Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (35)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Goodwin, L. O.
Right arrow Articles by Benoff, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Goodwin, L. O.
Right arrow Articles by Benoff, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Human Reproduction, Vol. 6, No. 2, 127-136, February 2000
© 2000 European Society of Human Reproduction and Embryology


Endocrinology

L-type voltage-dependent calcium channel {alpha}-1C subunit mRNA is present in ejaculated human spermatozoa*

Leslie O. Goodwin1,5, David S. Karabinus2, Robert G. Pergolizzi1 and Susan Benoff3,4

1 Division of Molecular Genetics, Department of Research, North Shore University Hospital-New York University School of Medicine, 300 Community Drive, Manhasset, New York 11030, 2 Department of Obstetrics and Gynecology, The University of Arizona, Tucson, Arizona, 3 Division of Human Reproduction, Department of Obstetrics and Gynecology, North Shore University Hospital-New York University School of Medicine, Manhasset, New York, and 4 Departments of Obstetrics and Gynecology and Cell Biology, New York University, School of Medicine, New York, New York, USA

Abstract

The current study adds to the growing body of evidence that RNA is present in mature ejaculated human spermatozoa. We report that a sodium dodecyl sulphate (SDS)/citric acid extraction method is superior to guanidinium isothiocyanate in terms of reproducibility of RNA recovery from motile sperm populations from individual ejaculates. Using the SDS/citric acid method, RNA was recovered from both fresh and frozen–thawed motile spermatozoa. Sperm RNA were used as templates in reverse transcription–polymerase chain reaction (RT–PCR), in an attempt to identify partial RNA transcripts of a highly conserved region within the {alpha}-1C (pore-forming) subunit of L-type voltage-dependent calcium channels from 11 individual donors. Control reactions employed primers derived from the human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) sequence. In nine of the 11 specimens, gene-specific PCR products were obtained with both the GAPDH and {alpha}-1C primer pairs. DNA sequencing analysis confirmed that the respective spliced transcripts were amplified. The two cases in which no amplification was obtained were attributed to reduced RNA yield. These data are consistent with results from in-situ RTPCR of rat testis sections indicating that the testis-specific calcium channel of that species was expressed uniformly in all stages of the germinal epithelium, including mature spermatozoa.

calcium channels/RNA/RT–PCR/spermatozoa

Introduction

In all, 2–15% of couples experience difficulty in conceiving (Vassen, 1984Go; Mosher, 1985Go). In couples seeking treatment by in-vitro fertilization (IVF), a male factor contributes to the majority of cases assigned to intracytoplasmic sperm injection (ICSI) (Palermo et al., 1995Go) and to >15% of the cases assigned to conventional IVF protocols (SART, 1998). Many subfertile men have insufficient sperm production and want to know the cause of their decreased spermatogenic potential. This and the fact that reports have appeared suggesting that sperm counts, and thus human male fertility potential, may be declining (Carlsen et al., 1992Go; Auger et al., 1995Go; Adamopoulos et al., 1996Go; Becker and Berhane, 1997Go) has spurred renewed interest in the mechanisms regulating spermatogenesis. Remarkable progress has been made in the last few years in the identification of multi-gene families responsible for normal meiotic progression and spermatid differentiation (Cooke et al., 1998Go). This information has been useful in clinical practice in defining the aetiology of some cases of infertility presenting with oligozoospermia or azoospermia (Pryor et al., 1997Go) and in counselling these patients prior to an attempt at assisted reproduction (Johnson, 1998Go).

Unfortunately, although diagnosis and treatment of male infertility is largely based on semen analysis, a significant fraction of subfertile men have normal semen parameters. In many cases, the reduced fertility of these men with idiopathic or `unexplained' infertility can now be attributed to molecular defects in sperm function (e.g. >50% exhibit an acrosome reaction insufficiency; Benoff et al., 1999). While the comparison of spermatozoa from fertile and infertile men has proved useful in some cases, knowledge concerning expression and regulation of genes involved in sperm function post-ejaculation has been derived mainly from animal models (Eddy and O'Brien, 1998Go). Testicular material from animals has been used to produce cDNA libraries and in Northern blot analyses allowing identification of structural genes which participate in the various aspects of sperm–egg interactions. The construction of knock-out targeted mutations, which is possible only in laboratory animals, has helped separate proteins whose functions may be non-essential (Baba et al., 1994Go) from those whose absence results in infertility without affecting semen parameters (Krege et al., 1995Go; Esther et al., 1996Go).

Given the current concerns over the costs of infertility treatment (Van Voorhis et al., 1998Go), new diagnostic technologies are clearly needed and are predicted to increasingly draw upon molecular methodologies (Barratt and St. John, 1998Go). Non-invasive methodologies have been devised which use analysis of ejaculated spermatozoa. For example, fluorescence in-situ hybridization (FISH) to sperm nuclei has been used to evaluate structural and numerical chromosomal anomalies (Egozcue et al., 1997Go), allowing identification of semen samples which may be unsuitable even for ICSI (Weissenberg et al., 1998Go). Polymerase chain reaction (PCR) technology (Saiki et al., 1985Go; Mullis and Faloona, 1987Go) has permitted examination of genetic linkage and specific gene mutations in a single spermatozoon (Li et al., 1988Go; Cui et al., 1989Go). Unfortunately, these techniques cannot currently be employed to identify sperm function defects arising from reduced gene expression. Such defects can conveniently be identified by semi-quantitative analysis of mRNA values or by monitoring expression of alternatively processed messages by Northern blotting. In this regard, it is important to note that many germ cell-specific transcripts arise from alternative splicing of RNA transcripts from genes that are also expressed in somatic cells (Means et al., 1991Go; Bolger et al., 1996Go; Walensky et al., 1998Go). Some of the Y chromosome-linked genes implicated in male infertility are postulated to be involved in regulation of RNA splicing (Cooke et al., 1998Go). As mature spermatozoa have been considered to be transcriptionally inert (Kierszenbaum and Tres, 1975Go), until recently such events could only be addressed in man following testicular biopsy.

However, relatively early observations in the literature suggested that human spermatozoa contained some ribonuclease (RNase)-sensitive material (Witkin et al., 1975Go). More recent results by in-situ hybridization, which can identify relatively abundant RNA species, suggested transcripts encoding genes expressed exclusively by haploid germ cells persist in ejaculated human spermatozoa (Pessot et al, 1989Go; Kumar et al., 1993Go; Wykes et al., 1997Go). The advent of PCR has made examination of spermatogenic-specific gene expression possible and has allowed the further identification of rare transcripts following reverse transcription of sperm mRNA into cDNA (RT–PCR), such as those for the proto-oncogene c-myc (Kumar et al., 1993Go), human leukocyte antigen class I (Chiang et al., 1994Go), protamines PRM-1 and PRM-2 (Miller et al., 1994Go), ß1 integrin (Rohwedder et al., 1996Go) and cyclic nucleotide phosphodiesterase subtypes (Richter et al., 1999Go). In this paper, we report a method for the reproducible isolation of RNA from ejaculated human spermatozoa from individual donors. We use this method to examine the expression of the {alpha}-1C subunit of the L-type voltage-dependent calcium channel (VDCC), an alternatively spliced gene product (Goodwin et al., 1997Go, 1998aGo,bGo, 1999aGo,bGo) essential for the human sperm acrosome reaction (Benoff, 1998aGo, 1999Go).

Materials and methods

Products and reagents
All PCR reagents were purchased from Perkin-Elmer (Foster City, CA, USA). All other enzymes were obtained from New England Biolabs (Beverly, MA, USA). Unless otherwise stated, all other reagents were purchased from Sigma Chemical Co (St Louis, MO, USA).

Human semen specimens
All protocols employing human subjects were reviewed and approved by The University of Arizona Health Sciences Center Human Subjects Committee.

Semen analysis
Semen specimens from number coded fertile donors were collected by masturbation and allowed to liquefy for up to 1 h after collection. Semen quality was then evaluated using a computer-assisted semen analysis (CASA) system (Motion Analysis, Santa Rosa, CA, USA) as previously described (Gonzalez-Estrella et al., 1994Go). Smears prepared from raw semen were air-dried, stained with Stat III Andrology Stain (Mid-Atlantic Diagnostics Inc, Medford, NJ, USA), and evaluated for the incidence of immature forms (as indicated by the presence of residual cytoplasm in the sperm head–neck region; Figure 1Go).



View larger version (100K):
[in this window]
[in a new window]
 
Figure 1. Microscopic examination of raw semen. (A) Normal sperm morphology; (B) poor sperm morphology. The numbers in the figure indicate spermatozoa with: (1) normal oval head; (2) small heads; (3) a tapered head; and (4) with a small acrosome. Scale bars = 3.6 µm.

 
Only specimens with the following characteristics were used in these studies: >50x106 spermatozoa/ml, >50% motility, and >10% normal forms, as determined by morphological evaluation using strict criteria (Kruger et al., 1988Go). Raw semen specimens were divided into two parts: one for RNA extraction from fresh spermatozoa, the other for RNA extraction from cryopreserved spermatozoa.

Cryopreservation of raw semen
Spermatozoa were cryopreserved after diluting raw semen with an equal volume of TEST Yolk buffer (TYB; Irvine Scientific, Santa Ana, CA, USA) and allowing diluted semen to equilibrate 15 min at room temperature. After packaging diluted semen in cryostraws (IMV, l'Aigle, France), semen was cooled for 90 min at 40°C, suspended in liquid nitrogen vapour for 15 min, and then plunged into liquid nitrogen for storage. Post-thaw motility in specimens preserved by this protocol typically averaged 65.5 ± 0.7% (n = 2).

Semen preparation for RNA extraction
Motile sperm populations were recovered from fresh semen by swim-up and from frozen semen by Percoll density gradient centrifugation following previously published protocols (Karabinus and Gelety, 1997Go). Highly motile populations were routinely obtained: 99.0 ± 3.9% after swim-up (n = 5) and 86.5 ± 0.8% (n = 2) following Percoll density gradient centrifugation.

Isolation of RNA from human spermatozoa
RNA in motile sperm populations was extracted in the presence of guanidinium isothiocyanate (Chirgwin et al., 1979Go). Alternatively, sperm RNA was extracted using reagents from a Purescript RNA isolation kit (Gentra Systems Inc, Minneapolis, MN, USA) and a protocol modified from that supplied by the manufacturer in that after addition of the `Cell Lysis' solution, dithiothreitol (DTT) was added to a final concentration of 40 mmol/l and the mixture was incubated for 4 h at 55°C prior to addition of the `Protein–DNA Precipitation' solution. This improved the overall yield of RNA.

Human testis polyA+ RNA
Human testis polyA+ RNA was purchased from Clontech (Palo Alto, CA, USA). The RNA was purified using guanidinium isothiocyanate (Chomczski and Sacchi, 1987) and oligo(dT)-cellulose columns (Sambrook et al., 1989Go). The preparation used was obtained from a pool composed of testis tissue from 20 men, aged 6 months to 70 years, and was checked for integrity on a denaturing agarose gel (Sambrook et al., 1989Go).

PCR primers
Oligonucleotide primers were synthesized on a Model 394 DNA Synthesizer (Applied Biosystems, Foster City, CA, USA). Sets of forward (F) and reverse (R) primers were designed to detect a highly conserved region (HUCH 7F and HUCH 7R) or an alternatively spliced region (pRACH 3908F and pRACH 4777R; Goodwin et al., 1998a) in the L-type VDCC {alpha}-1C subunit (Soldatov, 1994Go), to amplify exons 4 and 5 of ß-actin (A4F and A5R), to identify transcripts directing the synthesis of human glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Tso et al., 1985) (HG690F and HG984R), and to amplify the origin of replication of Escherichia coli DNA (ORIF and ORIR). The 10 oligonucleotide primers synthesized were as follows:

HUCH 7F 5'GCCCTATGTGGCCCTCCTGATCGTGAT

HUCH 7R 5'CTTGTCCAGCTCCTCCTCAGCGGTGAGA

pRACH 3908F 5'GTGGTACGTGGTCAACTCCACCTACT

pRACH 4777R 5'CAGATTCTCTTGAATTCAATCCAGGTGA

A4F 5'ATGTACGTTGCTATCCAGGCT

A5R 5'TGCCAGGGCAGTGATCTCCTT

HG690F 5'GGTCATCCCTGAGCTGAACG

HG984R 5'TCCGTTGTCATACCAGGAAAT

ORIF 5'CGAGATTACAAAGTTACCTG

ORIR 5'CGTTAGCCCACCCAGCAAAA

Reverse transcription (RT) in-situ hybridization
Rat testis frozen sections (5 µm) were mounted on in-situ PCR glass slides (Perkin-Elmer). The pRACH 3908F/pRACH 4777R primer pair in conjunction with an EZ rTth RNA PCR kit (Perkin-Elmer) and digoxigenin dUTP (Boehringer-Mannheim, Indianapolis, IN, USA) was used to amplify L-type VDCC {alpha}-1C RNA sequences in these testis sections in a Gene Amp in situ PCR System 1000 (Perkin-Elmer) following protocols established in the laboratory (Goodwin et al., 1998aGo). Negative controls were performed with E.coli primers and with tissue sections that had not been pre-digested with protease. Actin primers were used in parallel positive control reactions. PCR products were detected using alkaline-phosphatase-coupled anti-digoxigenin antibody (Boehringer Mannheim) as previously described (Goodwin et al., 1998aGo). Slides were counterstained with Fast Nuclear Red and mounted with Permount (Fisher Scientific, Pittsburgh, PA, USA), examined at x600 magnification with an Olympus microscope (Olympus Corporation, Lake Success, NY, USA) and photographed using Ektachrome Elite film for colour microscopy (Eastman Kodak Co, Rochester, NY, USA) with automatic exposure control.

Conditions for RT–PCR, cloning of PCR products and DNA sequence analysis
First strand cDNA was synthesized using a Reverse Transcription System kit (Promega, Madison, WI, USA) and converted to double stranded cDNA and amplified using gene-specific primers (Goodwin et al., 1997Go, 1998aGo, 1999aGo). A two-step amplification was employed for the primer pair HUCH 7F/HUCH 7R (94°C for 30 s/72°C for 1 min; 45 cycles) while amplification with GAPDH-specific primers required three steps (94°C for 30s/58°C for 30s/72°C for 1min; 35 cycles). The size of the PCR products was estimated by co-electrophoresis of 20 µl of the completed PCR reaction and 500 ng of molecular weight size standards (1 kb DNA ladder, Cat. no. 5615SB, Gibco-BRL, Grand Island, NY, USA) on a 1.2% agarose gel. Size separated nucleic acids were visualized following ethidium bromide staining and photographed using a Gel Doc 1000 video camera (Bio-Rad Laboratories, Hercules, CA, USA). The default setting for exposure of the photographic image was 0.1 min. Where necessary the photographic image was `amplified' or intensified by increasing the exposure time. The PCR products were gel purified using Wizard PCR Preps (Promega), and were directly sequenced using automated DNA Sequencing System Model 373A (Applied Biosystems) following manufacturer's protocols for fluorescence-based DNA sequencing with Taq polymerase.

Statistical analysis
All statistical analyses were performed using the SAS/PC software package (SAS Institute Inc, Cary, NC, USA). P < 0.05 was considered to be statistically significant. Values are given as means ± SD.

Results

In-situ RT–PCR
In-situ RT–PCR was employed to examine the distribution of gene-specific transcripts in rat testis. Primers to amplify ß-actin sequences were used as a positive control as these transcripts are constitutively expressed in most somatic cells (Innis et al., 1990Go). PCR products resulting from these primers, which were identified by a precipitate formed by reaction of alkaline phosphatase-conjugated anti-digoxigenin antibody and 4-Nitro Blue Tetrazolium/5-bromo-4-chloro-3-indolyl-phosphate substrate, were observed in both the interstitial spaces and in the germinal epithelium (not shown). The amount of actin mRNA differed at several different stages of spermatogenesis and spermiogenesis. Within the seminiferous tubules, abundant PCR products were detected in the spermatogonia. The amount of PCR product decreased as differentiation progressed. No staining was detected in mature spermatozoa released in the lumen of the tubules.

In contrast, PCR products produced using primers specific for L-type VDCC {alpha}-1C were equally abundant in all cells of the germinal epithelium, including Sertoli cells. PCR products were also associated with the heads of mature testicular spermatozoa (Figure 2Go). The latter was clearly not an artefact of the preparation of testis sections or choice of sections examined; the size and shape of the precipitate differed between less mature spermatozoa and germinal cells in the epithelium. No precipitate was observed in the interstitial spaces or in the negative controls, either when using E.coli primers or when pepsin pre-digestion of the tissue section was omitted (Figure 2Go inset).



View larger version (180K):
[in this window]
[in a new window]
 
Figure 2. Rat testis showing results of in-situ reverse transcription polymerase chain reaction (RT–PCR) amplification of L-type voltage-dependent calcium channel (VDCC) {alpha}-1C subunit transcripts in mature spermatozoa. Main figure shows a high power view of a rat testis section digested with pepsin prior to in-situ RT–PCR with the pRACH 3908F/4777R primer pair. A dark blue precipitate is observed in regions where alkaline phosphatase-conjugated anti-digoxigenin antibody is bound to digoxigenin dUTP incorporated in the PCR product. Solid arrow = PCR products identified in and around sperm heads. Open arrow = PCR products detected in the cytoplasm of cells within the germinal epithelium. Scale bar = 10 µm. Inset shows low power view of a negative control rat testis serial section not protease pre-digested. In-situ RTPCR with the pRACH 3908F/4777R primer pair failed to amplify L-VDCC {alpha}-1C-specific products, as indicated by the complete lack of detectable blue precipitate. Tissue histology may be discerned from the Fast Nuclear Red counterstain. Scale bar = 2.5 µm.

 
The primers employed were designed to amplify nucleotides 3098–4777 of the rat cardiac {alpha}-1C sequence (Koch et al., 1989, 1990; Accession Nos. M59786 and M34365). Comparison with the genomic sequence of the human {alpha}-1C gene (Soldatov, 1994Go), the only {alpha}-1 genomic sequence to be reported to date, indicated that this region encompasses exons 28–37 and ~17 kb of DNA including the intronic sequences. As it is extremely difficult to co-amplify exons that are separated by >10 kb of sequence (Snutch et al., 1991Go), it is highly unlikely that the {alpha}-1C-specific PCR products in the germinal epithelium and in mature testicular spermatozoa were derived from genomic DNA as template. Rather, these data provide strong evidence that processed {alpha}-1C RNA transcripts persist in mature spermatozoa.

Microscopic examination of semen
To pursue these observations microscopic examination of semen was used to identify populations to be used for RNA extraction. Stained smears of whole semen were viewed at x1000 and photographed on 35 mm/100 ASA black and white film (TMAX, Eastman Kodak) with an automatic exposure setting. Figure 1AGo shows an example of normal semen morphology. The majority of spermatozoa in this field exhibited normal morphology. There is no evidence of cytoplasmic droplets or other abnormalities. The specimen shown is typical of those employed in the search for L-type VDCC {alpha}-1C subunit transcripts. The raw specimens chosen typically had the following characteristics (n = 5: concentration = 129.0 ± 41.5x106 spermatozoa/ml; motility = 78.4 ± 12.2%; and morphology = 16.6 ± 1.4% normal forms, 5.5 ± 1.8% amorphous heads, and 4.4 ± 2.2% immature spermatozoa, e.g. with residual cytoplasm). Therefore, we do not think that presence of contaminating cells in the ejaculate confuse or complicate our findings.

Figure 1BGo shows an example with poor morphology. The numbers in the figure indicate spermatozoa with: (1) normal oval head; (2) small heads; (3) a tapered head; and (4) with a small acrosome. Abnormalities in the sperm head–neck region are also visible. This specimen and others with similar characteristics were discarded. The raw semen excluded from the current study typically had the following characteristics (n = 5: concentration = 76.2 ± 64.4x106 spermatozoa/ml; motility = 29.4 ± 6.3%; and morphology = 4.8 ± 2.4% normal forms, 8.4 ± 4.0% amorphous heads, and 28.4 ± 7.0% spermatozoa with residual cytoplasm). The sperm concentration and the percentages of spermatozoa with amorphous heads were similar in specimens included in this study and those excluded (respectively, P = 0.162 and P = 0.182, not significant). Nevertheless, these specimens could be differentiated on the basis of motility (P < 0.0001), percentages of normal forms (P < 0.0001) and percentages of immature spermatozoa (P < 0.0001).

Isolation of RNA from ejaculated human spermatozoa
Two methods for RNA extraction were compared. A motile sperm population was prepared from frozen semen from a single fertile donor and yielded 3.4x107 cells. An attempt was made to isolate RNA from one half of this specimen by a classical method employing guanidinium isothiocyanate (Chirgwin et al., 1979Go). The other half was extracted using reagents from a commercially-available RNA isolation kit (Purescript, Gentra Systems Inc.) and a protocol modified from that supplied by the manufacturer (see Materials and methods).

Ejaculated human spermatozoa are reported to contain 0.07 pg of RNA per spermatozoon (Pessot et al., 1989Go). Therefore, the maximum expected yield of RNA from the fertile donor was 1.19 µg, an amount too low for accurate measurement by UV absorbance at 260 nm. To estimate the actual amount of RNA isolated by each protocol, the final precipitates were resuspended in 5 µl sterile water, electrophoresed through a 1.2% agarose gel containing ethidium bromide. When the ethidium bromide image was photographed at the default 0.1 min exposure time, no staining was detected (not shown). However, when the exposure time for the photographic image was increased to 0.6 min, a smear of ethidium bromide staining was observed in the lane containing the sample isolated using the Purescript kit (Figure 3Go). No ethidium bromide staining was detectable in the lane containing the sample isolated using guanidinium isothiocyanate (Figure 3Go).



View larger version (55K):
[in this window]
[in a new window]
 
Figure 3. Analysis of RNA preparations size separated on a 1.2% agarose gel containing ethidium bromide. MW = molecular weight standards (1 kb ladder) Results from the initial attempt to isolate RNA from motile human spermatozoa are shown. The photographic image was intensified by increasing the exposure time from 0.1–0.6 min. Note the smear of ethidium bromide staining (arrow) in the lane labelled GENTRA, containing the material isolated using the Purescript kit. No ethidium bromide staining is visible in the lane labelled GITC, containing the product of the guanidinium isothiocyanate RNA isolation protocol.

 
To examine the reproducibility of sperm RNA extraction using the Purescript reagents, RNA was isolated from semen samples of 11 different donors. Inclusion/exclusion criteria included motility, percentage of normal forms and percentage of immature spermatozoa. Raw semen chosen for RNA extraction exhibited uniform sperm head size and <7% of spermatozoa with residual cytoplasm (see Figure 1Go). Motile spermatozoa were isolated from these specimens and an aliquot of each, containing 4x107 spermatozoa, was used for isolation of total RNA to control for concentration dependence. The optimal yield of RNA from each of these specimens was 2.8 µg. As above, this amount would not allow an accurate estimate of concentration by ultraviolet absorbance. Therefore, 25% of the material recovered from each of three specimens was subjected to agarose gel electrophoresis. Total RNA from cardiac muscle (1 µg) was included in another lane for the purposes of comparison. When photographed at the default setting of 0.1 min, the RNA from heart appeared as a bright smear with two distinct bands corresponding to 28S and 18S ribosomal RNA while no ethidium bromide staining was detected in the lanes containing RNA from spermatozoa. A smear of ethidium bromide staining was, however, observed in the lanes with sperm RNA when the image was intensified by increasing the exposure time 20-fold (data not shown).

Amplification of GAPDH transcripts in sperm RNA
To confirm that biologically active RNA (e.g. intact) was recovered from human spermatozoa using Purescript reagents, an assay was performed for a ubiquitously expressed transcript, e.g. a `housekeeping' gene such as ß-actin used as control in the in-situ RT–PCR experiments described above.

We were unable to amplify ß-actin transcripts using the actin primers previously employed in in-situ RT–PCR and sperm RNA as template (not shown), confirming prior findings (Chiang et al., 1994Go; Rohwedder et al., 1996Go). This failure to amplify ß-actin transcripts is consistent with our findings with rat testis (described above). In contrast, the protein encoded by sperm-specific GAPDH transcripts does not appear until after completion of meiosis (Welch et al., 1992Go). GAPDH is considered to be another housekeeping gene. Therefore, PCR reactions employing primers for GAPDH were used as positive controls (Piva and Sharpe-Timms, 1999).

The GAPDH primers employed were designed to amplify nucleotides 690–984 of the human GAPDH mRNA sequence (Accession No. M17851). The region is derived from exons 8 and 9 of the human G3PDH gene, which are separated in the genome by a 100 bp intron (Accession No. J04038). Typical results are shown in Figure 4Go.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 4. Transcripts for a housekeeping gene, human glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were detected by polymerase chain reaction (PCR) using gene-specific primers and human sperm (HS) or human testis (HT) cDNA as template. MW = molecular weight standards (1 kb ladder). Open arrow heads indicate the position of the 506/517 bp and the 1636 bp sizing linear double-stranded DNA fragments of the vector DNA in the standard preparation. H2O CONTROL = distilled water control (no added template). HS 1–4 corresponds to specimens also analysed in Figure 5BGo. The solid arrowhead in the figure points to the 294 bp GAPDH-specific PCR product.

 
In nine of the sperm RNA isolates, a robust PCR product of the expected 294 bp was identified following analysis on agarose gels, confirming that the PCR product was derived from a processed transcript template. Ethidium bromide staining of the RNA PCR product from nine different males was similar among those males. However, of the two remaining isolates, one yielded a PCR product of greatly diminished ethidium bromide staining intensity and the other completely failed to yield a PCR product. In the latter, no ethidium bromide staining was detectable, even after the visual image was amplified 20-fold. Repeat analysis of all specimens confirmed the original findings, so these results were not due to a simple PCR reaction failure.

Identification of L-type VDCC {alpha}-1C subunit transcripts in spermatozoa
The L-type VDCC {alpha}-1 subunit protein is comprised of four equivalent domains (I–IV), each of which contains six transmembrane segments (S1–S6), and cytoplasmic amino and carboxy termini (for review, see Benoff, 1998a). The amino terminus and the transmembrane segments which contain dihydropyridine binding sites (e.g. IS6, IIIS2, IVS3) are differentially expressed in various tissues as a result of alternate splicing (Benoff, 1998aGo, 1999Go; Goodwin et al., 1998aGo, 1999aGo). Therefore, in this first attempt to assay for the presence of L-type VDCC {alpha}-1C transcripts in ejaculated human spermatozoa, it was deemed preferable to target a region which is highly conserved among the different {alpha}-1C protein isoforms.

PCR primers HUCH 7F/HUCH 7R were designed to amplify sequences encoding IVS5 and extending into the cytoplasmic tail. As in the studies described above, the primers chosen were designed to span a number of exons (exons 35–43). This design allowed discrimination between PCR products derived from cDNA templates (972 bp) and those resulting from contamination of the specimen with genomic DNA (~15 kb; Soldatov, 1994). When human testis cDNA was used as template, amplification with the HUCH 7F/HUCH 7R primer pair resulted in a single robust PCR product of 972 bp (Figure 5AGo). A less robust PCR product was obtained with human sperm cDNA templates from nine of the men studied. The amount of product obtained was proportional to the amount of human sperm cDNA template added to the reaction mixture (typical results, Figure 5AGo). The relative amount of gene-specific product was estimated from intensity of the band detected by EB staining and was compared with the intensity of the PCR product generated using 2 µl of human testis cDNA (50 ng) as template. Under the conditions employed, a minimum of 5x106 spermatozoa were required for amplification of a VDCC {alpha}-1C-specific product by RT–PCR. No PCR product was obtained with isolates from the two remaining men (not shown). The same isolates yielded, at best, a markedly reduced product with the GAPDH primers (see above). Thus, the failure to detect gene-specific PCR product in these two samples may be attributed to reduced RNA yield.




View larger version (163K):
[in this window]
[in a new window]
 
Figure 5. Polymerase chain reaction (PCR) products from voltage-dependent calcium channel (VDCC) {alpha}-1C-specific primers HUCH 7F and HUCH 7R analysed on 1.2% agarose gels. MW = molecular weight standards. Open arrows indicate the position of the 506/517 bp and the 1636 bp DNA fragments. Solid arrow points to the 972 bp VDCC {alpha}-1C-specific PCR product. HS = PCR products from sperm RNA templates. HT = PCR product obtained when 50 ng of human testis cDNA was employed as template, and CONTROL = distilled water control containing no template. Typical results are shown. (A) First strand cDNA (1–20 µl = 1x106 to 2x107 sperm equivalents) were employed as template in PCR reactions with VDCC {alpha}-1C primers HUCH 7F and HUCH 7R. (B) The gene-specific PCR products in reactions using cDNAs from three matched fresh (RAW) and frozen (FROZEN) semen specimens were compared with that from human testis cDNA template.

 
Importantly, intact RNA was isolated from frozen–thawed semen specimens (typical results, Figure 5BGo). Comparison of RNA yields from matched fresh and frozen–thawed semen specimens suggested that the yield of RNA from equal numbers of motile spermatozoa was somewhat reduced in motile populations from frozen versus fresh semen. Additional experiments are required to confirm the latter finding.

The PCR products obtained from the human sperm cDNA templates were sequenced and the derived sequence aligned with the sequence of the L-type VDCC {alpha}-1C subunit expressed in rat testis (Figure 6Go). Sequence identity was >99%, confirming that this region encodes a highly conserved portion of the {alpha}-1C protein which may be essential for the function or stability of the channel.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 6. The deduced amino acid sequence of the {alpha}-1C-specific polymerase chain reaction (PCR) product from human spermatozoa (HS) was aligned with the corresponding region of the rat testis-specific L-type voltage-dependent calcium channel (VDCC) {alpha}-1 subunit (Goodwin et al., 1999aGo). Identity is noted by a dot (.) and differences are shown by inclusion of the resultant amino acid change. Typical results are shown.

 
Discussion

The analysis of RNA in ejaculated spermatozoa by RT–PCR has been shown to be possible (Miller, 1997Go), and can add to our understanding of the cellular and molecular events which mediate male infertility. Unfortunately, such studies have been limited by the low value of RNA in spermatozoa and difficulties associated with RNA recovery. In general, prior studies have either had to pool multiple semen samples in order to obtain sufficient RNA for direct RT–PCR analysis of gene-specific transcripts (Kumar et al., 1993Go; Chiang et al., 1994Go; Richter et al., 1999Go), and have required hybridization with radioactive probes to detect the amplified product (Kumar et al., 1993Go), or have employed nested RT–PCR in order to obtain amounts of amplified products sufficient for detection by ethidium bromide staining after electrophoresis through agarose gels (Rohwedder et al., 1996Go).

In contrast, we have observed that single semen specimens yield sufficient RNA for up to five PCR reactions and that gene-specific sequences can be identified by direct RT–PCR. The results of the present study show that single ejaculates can yield useful amounts of RNA, with recovery being technique dependent. Although we were unable to isolate sperm RNA using a standard guanidinium extraction protocol, the results show that sperm RNA was reproducibly obtained following sodium dodecyl sulphate (SDS)/citric acid extraction and ethanol precipitation. Further, these data suggest that the recovery of RNA was considerably lower than the calculated optimum of 0.07 pg/spermatozoa (Pessot et al., 1989Go). On the other hand, since the reported 260/280 nm absorbance ratio of RNA preparations (Pessot et al., 1989Go) suggests significant protein contamination, their reported per-sperm RNA content may have been an over-estimate.

Qualitatively less RNA was recovered from motile spermatozoa from frozen semen prepared by Percoll density gradient centrifugation than from motile spermatozoa from raw semen prepared by swim-up. This difference cannot be attributed to the method for obtaining motile sperm populations as motile sperm preparation protocols have no effect on RNA recovery from raw semen after SDS/citric acid extraction (A.Jacob and S.Benoff, unpublished observations).

The location of RNA in spermatozoa remains controversial. Results from in-situ hybridization to animal and human spermatozoa suggest the RNA is contained within the residual cytoplasm of immature spermatozoa (Kwon and Hecht, 1991Go) or the mid-piece and tail regions (Kumar et al., 1993Go). In contrast, RNase treatment of swollen sperm heads (Witkin et al., 1975Go) and electron microscopy of sperm and testis sections stained with RNase-colloidal gold suspensions indicated that RNA was confined to the sperm nucleus (Pessot et al., 1989Go). In the present study, only raw semen specimens containing very low percentages of spermatozoa with residual cytoplasm were used, thus reducing the likelihood that the L-type VDCC {alpha}-1C transcripts amplified were derived from immature human spermatozoa. The results from in-situ RT–PCR of rat testis sections support this conclusion. The hybridization signal was consistently observed only over the head and, sometimes the mid-piece, of mature testicular spermatozoa from the rat. In somatic cells, mRNA is specifically distributed within a cell, according to the localized concentration of the specifically-encoded proteins (Lawrence and Singer, 1986Go). The current findings suggest that this may also be true for cells of the male germ line, as both the L-type VDCC {alpha}-1C transcript and its encoded protein (Goodwin et al., 1997Go; Benoff, 1998aGo,1999Go; Westenbroek and Babcock, 1999Go) exhibit similar distributions. These conflicting reports on the intracellular localization of RNA in spermatozoa may be resolvable, as they are likely to result from differences between methodologies and/or probes employed to detect RNA.

Whether sperm RNA transcripts are cytoplasmic survivors long after transcription has ended or result from ongoing transcription in mature spermatozoa remains to be determined. Although our studies do not address the origin or function of sperm L-type VDCC {alpha}-1C transcripts, the current observations may have a clinical use. It has been suggested that RT–PCR of human sperm RNA would be useful in monitoring the efficiency of vasectomy and reversal procedures (Miller et al., 1994Go). RT–PCR now offers the means for the molecular analysis of ion channel expression, function and regulation in relation to calcium influx and acrosome exocytosis, a critical feature of sexual reproduction. The nature of the ion channels that regulate intracellular calcium concentrations is a matter of considerable current speculation (Benoff, 1998aGo, 1999Go; Darszon et al., 1999Go; Publicover and Barratt, 1999Go). There is a growing body of evidence showing the presence of low voltage-activated `T-type' calcium currents in spermatogenic cells, i.e. patch clamp recordings have revealed that immature spermatogenic cells express only low voltage- activated (T-type) calcium currents (Lievano et al., 1996Go) and recent optical analyses with fluorescent ion-selective probes suggest that ejaculated spermatozoa, which do not actively synthesize proteins, also express T-type calcium currents (Linares-Hernandez et al., 1998Go; Arnoult et al., 1999Go).

To date, other laboratories have not observed T-type calcium channel subunit mRNA transcripts in mammalian testis by Northern blot analysis (Perez-Reyes et al, 1998Go). Similarly, our initial attempts to identify authentic T-type calcium channel pore-forming {alpha}-1 subunits in mammalian testis and spermatozoa by RT–PCR were unsuccessful (Benoff, 1999Go), although this may be a problem of appropriate PCR primer design. In contrast, results from Northern analyses, PCR analysis and immunocytochemistry provide strong evidence for expression of inositol 1,4,5-trisphosphate receptors (Tovey et al., 1997Go), responsible for release of calcium from intracellular stores (Berridge, 1993Go), and at least three different transcripts encoding the {alpha}-1 subunit of high voltage-activated calcium channels in immature mammalian spermatogenic cells and mature spermatozoa (e.g. A-type, C-type and E-type) (Lievano et al., 1996Go; Goodwin et al., 1997Go, 1998aGo,bGo, 1999aGo,bGo; Westenbroek and Babcock, 1999Go).

Observations on expression, or lack thereof, of various calcium channels subunits in the mammalian male germ line must be considered in the context of physiological agonist-stimulated calcium influx. This occurs in two waves: a rapid transient followed by a lag period and then a sustained rise in intracellular calcium (Florman, 1994Go). Acrosome exocytosis is correlated with the latter. Electrophysiological measurements and examination of sensitivity to pharmacological agents and metal ions (e.g. nickel) indicate that these T-type calcium currents, which are activated by protein tyrosine dephosphorylation (Arnoult et al., 1997Go) and inactivate rapidly, are responsible for the initial rapid calcium transients observed after mammalian sperm contact components of the zona pellucida (Arnoult et al., 1999Go; Blackmore and Eisoldt, 1999Go), producing a depolarization of sperm membrane potential. Based on results from in-vitro expression of cloned calcium channel {alpha}-1 subunits (Meir and Dolphin, 1998Go) and the effects of co-expression of auxiliary subunits (Wyatt et al., 1998Go), it is conceivable that the high voltage-activated calcium channel subunits detected in mammalian testis are responsible for production of these T-type currents. With regard to the second and prolonged increase in sperm intracellular calcium, it has been postulated that it arises from depletion of perinuclear (Blackmore, 1993Go) or intra-acrosomal calcium stores (Walensky and Snyder, 1995Go; Spungin and Breitbart, 1996Go). However, zona ligands containing mannose do not induce the human sperm acrosome reaction by mobilization of intracellular calcium stores (Blackmore and Eisoldt, 1999Go). It is, therefore, significant that a second calcium current, which is slowly inactivating and relatively insensitive to nickel as is typical of those carried by high voltage-activated calcium channels, has been observed in animal and human spermatozoa (Tiwari-Woodruff and Cox, 1995Go; Linares-Hernandez et al., 1998Go; Darszon et al., 1999Go). High voltage-activated calcium currents in somatic cells are activated by depolarization of membrane potential, phosphorylation of tyrosine residues and proteolytic cleavage of {alpha}-1 subunits (Klockner et al., 1997Go; Liu and Sperelakis, 1997Go). The same appears to be true in mammalian spermatogenic cells and mature spermatozoa.

In mammalian spermatogenic cells, high voltage-activated calcium currents are induced by membrane depolarization (Florman, 1994Go) (possibly as the result of the activation of the T-type calcium current described above). In addition, induction of the human sperm acrosome reaction by mannose ligands involves tyrosine phosphorylation (Benoff, 1997Go; Fisher et al., 1998Go) of the L-type VDCC {alpha}-1C subunit (Benoff, 1998bGo), which is can be inhibited by the L-type calcium channel antagonists nifedipine and PN200 (Benoff, 1998bGo). Proteolysis of the mammalian sperm L-type VDCC {alpha}-1C subunit is required for induction of the acrosome reaction by physiological agonists (Benoff, 1998aGo,bGo). Sites for L-type VDCC {alpha}-1C protein (Goodwin et al., 1997Go) and initial zona pellucida-induced calcium entry (Shirakawa and Miyazaki, 1999Go) co-localize on the mammalian sperm head. These data support the hypothesis that L-like VDCC regulate sustained calcium influx in mammalian spermatozoa (Florman, 1994Go; Shirakawa and Miyazaki, 1999Go).

At least 13 different isoforms of the human testis L-type VDCC {alpha}-1C are produced by alternative splicing (Benoff, 1998aGo; Goodwin et al., 1998bGo). Preliminary studies, employing sperm RNA isolated by the protocol described herein, suggest that each man carries RNA encoding only one L-VDCC {alpha}-1C splice variant mRNA sequence in his spermatozoa and that expression of splice variants which would result in deletions of membrane spanning segments is associated with a reduced acrosome response to mannose treatment (Goodwin et al., 1999bGo). Based on the present results, RT–PCR using sperm RNA as template could ultimately be useful to identify males with an acrosome reaction insufficiency prior to attempts at intrauterine insemination or assisted reproduction.

Acknowledgments

Appreciation is expressed to Ian R.Hurley and George W.Cooper for critical reading of the manuscript, to Craig Gawel for performing the fluorescence-based automated DNA sequencing, to Asha Jacob and Stephanie Canaras for assistance with photomicroscopy, and to Barbara Napolitano for statistical consultations. Supported by funds from the Division of Molecular Genetics, Department of Research, North Shore University Hospital and the Department of Obstetrics and Gynecology, University of Arizona and, in part, by Grant No. ES 06100 to S.B. from the National Institute of Environmental Health Sciences, National Institutes of Health, Bethesda, Maryland.

Notes

5 To whom correspondence should be addressed

Back

* Presented at IFFS '98 (16th World Congress on Fertility and Sterility and 54th Annual Meeting of the American Society for Reproductive Medicine), San Francisco, California, October 4–9, 1998

Back

References

Adamopoulos, D.A., Pappa, A., Nicopoulou, S. et al. (1996) Seminal volume and total sperm number trends in men attending subfertility clinics in the Greater Athens area during the period 1977–1993. Hum. Reprod., 9, 1936–1941.

Arnoult, C., Lemos, J.R. and Florman, H.M. (1997) Voltage-dependent modulation of T-type calcium channels by protein tyrosine dephosphorylation. EMBO J., 16, 1593–1599.[ISI][Medline]

Arnoult, C., Kazam, I.G., Visconti, P.E. et al. (1999) Control of the low voltage-activated calcium channel of mouse sperm by egg ZP3 and by membrane hyperpolarization during capacitation. Proc. Natl. Acad. Sci. USA, 96, 6757–6762.[Abstract/Free Full Text]

Auger, J., Kunstmann, J.M., Czyglik, F. et al. (1995) Decline in semen quality among fertile men in Paris during the past 20 years. N. Engl. J. Med., 332, 281–285.[Abstract/Free Full Text]

Baba, T., Azuma, S., Kashiwabara, S. et al. (1994) Sperm from mice carrying a targeted mutation of the acrosin gene can penetrate the oocyte zona pellucida and effect fertilization. J. Biol. Chem., 269, 31845–31849.[Abstract/Free Full Text]

Barratt, C.L.R. and St John, J.C. (1998) Diagnostic tools in male infertility. Hum. Reprod., 13 (Suppl., 1), 51–61.

Becker, S. and Berhane, K. (1997) A meta-analysis of 61 sperm count studies revisited. Fertil. Steril., 67, 1103–1108.[ISI][Medline]

Benoff, S. (1997) Carbohydrates and fertilization: an overview. Mol. Hum. Reprod., 3, 599–637.[Abstract/Free Full Text]

Benoff, S. (1998a) Voltage dependent calcium channels in mammalian spermatozoa. Frontiers Biosci., 3, d1220-d1240.

Benoff, S. (1998b) Modelling human sperm–egg interactions in vitro: signal transduction pathways regulating the acrosome reaction. Mol. Hum. Reprod., 4, 453–471.[Abstract/Free Full Text]

Benoff, S. (1999) Receptors and channels regulating acrosome reaction. Hum. Fertil., 2, 42–55.

Benoff, S., Cooper, G.W., Paine, T. et al. (1999) Numerical dose-compensated IVF inseminations yield high fertilization and pregnancy rates. Fertil. Steril., 71, 1019–1028.[ISI][Medline]

Berridge, M.J. (1993) Inositol trisphosphate and calcium signalling. Nature, 361, 315–325.[Medline]

Blackmore, P.F. (1993) Thapsigarin elevates and potentiates the ability of progesterone to increase intracellular free calcium in human sperm: a possible role of perinuclear calcium. Cell Calcium, 14, 53–60.[ISI][Medline]

Blackmore, P.F. and Eisoldt, S. (1999) The neoglycoprotein mannose–bovine serum albumin, but not progesterone, activates T-type calcium channels in human spermatozoa. Mol. Hum. Reprod., 5, 498–506.[Abstract/Free Full Text]

Bolger, G.B., McPhee, I. and Houslay, M.D. (1996) Alternative splicing of cAMP-specific phosphodiesterase mRNA transcripts. J. Biol. Chem., 271, 1065–1071.[Abstract/Free Full Text]

Carlsen, E., Giwercman, A., Keiding, N. et al. (1992) Evidence for decreasing quality of semen during the past 50 years. Br. Med. J., 305, 609–613.

Chiang, M.H., Stuerwald, N., Lambert, H. et al. (1994) Detection of human leukocyte antigen class I messenger ribonucleic acid transcripts in human spermatozoa via reverse transcription-polymerase chain reaction. Fertil. Steril., 61, 276–280.[ISI][Medline]

Chirgwin, J, Przbyla, A., MacDonald, R. et al. (1979) Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry, 18, 5294–5299.[Medline]

Chomcznski, P and Sacchi, N (1987) Single step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal. Biochem., 162, 156–159.[ISI][Medline]

Cooke, H.J., Hargreave, T. and Elliott, D.J. (1998) Understanding the genes involved in spermatogenesis. Fertil. Steril., 69, 989–995.[ISI][Medline]

Cui, X., Li, H., Goradia, T.M. et al. (1989) Single-sperm typing: determination of the genetic distance between Gg-globin and parathyroid hormone loci using the polymerase chain reaction and allele-specific oligomers. Proc. Natl. Acad. Sci. USA, 86, 9389–9393.[Abstract/Free Full Text]

Darszon, A., Labarca, P., Nishigaki, T. et al. (1999) Ion channels in sperm physiology. Physiol. Rev., 79, 481–510.[Abstract/Free Full Text]

Eddy, E.M. and O'Brien, D.A. (1998) Gene expression during mammalian meiosis. Curr. Topics Dev. Biol., 37, 141–200.[ISI][Medline]

Egozcue, J., Blanco, J. and Vidal, F. (1997) Chromosome studies in human sperm nuclei using fluorescence in-situ hybridization (FISH). Hum. Reprod. Update, 3, 441–452.[Abstract/Free Full Text]

Esther, C.R., Howard, T.E., Marino, E.M. et al. (1996) Mice lacking angiotensin-converting enzyme have low blood-pressure, renal pathology, and reduced fertility. Lab. Invest., 7, 953–965.

Fisher, H.M., Brewis, I.A., Barratt, C.L.R. et al. (1998) Phosphoinositide 3-kinase is involved in the induction of the human sperm acrosome reaction downstream of tyrosine phosphorylation. Mol. Hum. Reprod., 4, 849–855.[Abstract/Free Full Text]

Florman, H.M. (1994) Sequential focal and global elevations of sperm intracellular calcium are initiated by the zona pellucida during acrosomal exocytosis. Dev. Biol., 165, 152–164.[ISI][Medline]

Gonzalez-Estrella, J.A., Coney, P., Ostash, P. et al. (1994) Dithiothreitol effects on the viscosity and quality of human semen. Fertil. Steril., 62, 1238–1243.[ISI][Medline]

Goodwin, L.O., Leeds, N.B., Hurley, I. et al. (1997) Isolation and characterization of the primary structure of testis-specific L-type calcium channel: implications for contraception. Mol. Hum. Reprod., 3, 255–268.[Abstract/Free Full Text]

Goodwin, L.O., Leeds, N.B., Hurley, I. et al. (1998a) Alternative splicing of exons of the a1 subunit of the rat testis L-type voltage-dependent calcium channel generates germ line-specific dihydropyridine binding sites. Mol. Hum. Reprod., 4, 215–226.[Abstract/Free Full Text]

Goodwin, L.O., Leeds, N.B., Jacob, A. et al. (1998b) The unique structural diversity of the human testis-specific voltage-dependent calcium channel. [Abst.] J. Androl. Suppl., 26.

Goodwin, L.O., Leeds, N.B., Guzowski, D. et al. (1999a) Identification of structural elements of the testis-specific voltage dependent calcium channel that potentially regulate its biophysical properties. Mol. Hum. Reprod., 5, 311–322.[Abstract/Free Full Text]

Goodwin, L.O., Leeds, N.B., Karabinus, D.S. et al. (1999b) Variability in L-type voltage-dependent calcium channel (L-VDCC) sequence in human testis and sperm. [Abstr. no. O-062.] In American Society for Reproductive Medicine, 55th Annual Meeting. Abstracts of the Scientific Oral and Poster Sessions. p. S24.

Innis, M., Gelfand, D. and Sninsky, J. (1990) PCR Protocols: A Guide to Methods and Applications. Academic Press Inc., San Diego, CA, USA.

Johnson, M.D. (1998) Genetic risks of intracytoplasmic sperm injection in the treatment of male infertility: recommendations for genetic counseling and screening. Fertil. Steril., 70, 397–411.[ISI][Medline]

Karabinus, D.S. and Gelety, T.J. (1997) The impact of sperm morphology evaluated by strict criteria on intrauterine insemination success. Fertil. Steril., 67, 536–541.[ISI][Medline]

Kierszenbaum, A.L. and Tres, L.L. (1975) Structural and transcriptional features of the mouse spermatid genome. J. Cell. Biol., 65, 258–270.[Abstract/Free Full Text]

Klockner, U., Mikala, G., Eisfeld, J. et al. (1997) Properties of three COOH-terminal splice variants of the human cardiac L-type Ca2+-channel alpha1-subunit. Am. J. Physiol., 272, H1372–H1381.[Abstract/Free Full Text]

Koch, W.J., Hui, A., Schull, G. et al. (1989) Characterization of cDNA clones encoding two putative isoforms of the alpha 1 subunit of the dihydropyridine-sensitive voltage-dependent calcium channel isolated from rat brain and rat aorta. FEBS Lett., 250, 386–388.[ISI][Medline]

Koch, W.J., Ellinor, P.T. and Schwartz, A. (1990) cDNA cloning of a dihydropyridine-sensitive calcium channel from rat aorta: evidence for the existence of alternatively spliced forms. J. Biol. Chem., 265, 17786–17791.[Abstract/Free Full Text]

Krege, J.H., John, S., Langenbach, L.L. et al. (1995) Male-female differences in fertility and blood-pressure in ACE deficient mice. Nature, 375, 146–148.[Medline]

Kruger, T.F., Acosta, A.A., Simmons, K.F. et al. (1988) Predictive value of abnormal sperm morphology in in vitro fertilization. Fertil. Steril., 49, 112–117.[ISI][Medline]

Kumar, G., Patel, D. and Naz, R.K. (1993) c-MYC mRNA is present in human sperm cells. Cell. Mol. Biol. Res., 39, 111–117.[ISI][Medline]

Kwon, Y.K. and Hecht, N.B. (1991) Cytoplasmic protein bindings to highly conserved sequences in the 3' untranslated region of mouse protamine 2 mRNA, a translationally regulated transcript of male germ cells. Proc. Natl. Acad. Sci. USA, 88, 3584–3588.[Abstract/Free Full Text]

Lawrence, J.B. and Singer, R.H. (1986) Intracellular localization of messenger RNAs for cytoskeletal proteins. Cell, 45, 407–415.[ISI][Medline]

Lievano, A., Santi, C.M., Serrano, C.J. et al. (1996) T-type Ca2+ channels and alpha1E expression in spermatogenic cells, and their possible relevance to the sperm acrosome reaction. FEBS Lett., 388, 150–154.[ISI][Medline]

Li, H., Gyllensten, U.B., Cui, X. et al. (1988) Amplification and analysis of DNA sequences in single human sperm and diploid cells. Nature, 335, 414–417.[Medline]

Linares-Hernandez, L., Guzman-Grenfell, A.M., Hicks-Gomez, J.J. et al. (1998) Voltage-dependent calcium influx in human sperm assessed by simultaneous optical detection of intracellular calcium and membrane potential. Biochim. Biophys Acta, 1372, 1–12.[Medline]

Liu, H. and Sperelakis, N. (1997) Tyrosine kinases modulate the activity of single L-type calcium channels in vascular smooth muscle cells from rat portal vein. Can. J. Physiol. Pharmacol., 75, 1063–1068.[ISI][Medline]

Means, A.R., Cruzalegui, F., LeMagueresse, B. et al. (1991) A novel Ca++/calmodulin-dependent protein-kinase and a male germ cell-specific calmodulin-binding protein are derived from the same gene. Mol. Cell. Biol., 11, 3960–3971.[Abstract/Free Full Text]

Meir, A. and Dolphin, A.C. (1998) Known calcium channel alpha1 subunits can form low threshold small conductance channels with similarities to native T-type channels. Neuron, 20, 341–351.[ISI][Medline]

Miller, D. (1997) RNA in the ejaculate spermatozoon: a window into molecular events in spermatogenesis and a record of the unusual requirements of haploid gene expression and post-meiotic equilibration. Mol. Hum. Reprod., 3, 669–676.[Abstract/Free Full Text]

Miller, D., Tang, P.-Z., Skinner, T. et al. (1994) Differential RNA fingerprinting as a tool in the analysis of spermatozoal gene expression. Hum. Reprod., 9, 864–869.[Abstract/Free Full Text]

Mosher, W.D. (1985) Reproductive impairments in the United States, 1965–1982. Demography, 22, 415–430.[ISI][Medline]

Mullis, K.B. and Faloona, F.A. (1987) Specific synthesis of DNA in vitro via a polymerase catalyzed chain reaction. Methods Enzymol., 155, 335–350.[ISI][Medline]

Palermo, G.D., Coehn, J., Alikani, M. et al. (1995) Intracytoplasmic sperm injection: a novel treatment for all forms of male factor infertility. Fertil. Steril., 63, 1231–1240.[ISI][Medline]

Perez-Reyes, E., Cribbs, L.L., Daud, A. et al. (1998) Molecular characterization of a neuronal low-voltage-activated T-type calcium channel. Nature, 391, 896–900.[Medline]

Pessot, C.A., Brito, M., Figueroa, J. et al. (1989) Presence of RNA in the sperm nucleus. Biochem. Biophys Res. Commun., 158, 272–278.[ISI][Medline]

Piva, M. and Sharpe-Timmes, K.L. (1999) Peritoneal endometriotic lesions differentially express a haptoglobin-like gene. Mol. Hum. Reprod., 5, 71–78.[Abstract/Free Full Text]

Pryor, J.L., Kent-First, M., Muallem, A. et al. (1997) Microdeletions in the Y chromosome of infertile men. N. Engl. J. Med., 336, 534–539.[Abstract/Free Full Text]

Publicover, S.J. and Barratt, C.L.R. (1999) Voltage-operated Ca2+ channels and the acrosome reaction: which channels are present and what do they do? Hum. Reprod., 14, 873–879.[Abstract/Free Full Text]

Richter, W., Dettmer, D. and Glander, H.-J. (1999) Detection of mRNA transcripts of cyclic nucleotide phosphodiesterase subtypes in ejaculated human spermatozoa. Mol. Hum. Reprod., 5, 732–736.[Abstract/Free Full Text]

Rohwedder, A., Liedigk, O., Schaller, J. et al. (1996) Detection of mRNA transcripts of ß1 integrins in ejaculated human spermatozoa by nested reverse transcription–polymerase chain reaction. Mol. Hum. Reprod., 2, 499–505.[Abstract/Free Full Text]

Saiki, R.K., Scharf, S., Faloona, F. et al. (1985) Enzymatic amplification of B-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science, 230, 1350–1354.[Abstract/Free Full Text]

Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning. Cold Spring Harbor Publications, Cold Spring Harbor, New York, USA.

Shirakawa, H. and Miyazaki, S. (1999) Spatiotemporal characterization of intracellular Ca2+ rise during the acrosome reaction of mammalian spermatozoa induced by zona pellucida. Dev. Biol., 208, 70–78.[ISI][Medline]

Snutch, T.P., Tomlinson, W.J., Leonard, J.P. et al. (1991) Distinct calcium channels are generated by alternative splicing and are differentially expressed in the mammalian CNS. Neuron, 7, 45–57.[ISI][Medline]

Society for Assisted Reproductive Technology and the American Society for Reproductive Medicine (1998) Assisted reproductive technology in the United States and Canada: 1995 results from the American Society for Reproductive Medicine/Society for Assisted Reproductive Technology Registry. Fertil. Steril., 69, 389–398.[ISI][Medline]

Soldatov, N.M. (1994) Genomic structure of human L-type Ca2+ channel. Genomics, 22, 77–87.[ISI][Medline]

Spungin, B. and Breitbart, H. (1996) Calcium mobilization and influx during sperm exocytosis. J. Cell, Sci., 109, 1947–1955.[Abstract]

Tiwari-Woodruff, S.K. and Cox, T.C. (1995) Boar sperm plasma membrane Ca2+-selective channels in planar lipid bilayers. Am. J. Physiol., 268, C1284–C1294.[Abstract/Free Full Text]

Tovey, S.C., Godfrey, R.E., Hughes, P.J. et al. (1997) Identification and characterization of inositol,1,4,5-triphosphate receptors in rat testis. Cell Calcium, 21, 311–319.[ISI][Medline]

Tso, J.Y., Sun, X.H., Kao, T.H. et al. (1985) Isolation and characterization of rat and human glyceraldehyde-3-phosphate dehydrogenase cDNAs: genomic complexity and molecular evolution of the gene. Nucleic Acids Res., 13, 2485–2502.[Abstract/Free Full Text]