product of the CFTR transcript lacking exon 9 is apparently devoid of cAMP-activated chloride conductance. The T5 allele, the most common mutation in CAVD after {Delta}F508, is considered to be a mild mutation with an incomplete penetrance (Zielenski et al., 1995Go; Rave-Harel et al., 1997Go). Another group (Cuppens et al., 1998Go) has shown that the polymorphic (TG)m locus (with alleles ranging from 9 to 13 repeats) determined the partial penetrance of the T5 allele as a disease mutation. Furthermore, the phenotypic expression of R117H has previously been shown to be modulated by the polymorphic Tn locus. If an R117H CFTR gene harbours a T5 allele, the mutant gene will be responsible for CF. An R117H mutant CFTR gene that harbours a T7 allele can either result in CF or CAVD (Kiesewetter et al., 1993Go).

In this study, we investigated the proportion and distribution of CFTR gene mutations in a cohort of 47 males who presented with anomalies of the vas deferens.

Materials and methods

Patients
A total of 47 patients aged 23–43 years (mean age 31.5), unrelated, originating from the Brittany region of France and followed for sterility by the CECOS de l'Ouest (Centre d'Etude et Conservation des Oeufs et du Sperme Humain) were included in this study between 1992 and 1995. Of the present cohort, 25 patients were previously investigated (Jézéquel et al., 1995Go).

Diagnoses of 37 congenital bilateral absence of vas deferens (CBAVD), three congenital unilateral absence of vas deferens (CUAVD) and in seven patients with obstructive azoospermia and the presence of hypoplastic vas deferens (based on width criteria) were initially suggested by impalpable scrotal vas on physical examination and subsequently confirmed by biological characteristics: azoospermia with low semen volume (<1.5 ml), decrease of fructose (vesicular marker) and carnitine (epididymal marker) concentrations, and normal FSH concentrations. Diagnoses were confirmed by surgical exploration in 28 patients (Table IGo).


View this table:
[in this window]
[in a new window]
 
Table I. Summary of the clinical and biological findings of a population of men with congenital bilateral absence of the vas deferens (CBAVD, n = 37), congenital unilateral absence of the vas deferens (CUAVD, n = 3) and obstructive azoospermia (Obs A, n = 7)
 
None had clinical manifestations (pulmonary or gastrointestinal) or family history suggestive of CF. No sputum microbiology was done because no recurrent respiratory infection was observed. The results of sweat chloride analysis and additional clinical data on the patients are listed in Table IGo. Sweat chloride levels were determined in 21 patients. We assigned a positive diagnostic value to sweat chloride of >70 mmol/l (Hall et al., 1990Go). The three patients with a sweat chloride level of >70 mmol/l did not show any pulmonary or gastrointestinal symptoms of CF. In all, 11 patients had a sweat chloride level of <40 mmol/l, and seven patients were in the intermediate range (40–70 mmol/l), that is considered as equivocal.

None had undergone abdominal ultrasonography or excretory urography to detect congenital renal abnormalities.

Genetic analysis
Total genomic DNA was isolated from the patients' peripheral blood cells and analysed for mutations in the whole CFTR region and splice junctions. Chromosomes were first tested for the presence of the {Delta}F508 mutation by heteroduplex analysis (Rommens et al., 1990Go) and by polymerase chain reaction (PCR)-mediated site-directed mutagenesis (PSM) (Friedman et al., 1991Go).

The non-{Delta}F508 chromosomes were screened for mutations by denaturing gradient gel electrophoresis (DGGE) (Myers et al., 1985Go; Sheffield et al., 1989Go). Computer analysis was performed by using the Melt 87 and SQHTX programs, generously provided by L.Lerman (Lerman and Silverstein, 1987Go). A total of 20 exons and their flanking regions (1, 2, 5, 6a, 6b, 7, 10, 11, 12, 14a, 14b, 15, 16, 17a, 17b, 18, 20, 22, 23, 24) were amplified with a GC-clamp primer and six exons (3, 4, 8, part of 13, 19, 21) were amplified with a psoralen primer, as previously described (Fanen et al., 1992Go; Bienvenu et al., 1995Go; Jézéquel et al., 1995Go). PCR was first performed on a PTC thermal cycler (MJ Research, MA, USA) on 500 ng of DNA with standard conditions for all the exons and DGGE was performed in a CBS Scientific apparatus (CA, USA), The DGGE conditions have been described elsewhere (Fanen et al., 1992Go; Bienvenu et al., 1995Go; Jézéquel et al., 1995Go). Each PCR fragment displaying an abnormal pattern of migration was further analysed by direct sequencing on an automatic ABI 373A DNA sequencer with the ABI prism dye terminator cycle sequencing ready reaction kit (Perkin Elmer-Applied Biosystems, CA, USA).

Exon 9 and its exon/intron junctions were directly sequenced using the following primers: forward: 5' TAATGGATCATGGGCCATGT 3'; reverse: 5' ACAGTGTTGAATGTGGTGCA 3', which allowed both screening for mutations and genotyping at the Tn and (TG)m loci. Part of exon 13 was directly sequenced with the primers: forward: 5' CAAAATGCTAAAATACGAGAC 3'; reverse: 5' TCATCAGGTTCAGGACAGACT 3'.

The 3849 + 10 kb C->T splice mutation in intron 19 was explored by PCR followed with HphI digestion as previously described (Highsmith et al., 1994Go).

Results

We have found 65 mutations in our 47 patient cohort (allelic frequency: 69%). There were 16 different types of mutations. In agreement with a previous study (Dumur et al., 1990Go), {Delta}F508 was the most frequent mutation occurring in 21 out of 47 patients (44.7%).

The T5 allele was found in 17 out of 47 patients (36.2%). In patients with the T5 allele, the [(TG)12T5] allele was the most frequent (nine out of 17 = 52.9%), followed by the [(TG)13T5] allele (5/17 = 29.4%) and the [(TG)11T5] allele (3/17 = 17.7%).

R117H showed a high frequency (9/47 = 19.1%). Out of eight chromosomes bearing the R117H mutation, five [R117H;(TG)10T7] haplotypes (62.5%) and three [R117H;(TG)11T7] haplotypes (37.5%) were found. In one case the [R117H;(TG)mTn] haplotype could not be deduced. R117H was always present on T7 CFTR allele.

Except for R1070W in exon 17b (four out of 47 = 8.5%) and L375F in exon 8 (two out of 47 = 4.25%), all the other mutations (11 out of 47 = 23.4%) were found only once. In total, {Delta}F508, T5 allele, R117H, R1070W and L375F represent 83% of the mutation types in our cohort. The mild mutation 3849 + 10 kb C->T was not found in any patient.

Three novel mutations were identified: 2789+2insA, L1227S and 4428insGA. The three men with CUAVD were compound heterozygotes (G542X/R1070W, {Delta}F508/R117H, L375F/G551D).

Among the seven men with obstructive azoospermia without CBAVD, four were mutation positive: three men were compound heterozygotes ({Delta}F508/2789+2insA, {Delta}F508/4428insGA, {Delta}F508/T5), one man had one mutation (T5/–) and in three men, no mutation was found.

The genotypes are commonly classified into five groups, according to whether or not the mutation includes the T5 allele (Table IIGo) (Costes et al., 1995Go; Bienvenu et al., 1997Go). Two mutations were found in 31.9% of patients, 31.9% had one mutation and the T5 allele, 10.7% had only one mutation and 25.5% had no mutation in the CFTR coding and flanking regions.


View this table:
[in this window]
[in a new window]
 
Table II. Cystic fibrosis transmembrane conductance regulator (CFTR) gene screening in 47 men with anomalies of the vas deferens
 
Discussion

Three out of 65 mutations found in 47 men with obstructive azoospermia were novel mutations.

2789+2insA
A one nucleotide insertion in intron 14b splice donor site, was found with {Delta}F508 in a patient (no. 42) who presented obstructive azoospermia with hypoplastic vas deferens diagnosed on clinical palpation. This 23-year-old man had a borderline sweat test (60 mEq/l) and sinusitis. Since the other chromosome of this patient carries a severe mutation ({Delta}F508), the 2789+2insA may be considered as a mild allele contributing to development of this phenotype.

L1227S
An exon 19 missense mutation in NBD2, was found with 3272–26A->G in a CBAVD phenotype (no. 2) which had been surgically explored. In addition to the absence of the vas deferens, the epididymal caput was dilated, and the corpus and cauda were atrophic. This 31-year-old man had normal sweat test (40 mEq/l). Amino acid sequences alignments of CFTR exon 19 in humans, rhesus monkey, sheep, mouse, European rabbit, cow, killifish, and African clawed frog (Xenopus laevis) were performed (data not shown). Evolutionary conservation of the leucine residue at this position suggests that its substitution may not be without a consequence for the CFTR function. Based on pancreas sufficiency, late age at diagnosis and mild-to-moderate pulmonary disease, it was concluded that 3272–26A->G/{Delta}F508 patients have mild CF disease (Beck et al., 1999Go). Since L1227S was associated with the 3272–26A->G mild mutation, it is difficult to judge the severity of this novel mutation with regard to its role in the CBAVD phenotype.

4428insGA
A two-nucleotide insertion in exon 24 was found along with {Delta}F508. This 25-year-old man (no. 43) with obstructive azoospermia who underwent surgical exploration had two hypoplastic vas deferens and bilateral aplasia of the epididymal cauda. In addition, he had an elevated sweat test (80 mEq/l) and sinusitis. This mutation creates a stop codon 43 nucleotides downstream leading to the deletion of 33 C-terminus amino acids of the CFTR protein including the TRL-COOH domain. This highly conserved proteic site is a perfect match for the binding consensus domain of the Na+-H+ exchanger regulatory factor (NHE-RF), a cytoplasmic phosphoprotein that may play an important regulatory role in CFTR function (Wang et al., 1998Go). Other authors (Mickle et al., 1998Go; Moyer et al., 1999Go) have demonstrated that a nonsense S1455X mutation in exon 24 encoded a truncated version of the CFTR protein which missed the last 26 amino acids and mispolarized to the lateral membrane of epithelia. The child and mother bearing the del14a/S1455X genotype were clinically well but had consistently elevated sweat chloride concentrations (74 mmol/l). Both had normal pulmonary function, normal sputum flora and no manifestations of exocrine pancreatic disease. The 4428insGA may, therefore, be considered as a mild allele responsible for elevated sweat test and obstructive azoospermia.

These three novel mutations have not been found in more than 200 non-CF chromosomes and in a sample of 300 CF chromosomes from local classical CF patients, nor were they reported by any other member of the CF Genetic Analysis Consortium. Under these circumstances, polymorphisms could be ruled out.

A rare missense mutation, L375F, first described elsewhere (Jézéquel et al., 1996Go) and located in exon 8 which codes for a cytoplasmic region between the m6 transmembrane domain and NBD1, was found twice, once associated with G551D in a CUAVD phenotype (no. 40) surgically explored and once with R117H in a CBAVD phenotype (no. 25) clinically diagnosed in a 30-year-old man with a normal sweat test (17 mEq/l) and asthma. Analysis of DNA from the CUAVD patients' parents has shown that the two mutations were located on different chromosomes. Subsequently, this mutation was found in a German family in which two brothers were ascertained as having CBAVD with the {Delta}F508/L375F CFTR genotype (Dörk et al., 1997Go).

Men with CAVD can undergo microsurgical epididymal sperm aspiration (MESA) followed by IVF with or without intracytoplasmic sperm injection (ICSI). This method can be credited with a high rate of pregnancy. The offspring of the patients must be regarded as being at increased risk for CF. The female partner of a man with CFTR-mediated anomalies of the genital tract may be heterozygous purely by chance (4–5% in many countries). Consequently, she should be advised to submit to DNA analysis and to seek genetic counselling to reduce the risk. In addition, the diagnosis of CAVD with a mutated CFTR genotype should alert the clinician as to the possibility of CF mutations in close relatives, for whom the risk of having a child presenting a pathological CFTR-mediated phenotype is higher than for the general population.

Acknowledgments

We are grateful to J.C.Chuat for revision of our manuscript.

Notes

5 To whom correspondence should be addressed at: Laboratoire de Génétique Moléculaire et Hormonologie, et UPR 41 CNRS, CHU Pontchaillou, F-35033 Rennes cedex, France. E-mail: christele.dubourg{at}chu-rennes.fr Back

References

Anguiano, A., Oates, R.D., Amos, J.A. et al. (1992) Congenital bilateral absence of the vas deferens. A primarily genital form of cystic fibrosis. J. Am. Med. Assoc., 267, 1794–1797.[Abstract]

Beck, S., Penque, D., Garcia, S. et al. (1999) Cystic fibrosis patients with the 3272–26A->G mutation have mild disease, leaky alternative mRNA splicing, and CFTR protein at the cell membrane. Hum. Mutat., 14, 133–144.[ISI][Medline]

Bienvenu, T., Cazeneuve, C., Kaplan, J.C. et al. (1995) Mutation heterogeneity of cystic fibrosis in France: screening by denaturing gradient gel electrophoresis using psoralen-modified oligonucleotide. Hum. Mutat., 6, 23–29.[ISI][Medline]

Bienvenu, T., Adjiman, M., Thiounn, N. et al. (1997) Molecular diagnosis of congenital bilateral absence of the vas deferens: analyses of the CFTR gene in 64 French patients. Ann. Génét., 40, 5–9.

Cheng, S.H., Rich, D.P., Marshall, J. et al. (1991) Phosphorylation in the R domain by cAMP-dependent protein kinase regulates the CFTR chloride channel. Cell, 66, 1027–1036.[ISI][Medline]

Chillon, M., Casals, T., Mercier, B. et al. (1995) Mutations in the cystic fibrosis gene in patients with congenital absence of the vas deferens. N. Engl J. Med., 332, 1475–1480.[Abstract/Free Full Text]

Costes, B., Girodon, E., Ghanem, N. et al. (1995) Frequent occurrence of the CFTR intron 8 (TG)n 5T allele in men with congenital bilateral absence of the vas deferens. Eur. J. Hum. Genet., 3, 285–293.[ISI][Medline]

Cuppens, H., Lin, W., Jaspers, M. et al. (1998) Polyvariant mutant cystic fibrosis transmembrane conductance regulator genes. The polymorphic (TG)m locus explains the partial penetrance of the T5 polymorphism as a disease mutation. J. Clin. Invest., 101, 487–496.[ISI][Medline]

Di Sant'Agnese, P.A. (1968) Fertility and the young adult with cystic fibrosis. N. Engl. J. Med., 279, 103–105.

Dörk, T., Dworniczak, B., Auleha-Scholz, C. et al. (1997) Distinct spectrum of CFTR gene mutations in congenital absence of vas deferens. Hum. Genet., 100, 365–377.[ISI][Medline]

Dumur, V., Gervais, R., Rigot, J.M. et al. (1990) Abnormal distribution of {Delta}F508 allele in azoospermic men with congenital aplasia of the epididymis and vas deferens. Lancet, 336, 512.[ISI][Medline]

Fanen, P., Ghanem, N., Vidaud, M. et al. (1992) Molecular characterization of cystic fibrosis: 16 novel mutations identified by analysis of the whole cystic fibrosis transmembrane conductance regulator (CFTR) coding regions and splice site junctions. Genomics, 13, 770–776.[ISI][Medline]

Friedman, K.J., Highsmith, W.E. and Silverman, L.M. (1991) Detecting multiple cystic fibrosis mutations by polymerase chain reaction-mediated site-directed mutagenesis. Clin. Chem., 37, 753–755.[Abstract/Free Full Text]

Gaillard, D.A., Carre-Pigeon, F. and Lallemand, A. (1997) Normal vas deferens in fetuses with cystic fibrosis. J. Urol., 158, 1549–1552.[ISI][Medline]

Hall, S.K., Stableforth, D.E. and Green, A. (1990) Sweat sodium and chloride concentrations-essential criteria for the diagnosis of cystic fibrosis in adults. Ann. Clin. Biochem., 7, 318–320.

Highsmith, W.E., Burch, L.H., Zhou, Z. et al. (1994) A novel mutation in the cystic fibrosis gene in patients with pulmonary disease but normal sweat chloride concentrations. N. Engl. J. Med., 331, 974–980.[Abstract/Free Full Text]

Holsclaw, D.S., Perlmutter, A.D., Jockin, H. et al. (1971) Genital abnormalities in male patients with cystic fibrosis. J. Urol., 106, 568–574.[ISI][Medline]

Jarvi, K., Zielenski, J., Wilschanski, M. et al. (1995) Cystic fibrosis transmembrane conductance regulator and obstructive azoospermia. Lancet, 345, 1578.[ISI][Medline]

Jequier, A.M., Ansell, I.D. and Bullmore, N.J. (1985) Congenital absence of the vasa deferencia presenting with infertility. J. Androl., 6, 15–19.[Abstract/Free Full Text]

Jézéquel, P., Dorval, I., Fergelot, P. et al. (1995) Structural analysis of CFTR gene in congenital bilateral absence of vas deferens. Clin. Chem., 41/6, 833–835.[Abstract/Free Full Text]

Jézéquel, P., Chauvel, B., Le Treut, A. et al. (1996) Identification of a novel mutation in CFTR gene exon 8 (L375F) in a CUAVD phenotype. Hum. Genet., 97, 548–549.[ISI][Medline]

Kanavakis, E., Tzetis, M., Antoniadi, T. et al. (1998) Cystic fibrosis mutation screening in CBAVD patients and men with obstructive azoospermia or severe oligospermia. Mol. Hum. Reprod., 4, 333–337.[Abstract/Free Full Text]

Kaplan, E., Schwachman, H., Perlmuter, A.D. et al. (1968) Reproductive failure in males with cystic fibrosis. N. Engl. J. Med., 279, 65–69.

Kiesewetter, S., Macek, M., Davis, C. et al. (1993) A mutation in CFTR produces different phenotypes depending on chromosomal background. Nature Genet., 5, 274–278.[ISI][Medline]

Landing, B.H., Wells, T.R. and Wang, C.I. (1969) Abnormality of epididymis and vas deferens in cystic fibrosis. Arch. Pathol., 88, 569–580.[ISI][Medline]

Lerman, L.S. and Silverstein, K. (1987) Computational simulation of DNA melting and its application to denaturing gradient gel electrophoresis. Methods Enzymol., 155, 482–501.[ISI][Medline]

Meschede, D., Eigel, A., Horst, J. et al. (1993) Compound heterozygosity for the {Delta}F508 and F508C cystic fibrosis transmembrane conductance regulator (CFTR) mutations in a patient with congenital bilateral aplasia of the vas deferens. Am. J. Hum. Genet., 53, 292–293.[ISI][Medline]

Meschede, D., Dworniczak, B., Behre, H.M. et al. (1995) CFTR gene mutations in men with bilateral ejaculatory-duct obstruction and anomalies of the seminal vesicles. Am. J. Hum. Genet., 61, 1200–1202.

Mickle, J.E., Macek Jr, M., Fumer-Smentek, S.B. et al. (1998) A mutation in the cystic fibrosis transmembrane conductance regulator gene associated with elevated sweat chloride concentrations in the absence of cystic fibrosis. Hum. Mol. Genet., 7, 729–735.[Abstract/Free Full Text]

Moyer, B.D., Denton, J., Karlson, K.H. et al. (1999) A PDZ-interacting domain in CFTR is an apical membrane polarization signal. J. Clin. Invest., 104, 1353–1361.[ISI][Medline]

Myers, R.M., Fisher, S.G., Lerman, L.S. et al. (1985) Nearly all single base substitution in DNA fragments joined to a GC clamp can be detected by denaturing gradient gel electrophoresis. Nucleic Acids Res., 13, 3131–3145.[Abstract/Free Full Text]

Patrizio, P., Asch, R.H., Handelin, B. et al. (1993) Aetiology of congenital absence of vas deferens: genetic study of three generations. Hum. Reprod., 8, 215–220.[Abstract/Free Full Text]

Rave-Harel, N., Kerem, E., Nissim-Rafinia, M. et al. (1997) The molecular basis of partial penetrance of splicing mutations in cystic fibrosis. Am. J. Hum. Genet., 60, 87–94.[ISI][Medline]

Riordan, J.R., Rommens, J.M., Kerem, B.S. et al. (1989) Identification of the cystic fibrosis gene: cloning and characterization of complementary DNA. Science, 245, 1066–1073.[Abstract/Free Full Text]

Rommens, J.M., Kerem, B.S., Greer, W. et al. (1990) Rapid nonradioactive detection of the major cystic fibrosis mutation. Am. J. Hum. Genet., 46, 395–396.[ISI][Medline]

Sheffield, V.C., Cox, D.R., Lerman, L.S. et al. (1989) Attachment of a 40-base pair G+C rich sequence (GC clamp) to genomic DNA fragments by the polymerase chain reaction results in improved detection of single base changes. Proc. Natl Acad. Sci. USA, 86, 232–236.[Abstract/Free Full Text]

Van der Ven, K., Messer, L., Van der Ven, H. et al. (1996) Cystic fibrosis mutation screening in healthy men with reduced sperm quality. Hum. Reprod., 11, 513–517.

Wang, S., Raab, R.W., Shatz, P.J. et al. (1998) Peptide binding consensus of the NHE-RF-PDZ1 domain matches the C-terminal sequence of cystic fibrosis transmembrane conductance regulator (CFTR). FEBS Lett., 427, 103–108.[ISI][Medline]

Zielenski, J., Patrizio, P., Corey, M. et al. (1995) CFTR gene variant for patients with congenital absence of vas deferens. Am. J. Hum. Genet., 57, 958–960.[ISI][Medline]

Submitted on June 23, 2000; accepted on September 6, 2000.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
PediatricsHome page
V. Scotet, M.-P. Audrezet, M. Roussey, G. Rault, A. Dirou-Prigent, H. Journel, V. Moisan-Petit, V. Storni, and C. Ferec
Immunoreactive Trypsin/DNA Newborn Screening for Cystic Fibrosis: Should the R117H Variant Be Included in CFTR Mutation Panels?
Pediatrics, November 1, 2006; 118(5): e1523 - e1529.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
R. Radpour, M. A. S. Gilani, H. Gourabi, A. V. Dizaj, and S. Mollamohamadi
Molecular analysis of the IVS8-T splice variant 5T and M470V exon 10 missense polymorphism in Iranian males with congenital bilateral absence of the vas deferens
Mol. Hum. Reprod., July 1, 2006; 12(7): 469 - 473.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
L.-S. Chou, F. Gedge, and E. Lyon
Complete Gene Scanning by Temperature Gradient Capillary Electrophoresis Using the Cystic Fibrosis Transmembrane Conductance Regulator Gene as a Model
J. Mol. Diagn., February 1, 2005; 7(1): 111 - 120.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
A. Grangeia, F. Niel, F. Carvalho, S. Fernandes, A. Ardalan, E. Girodon, J. Silva, L. Ferras, M. Sousa, and A. Barros
Characterization of cystic fibrosis conductance transmembrane regulator gene mutations and IVS8 poly(T) variants in Portuguese patients with congenital absence of the vas deferens
Hum. Reprod., November 1, 2004; 19(11): 2502 - 2508.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
V. van Heyningen and P. L. Yeyati
Mechanisms of non-Mendelian inheritance in genetic disease
Hum. Mol. Genet., October 1, 2004; 13(suppl_2): R225 - R233.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (9)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Jézéquel, P.
Right arrow Articles by David, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jézéquel, P.
Right arrow Articles by David, V.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?