Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (62)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Dadze, S.
Right arrow Articles by Wieacker, P.F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dadze, S.
Right arrow Articles by Wieacker, P.F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Human Reproduction, Vol. 6, No. 3, 207-214, March 2000
© 2000 European Society of Human Reproduction and Embryology


Testis and spermatozoa

The size of the CAG repeat in exon 1 of the androgen receptor gene shows no significant relationship to impaired spermatogenesis in an infertile Caucasoid sample of German origin

S. Dadze1,6, C. Wieland1,2, S. Jakubiczka3, K. Funke4, E. Schröder2, B. Royer-Pokora2, R. Willers5 and P.F. Wieacker3

1 Centre for Reproductive Medicine, Graf-Salm Straße 8, D-50181 Bedburg, 2 Institute of Human Genetics and Anthropology, University of Düsseldorf, Universitätsstraße 1, D-40225 Düsseldorf, 3 Institute of Human Genetics, University of Magdeburg, Leipziger Straße 44, D-39120 Magdeburg, 4 Institute of Medical Statistics, Information Technology and Epidemiology, University of Cologne, Josef-Stelzmann Str. 9, D-50931 Cologne and 5 Computer Science Department, University of Düsseldorf, Universitätsstraße 1, D-40225 Düsseldorf, Germany

Abstract

The androgen receptor (AR) gene, located on the X-chromosome at Xq11-12, contains in exon 1 a polymorphic CAG repeat which codes for a polyglutamine tract. Contractions of the CAG repeat are said to be related to prostate cancer. In contrast, sizeable expansion of the CAG repeat can cause spinal and bulbar muscular atrophy (SBMA). In infertile patients of Chinese origin and in a Melbourne multinational population impaired sperm production has been postulated to be related to moderate expansions of the polyglutamine tract. In a study of a Swedish population of infertile patients these findings could not be corroborated. The aim of our investigation was to examine the correlation between the length of the CAG repeat and impaired sperm production in an infertile Caucasoid patient sample of German ethnic origin. We found no statistically significant relationship between the size of the CAG repeat or polyglutamine tract and idiopathic impaired sperm production in the population studied. The variability of the results by various investigators may be attributed to different ethnic origins and hence different genetic modifiers of the populations studied and/or to the high probability that these infertile males may represent a heterogeneous group with respect to the causes of defective spermatogenesis.

androgen receptor gene/CAG repeat/defective spermatogenesis/male infertility

Introduction

According to the World Health Organization (WHO) tabulation of available data on the prevalence of primary and secondary infertility, >70% of the causes of male infertility are not known. The most important single test in the evaluation of male infertility is the semen analysis. Recently much attention has been given to genetic causes of male infertility with defective spermatogenesis (e.g. Ma et al., 1993; Chandley and Cooke, 1994; Vogt et al., 1996; Meschede and Horst, 1997; Tut et al., 1997; Yong et al., 1998; Wang et al., 1998; Dowsing et al., 1999).

Androgens initiate and maintain the formation of spermatozoa (Weinbauer and Nieschlag, 1998Go). They exert this effect through the androgen receptor (AR) encoded by the androgen receptor gene (AR).

The AR is a member of the steroid receptor superfamily (Tsai and O'Malley, 1994Go). After binding of androgen to the cytosolic AR, the receptor is activated. This activated androgen–AR complex translocates to the nucleus and binds to androgen-responsive elements leading to regulation of transcription processes of downstream androgen-dependent genes (Evans, 1988Go; Green and Chambon, 1988Go; Beato, 1989Go).

Since most infertile males have normal serum androgen levels, defects in the chain of the androgen response system and essentially of the AR could hypothetically result in defective spermatogenesis. The range of phenotypes of individuals with defects in AR function varies from 46,XY sex-reversed infertile females with complete androgen insensitivity to the phenotypically normal 46,XY infertile males with mild androgen insensitivity and severe oligozoospermia or azoospermia (Quigley et al., 1995Go; Quigley, 1998Go; Wieacker et al., 1998Go).

The AR gene is located on the long arm of the X chromosome at Xq11-12 (Wieacker et al., 1987Go; Brown, et al., 1989Go; Mahtani et al., 1991Go). Its protein coding regions comprise eight exons (Lubahn et al., 1988Go; Tilley et al., 1989Go; Marcelli et al., 1991) which code for various functional domains: exon 1 encodes the transactivation domain in the aminoterminal part of the protein (Lubahn et al., 1989Go; Jenster et al., 1995Go), exons 2 and 3 encode the DNA binding domain, exon 4 encodes the hinge domain and exons 5–8 encode the ligand binding domain (Lubahn et al., 1989Go; Quigley, 1998Go). A polymorphic trinucleotide repeat (CAG)n followed by a terminal CAA triplet located in exon 1 code for the polyglutamine tract in the aminoterminal region of the AR.

Patients suffering from spinal and bulbar muscular atrophy (SBMA or Kennedy disease) have generally normal androgen levels. In addition to the neurological features typical of this disease, some of them present with signs of infertility associated with impaired sperm production (Quigley, 1998Go). The cause of this disease is due to a so-called dynamic mutation in the AR gene: the normal AR gene contains a polymorphic stretch of CAG repeats in exon 1 of average length of 21 ± 2 (Quigley et al., 1998) with a range of 9–36 repeats (Andrew et al., 1997Go). In affected patients with SBMA this repeat segment is expanded to 38–62 repeats (Andrew et al., 1997Go).

Because of the incidence of impaired sperm production and expanded polyglutamine tracts in patients with SBMA, various investigators examined the hypothesis that expansion of the size of the CAG repeats or polyglutamine tract could also be a relevant cause of impaired sperm production (Tut et al., 1997Go; Yong et al., 1998Go). In a study of infertile patients of Chinese origin these investigators found a significant relationship between the length of the polyglutamine tract and the degree of impairment of sperm production (Tut et al., 1997Go). There was a 4-fold increased risk of impaired spermatogenesis in infertile patients with >=28 glutamine residues compared to a fertile control group (Tut et al., 1997Go). In cotransfection experiments with AR constructs of 31, 20 and 15 glutamine residues and a luciferase reporter gene there was an inverse relationship between the transregulatory activity and the number of glutamine residues (Tut et al., 1997Go). Another study of 30 patients with idiopathic azoospermia or oligozoospermia concluded that the mean CAG repeat size increased with severity of spermatogenic defect (Dowsing et al., 1999Go). However, other investigators using an infertile population of Swedish ethnic origin could not confirm a relationship between the size of the polyglutamine tract and impaired sperm production (Giwercman et al., 1998Go).

In our present work we investigated the hypothesis of a relationship between variations in the length of the CAG repeat of the AR gene and the impairment of sperm production in an infertile Caucasoid patient sample of German ethnic origin.

Materials and methods

Patients and control selection
The project was approved by the Medical Ethics Committee of the University of Düsseldorf, Germany.

A total of 119 patients of German ethnic origin were recruited from Centres for Reproductive Medicine in Bedburg and Deggendorf, Germany and the Department of Reproductive Medicine, University of Magdeburg, Germany. All of these patients had non-obstructive impairment of spermatogenesis. Control subjects were 22 males of German ethnic origin and of proven fertility, who have fathered at least one child by natural conception. Semen parameters were evaluated according to published recommendations (World Health Organization, 1996Go). Semen analysis of the patients was performed twice at 3 month intervals and the mean result recorded. The 119 patients were divided into subgroups according to the severity of the defects in spermatogenesis: 18 had no spermatozoa in ejaculate (azoospermia), 59 had a sperm concentration of <1x106/ml ejaculate (severe oligozoospermia), 29 had a sperm concentration of 1–5x106/ml ejaculate (moderate oligozoospermia) and 13 had a sperm concentration of 6–20x106/ml ejaculate (mild oligozoospermia). The mean age of the infertile patients was 33.3 years (SD 6.6, range 20–50). The mean age of the fertile control subjects was 38.8 years (SD 11, range 27–65).

Relevant serum hormone values [testosterone, prolactin, follicle stimulating hormone (FSH) and luteinizing hormone (LH)] were determined in most of the patients, using 125I radioimmunoassay kits according to the manufacturer's protocol.

Trinucleotide analysis
Genomic DNA was prepared from peripheral blood lymphocytes according to standard protocols. The DNA fragment containing the polymorphic CAG repeat was amplified in three subsequent polymerase chain reactions (PCR). The reaction components for each PCR consisted of 50 µl 1.5 mmol/l MgCl2, 200 µmol/l dNTP, 20 mmol/l Tris/HCl pH 8.4, 50 mmol/l KCl (Life Technologies, Karlsruhe, Germany), 10% dimethylsulphoxide and 1 Unit Platin Taq DNA Polymerase (Life Technologies). The reaction reagents were overlayed with two drops of mineral oil (Sigma, Steinheim, Germany). The first round of PCR was performed with 100–500 ng of genomic DNA as template, prepared from blood of the infertile patients and the fertile controls and 10 pmol of each primer ARL and ARR (ARL: 5' TCCAGAATC TGTTCCAGAGCGTGC; ARR: 5' GCTGTGAAGGT TGCTGTTCCTCAT; corresponding to the primers in La Spada et al., 1991). Amplification was performed in 30 cycles with a denaturation temperature of 94°C for 1 min, an annealing temperature of 58°C for 30 s and an extension temperature of 65°C for 1 min.

To increase the specificity of the reaction and for later sequencing a second nested PCR was performed with similar reagents using 1 pmol of each primer M13ARL forward primer (ARL with M13 tail: 5' TGTAAAACGACGGCCAGT AGAATCTGTTCCAGAGCGTGCGCG) and M13ARR reverse primer (ARR with M13 tail: 5' CAGGAAACAGCTATGACC GTGAAGGTTGCTGTTCCTCATCCA; for AR sequence refer to Lubahn et al., 1989) and 2 µl of the reaction product from the first round PCR as template. Thirty cycles of nested PCR were performed. The denaturation temperature was 94°C for 1 min, the annealing temperature 64°C for 20 s and the extension temperature 65°C for 20 s.

A third PCR was performed using 2 µl of the reaction product from the nested PCR as template with similar reagents, except that in this third PCR 2 pmol of each M13 forward [(-21f) 5' TGTAAAACGACGGCCAGT] and M13 reverse [(-29r) 5' CAGGAAACAGCTATG ACC] primer were used. One primer of the primer pair was 5' fluorescent labelled with the IR-dye: 2 pmol of unlabelled M13 forward primer and 2 pmol of labelled M13 reverse primer were used. Amplification was performed in 30 cycles with a denaturation temperature of 94°C for 1 min, an annealing temperature of 58°C for 1 min and an extension temperature of 72°C for 30 s.

For all PCR the TrioBlock cycler from Biometra was used. The reactions were terminated with formamide loading dye Fuchsin red (Amersham Life Science, Amersham Pharmacia Biotech, Freiburg, Germany) 1:1, denatured at 95°C for 3 min and put on ice before electrophoresis. 1,5 µl of the denatured reaction products were separated on a 6% Rapid Sequencing/6 mol/l urea gel (Rapid Gel Concentrate, Amersham Life Science) with 1xTBE at 40 W, 50°C in a Licor automatic DNA Sequencing apparatus (DNA Sequencer Long Read IR 4200., Licor/MWG, Ebersberg, Germany) for ~4 h. The size of the most prominent upper band was determined by comparing the size of this band with the size of sequenced PCR products containing CAG repeats of known length. For details of the sequencing procedure see below.

Cycle sequencing of the CAG repeats
For sequencing the reference samples no. 15 with 25 CAG, no. 16 with 25 CAG (father of no. 15), no. 17 with 19 CAG as well as one of the shortest (patient no. 28 with 16 CAG) and one of the longest (patient no. 35 with 30 CAG) the first round PCR was performed as described above. Sample no. 17 was a black ethnic African and was exclusively used as reference sample to determine the length of the CAG repeats (data not shown). The second round PCR was also performed as described above, except that annealing and extension were done in a single step at 66°C for 40 s. The resulting reactions were purified using the Quick PCR Purification Kit (Qiagen, Hilden, Germany) following the manufacturer's protocol. The cycle sequencing reaction was performed using the Sequi Therm Excell II Long Read DNA Sequencing Kit (Epicentre/Biozym, Hess. Oldendorf, Germany) with a maximum volume of purified PCR product of the second round PCR as recommended in the manufacturer's protocol. Sequencing was performed in two directions using 2 pmol of fluorescent labelled M13 forward primer or fluorescent labelled M13 reverse primer in the PTC 200 cycler from MJResearch. The initial denaturation temperature was 95°C for 2 min. Thirty cycles were performed with a denaturation temperature of 95°C for 15 s, an annealing temperature of 60°C for 15 s and an extension temperature of 70°C for 15 s. The sequencing reactions were terminated with 3 µl formamide loading dye Fuchsin red (Amersham Life Science), denaturated at 95°C for 3 min and put on ice. 1.5 µl of the terminated, denaturated sequencing reaction mixtures were electrophoresed as described above. M13 forward fluorescent labelled reaction mixures were analysed on 6% Rapid Sequencing/6 mol/l urea gels containing 17.8% deionized formamide (to improve the resolution of the CAG repeat) at 40 W, 50°C for ~4 h with 1xTBE. The size of the corresponding polyglutamine tract was deduced from the sequence. The size of the CAG repeat was calculated with an accuracy of ±1.

Statistical analysis
The statistical analysis of our results was performed with the Kruskal–Wallis test using the SAS program version 6.12 (SAS Institute Inc., 1989).

Results

Endocrine status
Relevant serum hormone levels (see Materials and methods) were measured in most of the patients. Almost all hormone levels measured were in the normal range (data not shown).

Molecular genetic analysis
Patients with visible cytogenetic aberrations were excluded from the study. All patients were 46,XY males (data not shown).

In the subsequent molecular genetic investigation the DNA fragment encoding the polyglutamine tract of the AR was amplified from DNA of peripheral lymphocytes in three subsequent PCR reactions using the initial primer pair ARL, ARR. The size of the uppermost strongest band was determined by comparison with sequenced reference samples of known size (Figure 1Go). PCR products of patient no. 28 with one of the shortest repeats (16 CAG) and of patient no. 35 with one of the longest repeats (30 CAG) and of two fertile reference samples (sample nos. 16 and 17) as well as of a female sample (sample no. 15) were sequenced in order to determine the length of the CAG repeat in these persons (data not shown). We were able to identify 17 different alleles in the infertile group with a range of 16–34 CAG repeats corresponding to 17–35 glutamine residues. In the same infertile patient group the most common allele consisted of 21 CAG repeats (17.6%; 22 glutamine residues respectively, see Table IGo). The most common alleles in the fertile control group consisted of 23 CAG repeats (22.7%) corresponding to 24 glutamine residues respectively (Table IGo). Nine of the infertile patients with impaired sperm production showed an expansion of the CAG repeat (27, 28, 29, 30, 34 repeats) and thus of the deduced polyglutamine tract (28, 29, 30, 31, 35 glutamine residues; Table IGo).



View larger version (83K):
[in this window]
[in a new window]
 
Figure 1. Length analysis of polymerase chain reaction products containing the CAG repeat of the AR gene. Differences between the (CAG)n repeat size of infertile patients and the control group are shown. Slot 1: female sample with 25 CAG; slot 2: fertile reference sample with 25 CAG and slot 3: fertile reference sample with 19 CAG; slot 4: infertile reference sample with 16 CAG; slot 5: infertile reference sample with 30 CAG; slot 6: infertile patient with 15 CAG; slots 7 and 8: fertile controls with 19 and 23 CAG; slots 9–13: infertile patients with 26, 21, 20, 25 and 24 CAG; slots 14–20: fertile controls with 22, 23, 15, 16, 23, 26 and 19 CAG; slot 21–25: the same samples as in slot 1–5. FR = fertile reference sample; FC = fertile controls; IP = infertile patients; IR = infertile reference samples (patients); F = female.

 

View this table:
[in this window]
[in a new window]
 
Table I. Summary of the CAG repeats and the deduced polyglutamine tracts determined
 
Statistical analysis
The CAG repeats of the AR gene in the infertile males presenting with impaired sperm production showed a mean of 22.0 and a SD of 3.2 with a range of 16–34. The mean for the corresponding glutamine residues was 23.0 with a SD of 3.2 and a range of 17–35. In the fertile controls the mean of the CAG repeat length was 20.8 with a SD of 3.3 and a range of 15–26. The mean of the corresponding glutamine residues was 21.8 with a SD of 3.3 and a range of 16–27 (Table IIGo).


View this table:
[in this window]
[in a new window]
 
Table II. Mean number of CAG repeats and deduced glutamine residues in fertile controls and infertile patients according to severity of spermatogenic defect
 
The box plot analysis in Figure 2Go of fertile and infertile subjects shows that the differences of the length of the CAG repeats and, by inference, of the glutamine residues in the infertile group compared to those of the fertile controls, do not differ much (Table IIGo). However, the whiskers in the box plot point to a tendency of longer CAG repeats, and, by inference, longer glutamine tracts in the infertile group compared to fertile controls (Figure 2Go). The box plot (Figure 2Go) shows a stronger upward variation trend in the infertile group. The medians of the two groups are almost equal and the means differ only slightly.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 2. Box plot of the infertile patient group compared to the fertile control group (P = 0.3051). The boxes delineate the upper and lower quartiles. The whiskers show the range; asterisk = mean; bar = median.

 
To test the results of the box plot analysis on a theoretical basis, Kruskal–Wallis test was performed with a not significance level of {alpha} = 0.05. The null hypothesis was: that there is no difference in the size of the CAG repeats between the groups of infertile and fertile subjects. According to the not significant result (P = 0.3051) the null hypothesis cannot be rejected; thus the statistical analysis of our test sample of n = 141 does not confirm that the size of the CAG repeats of our fertile and infertile subjects of German ethnic origin differ significantly.

Furthermore the box plot analysis of the four subsets of infertile males (azoospermic, severely oligozoospermic, moderately oligozoospermic and mildly oligozoospermic) and the fertile control group shows that the size of the CAG repeats and thus of the corresponding glutamine tracts do not differ to any significant degree (Figure 3Go; Kruskal–Wallis test P = 0.4396). Thus the severity of the impairment of spermatogenesis does not correlate with the enlargement of the size of the CAG repeats (Table IIGo and Figure 3Go).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 3. Box plot of the infertile patient group (divided into subgroups according to the severity of spermatogenic defect) compared to the fertile control group (P = 0.4396). The boxes delineate the upper and lower quartiles. The whiskers show the range; asterisk = mean; bar = median.

 
Analysis of the distribution of the CAG repeats in fertile controls and infertile patients (Figure 4Go) shows that the bulk of the CAG repeats in both groups falls in a nearly similar range. The shapes of the distribution pattern, however, show some differences: the control data are a little more peaked and somewhat skewed, whereas the infertile data show a semblance of symmetry.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 4. Distribution of the CAG repeat sizes in exon 1 of the androgen receptor gene of infertile males (grey) and fertile controls (black).

 
Discussion

Aiman and coworkers postulated that defects in the AR gene can lead to partial or complete spermatogenic failure (Aiman et al., 1979Go; Aiman and Griffin, 1982Go).

To date, deletions of the AR gene in exon 4 (Akin et al., 1991Go), point mutations in exon 6 (Tsukada et al., 1994Go) and in exon 8 (Yong et al., 1996Go), a missense mutation in exon 8 (Knoke et al., 1999Go) as well as missense mutations in exon 5 (Yong et al., 1994Go) have been reported with accompanying defects in spermatogenesis of affected patients. However, investigations of exon 1 of the AR gene with respect to impaired spermatogenesis of infertile males have yielded variable results: analysis of PCR products in agarose gels disclosed no gross mutations in the first analysis of exon 1 of the AR gene as a cause of impaired spermatogenesis, probably due to the relative insensitivity of the method used (Puschek et al., 1994Go).

However, in a recent study of exon 1 of the AR gene in infertile males of predominantly Chinese ethnic origin it was found that expansion of the trinucleotide (CAG) repeat and thus of the polyglutamine tract could be associated with increased risk of impaired spermatogenesis (Tut et al., 1997Go). This finding was then corroborated by Yong and colleagues in their work on the role of the AR gene in the control of spermatogenesis in a genetic screening of the transactivation domain of exon 1. In Chinese patients presenting solely with defective spermatogenesis and infertility they found that up to 20% of the infertile males had reduced androgenicity caused by an increased expansion of the polymorphic CAG repeat and thus of the polyglutamine tract (Yong et al., 1998Go). Another report corroborates the presumption that infertile males have significantly longer CAG repeat tracts than fertile males (Dowsing et al., 1999Go). In Swedish males no association could be established between the length of the CAG repeats in exon 1 of the AR gene and impaired sperm production (Giwercman et al., 1998Go). It has been suggested recently that reduction of the CAG repeat <=16 repeats is closely related to impaired sperm production in an infertile Japanese population (Komori et al., 1999Go).

Our group investigated the hypothetical association between the expansion of the CAG repeat of the AR gene in relation to various degrees of impaired sperm production in infertile males of German ethnic origin. In contrast to the findings of some (Tut et al., 1997Go; Yong et al., 1998Go; Dowsing et al., 1999Go) but in accordance with those of others (Giwercman et al., 1998Go) we found no statistically significant differences between the size of the CAG repeat as well as the deduced polyglutamine tract of infertile patients presenting with impaired sperm production and the fertile controls (P = 0.3051). Our results do not provide any proof of a relationship between the length of the CAG repeat (polyglutamine tract) and impairment of sperm production in infertile men of German ethnic origin.

Also within the subgroups of infertile males presenting with varying degrees of impaired sperm production (azoospermia, severe oligozoospermia, moderate oligozoospermia and mild oligozoospermia) we found no statistically significant association between the size of their respective CAG repeats or polyglutamine tracts and the severity of impaired sperm production (P = 0.4396). The range of the size of the CAG repeats in the infertile group was 16–34 and in the fertile control group 15–26; the difference was not statistically significant.

It has been found that an enlargement of the polyglutamine tract >=28 glutamine residues in infertile males is associated with a 4-fold increased risk of infertility (Tut et al., 1997Go). If these findings were generally applicable, then by extrapolation the more severe the spermatogenic defect the longer the polyglutamine tract should be. Our findings of 28 and 29 CAG repeats (29 and 30 glutamine residues) in two patients with severe oligozoospermia and of two patients with 27 and one patient each with 28, 29, 30 and 34 CAG repeats all with moderate oligozoospermia (28, 29, 30, 31 and 35 glutamine residues, respectively) and of a patient with 28 CAG repeats and mild oligozoospermia do not lend support to a generalization of the hypothesis of Tut and coworkers. We found no expansion of the CAG repeat >=28 in the azoospermic subgroup. In all other infertile patients the polyglutamine tract was in the normal range of 9–36 (Andrew et al., 1997Go).

The maximum deduced polyglutamine tract size in our study and one other (Dowsing et al., 1999Go) consisted of 35 glutamine residues; in other studies the maximum length found consisted of 31 glutamine residues (Tut et al., 1997Go; Yong et al., 1998Go). The alleles of the 33–39 repeat size may be so rare because of very low expansion frequency and high contraction frequency in the range of 28–31 repeats (Zhang et al., 1994Go).

In our study the majority of infertile men (71%) fall in the category of <=22–23 glutamine residues (<=21–22 CAG repeats), which (according to Tut et al., 1997) should rather be associated with reduced risk of infertility. However, such short polyglutamine tracts could also be associated with increased risk of prostate cancer (Irvine et al., 1994Go). Although the CAG repeat sizes of more infertile patients (n = 119) and fewer fertile controls (n = 22) were studied, the result of our Kruskal–Wallis test (P = 0.3051) is in agreement with a similar Kruskal–Wallis test in a study of 35 infertile males and 32 controls (P = 0.250) (Dowsing et al., 1999Go). Thus the numbers studied were probably adequate for statistical conclusions, confirming our presumption as reflected by our data, and provide no cause for further attempts to fit the same data to other statistical tests.

It is well documented in the literature that the size of the CAG repeats in the AR gene varies in a race-specific manner without evidence of prostate cancer (Sartor et al., 1999Go). The prevalence of short CAG repeats (<=22 repeats) was shown to be high in African Americans (75%) and low in Asians (49%) (Irvine et al., 1994Go). Thus one possible explanation of the corroboration of our results with those of Giwercman and colleagues might be the ethnic similarities of the European patients studied; the difference of our results and Giwercmans from those of Tut, Yong, Dowsing and colleagues could be due to the Chinese ethnic and mixed Australian multinational origins of patients studied by them. The variable results according to ethnicity and hence differing genetic modifiers are also supported by a study on Japanese subjects (Komori et al., 1999Go). More population studies are needed to determine the average length of the polyglutamine tract in a large number of controls in different ethnic groups in order to clarify these issues.

Until there is evidence of a spermatogenesis gene directly expressed under the control of the androgen receptor, modulation of the activity of this receptor as a cause of severe male infertility in males should be viewed cautiously (Vogt, 1999Go).

Deletions in the long arm of the Y chromosome in the AZF a, b, c regions are known to cause impairment of sperm production in infertile males. They occur frequently as de novo mutations in men with idiopathic azoospermia or severe oligozoospermia (e.g. Ma et al., 1993; Chandley and Cooke, 1994; Reijo et al., 1995; Najmabadi et al., 1996; Vogt et al., 1996; Simoni et al., 1997; Vogt, 1998). One of the men studied here with idiopathic impaired sperm production had a Y-chromosome deletion in the AZFc (DAZ) region (S.Dadze et al., unpublished data). Furthermore deletions or mutations in recently isolated new genes, involved in control of spermatogenesis (e.g. Lahn and Page, 1997; Korpelainen et al., 1998; Peri et al., 1998; Vogt, 1998; Weinbauer et al., 1998; Yu et al., 1998) could be responsible for the impairment of spermatogenesis in our patient group.

This highlights the fact that infertile males presenting with idiopathic non-obstructive impairment of sperm production represent a heterogeneous aetiological entity, and hence there is need for more basic research into idiopathic male infertility as well as a multilayered diagnostic approach.

Our investigations of the AR gene have not included work to detect point mutations. Currently we are using PCR-SSCP to screen for point mutations in the AR gene and examine possible relationships to impaired sperm production in the same patient group.

Acknowledgments

The first three authors contributed equally to the work. We thank I.Dadze for performing C.W.'s routine IVF duties and thus enabling C.W. to devote all her energies to this investigation. We also thank S.Zimmermann, V.Schumacher, M.Drechsler, E.Höricht and B.Leube for helpful discussions as well as A.Jung and H.-J.Gebauer for performing the cytogenetic analysis. Finally we express our appreciation to U.Ebner for providing us with blood samples of some of the patients, to J.Kleinstein for providing us with some of the andrological data, the staff of the Centre for Reproductive Medicine in Bedburg for their help in various ways and to P.Sinther, M.Bauer and T.Goecke for help in the technical layout of the Figures.

Notes

6 To whom correspondence should be addressed Back

References

Aiman, J. and Griffin, J.E. (1982) The frequency of androgen receptor deficiency in infertile men. J. Clin. Endocrinol. Metab., 54, 725–732.[Abstract/Free Full Text]

Aiman, J., Griffin, J.E., Gazak, J.M. et al. (1979) Androgen insensitivity as a cause of infertility in otherwise normal men. N. Engl. J. Med., 300, 223–227.[Abstract]

Akin, J.W., Behzadian, A., Tho, S.P.T. et al. (1991) Evidence for a partial deletion in the androgen receptor gene in a phenotypic male with azoospermia. Am. J. Obstet. Gynecol., 165, 1891–1894.[Web of Science][Medline]

Andrew, S.E., Goldberg, Y.P. and Hayden, M.R. (1997) Rethinking genotype and phenotype correlations in polyglutamine expansion disorders. Hum. Mol. Genet., 6, 2005–2010.[Free Full Text]

Beato, M. (1989) Gene regulation by steroid hormones. Cell, 56, 335–344.[Web of Science][Medline]

Brinkmann, A., Jenster, G., Ris-Stalpers, C. et al. (1996) Molecular basis of androgen insensitivity. Steroids, 61, 172–175.[Web of Science][Medline]

Brown, C.J., Goss, S.J., Lubahn, D.B. et al. (1989) Androgen receptor locus on the human X-chromosome: regional localisation to Xq11–12 and description of a DNA polymorphism. Am. J. Hum. Genet., 44, 264–269.[Web of Science][Medline]

Chandley, A. and Cooke, H. (1994) Human male fertility __ Y- linked genes and spermatogenesis. Hum. Mol. Genet., 3, 1449–1452.[Abstract]

Dowsing, A., Yong, E.L., Clark, M. et al. (1999) Linkage between male infertility and trinucleotid repeat expansion in the androgen receptor gene. Lancet, 354, 640–643.[Web of Science][Medline]

Evans, R.M. (1988) The steroid and thyroid hormone receptor superfamily. Science, 240, 889–899.[Abstract/Free Full Text]

Giwercman, Y.L., Xu, C., Arver, S. et al. (1998) No association between the androgen receptor gene CAG repeat and impaired sperm production in Swedish men. Clin. Genet., 54, 435–436.[Web of Science][Medline]

Green, S. and Chambon, P. (1988) Nuclear receptors enhance our understanding of transcription regulation. Trends Genet., 4, 309–313.[Web of Science][Medline]

Irvine, R.A., Yu, M.C., Ross, R.K. et al. (1994) The CAG and GGC microsatellites of the androgen receptor gene are in linkage disequilibrium in men with prostate cancer. Cancer Res., 54, 2861–2864.[Abstract/Free Full Text]

Jenster, G., van der Korput, H.G.M., Trapman, J. et al. (1995) Identification of two transcription activation sites in the N-terminal domain of the human androgen receptor. J. Biol. Chem., 270, 7341–7346.[Abstract/Free Full Text]

Knoke, I., Jakubiczka, S., Lehnert, H. et al. (1999) A new point mutation of the androgen receptor gene in a patient with partial androgen resistance and severe oligozoospermia. Andrologia, 31, 199–201.[Web of Science][Medline]

Komori, S., Kasumi, H., Kanazawa, R. et al. (1999) CAG repeat length in the androgen receptor gene of infertile Japanese males with oligozoospermia. Mol. Hum. Reprod., 5, 14–16.[Abstract/Free Full Text]

Korpelainen, E.I., Karkkainen, M.J., Tenhunen, A. et al. (1998) Overexpression of VEGF in testis and epididymis causes infertility in transgenic mice: evidence for nonendothelial targets for VEGF. J. Cell Biol., 143, 1705–1712.[Abstract/Free Full Text]

Lahn, B.T. and Page, D.C. (1997) Functional coherence of the human Y chromosome. Science, 278, 675–679.[Abstract/Free Full Text]

La Spada, A.R., Wilson, E.M., Lubahn, D.B. et al. (1991) Androgen receptor gene mutations in X-linked spinal and bulbar muscular atrophy. Nature, 352, 77–79.[Medline]

Lubahn, D.B., Joseph, D.R., Sullivan, P.M. et al. (1988) Cloning of human androgen receptor complementary DNA and localization to the X-chromosome. Science, 240, 327–330.[Abstract/Free Full Text]

Lubahn, D.B., Brown, T.R., Simental, J.A. et al. (1989) Sequence of the intron/exon junctions of the coding region of the human androgen receptor gene and identification of a point mutation in a family with complete androgen insensitivity. Proc. Natl Acad. Sci. USA, 86, 9534–9538.[Abstract/Free Full Text]

Ma, K., John, D.I., Sharkey, A. et al. (1993) A Y-chromosome gene family with RNA binding protein homology: candidates for the azoospermia factor AZF controlling human spermatogenesis. Cell, 75, 1287–1295.[Web of Science][Medline]

Mahtani, M.M., Lafeniere, R.G., Kruse, T.A. et al. (1991) An 18-locus linkage map of the pericentromeric region of the human X-chromosome: Genetic framework for mapping X-linked diseases. Genomics, 10, 849–857.[Web of Science][Medline]

Marcelli, M., Tilley, W.D., Wilson, C.M. et al. (1990) Definition of the human androgen receptor gene structure permits the identification of mutations that cause androgen resistance: premature termination of the receptor protein at amino acid residue 588 causes complete androgen resistance. Mol. Endocrinol., 4, 1105–1116.[Abstract/Free Full Text]

Meschede, D. and Horst, J. (1997) The molecular genetics of male infertility. Mol. Hum. Reprod., 3, 419–430.[Abstract/Free Full Text]

Najmabadi, H., Huang, V., Yen, P. et al. (1996) Substantial prevalence of microdeletions of the Y-chromosome in infertile men with idiopathic azoospermia and oligozoospermia detected using a sequence-tagged site-based mapping strategy. J. Clin. Endocrinol. Metab., 81, 1347–1352.[Abstract]

Peri, A., Krausz, C., Cioppi, F. et al. (1998) Cyclic adenosine 3', 5'-monophosphate-responsive element modulator gene expression in germ cells of normo- and oligoazoospermic men. J. Clin. Endocrinol. Metab., 83, 3722–3726.[Abstract/Free Full Text]

Puschek, E.E., Behzadian, M.A. and McDonough, P.G. (1994) The first analysis of exon 1 (the transactivation domain) of the androgen receptor gene in infertile men with oligospermia or azoospermia. Fertil. Steril., 62, 1035–1038.[Web of Science][Medline]

Quigley, C.A. (1998) The androgen receptor: physiology and pathophysiology. In Nieschlag, E. and Behre, H.M. (eds) Testosterone: Action, Deficiency, Substitution, 2nd edn. Springer, Heidelberg, pp. 33–106.

Quigley, C.A., De Bellis, A., Marschke, K.B. et al. (1995) Androgen receptor defects: historical, clinical and molecular perspectives. Endocr. Rev., 16, 271–321.[Abstract/Free Full Text]

Reijo, R., Lee, T.Y., Salo, P. et al. (1995) Diverse spermatogenic defects in humans caused by Y chromosome deletions encompassing a novel RNA-binding protein gene. Nature Genet., 10, 383–393.[Web of Science][Medline]

Sartor, O., Zheng, Q. and Eastham, J.A. (1999) Androgen receptor gene CAG repeat length varies in a race-specific fashion in men without prostate cancer. Urology, 53, 378–380.[Web of Science][Medline]

SAS (1989) SAS/STAT User's Guide, Version 6, 4th edn. SAS Institute Inc., Cary, NC, Vol., 1, p. 943.

Simoni, M., Gromoll, J., Dworniczak, B. et al. (1997) Screening for deletions of the Y-chromosome involving the DAZ (Deleted in AZoospermia) gene in azoospermia and severe oligozoospermia. Fertil. Steril., 67, 542–547.[Web of Science][Medline]

Tilley, W.D., Marcelli, M., Wilson, J.D. et al. (1989) Characterization and expression of a cDNA encoding the human androgen receptor. Proc. Natl Acad. Sci. USA, 86, 327–331.[Abstract/Free Full Text]

Tsai, M.J. and O'Malley, B.W. (1994) Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu. Rev. Biochem., 63, 451–486.[Web of Science][Medline]

Tsukada, T., Imque, M., Tachibana, S. et al. (1994) An androgen receptor mutation causing androgen resistance in undervirilized male syndrome. J. Clin. Endocr. Metab., 15, 1202–1207.

Tut, T.G., Ghadessy, F.J., Trifiro, M.A. et al. (1997) Long polyglutamine tracts in the androgen receptor are associated with reduced transactivation, impaired sperm production and male infertility. J. Clin. Endocrinol. Metab., 82, 3777–3782.[Abstract/Free Full Text]

Vogt, P. (1998) Human chromosome deletions in Yq11, AZF candidate genes and male infertility: history and update. Mol. Hum. Reprod., 4, 739–744.[Abstract/Free Full Text]

Vogt, P. (1999) Risk of neurodegenerative diseases in children conceived by intracytoplasmic sperm injection? Lancet, 354, 611–612.[Web of Science][Medline]

Vogt, P., Edelmann, A., Kirsch, S. et al. (1996) Human Y-chromosome azoospermia factors (AZF) mapped to different subregions in Yq11. Hum. Mol. Genet., 5, 933–943.[Abstract/Free Full Text]

Wang, Q., Ghadessy, F.J., Trounson, A. et al. (1998) Azoospermia associated with a mutation in the ligand binding domain of an androgen receptor displaying normal ligand binding, but defective trans-activation. J. Clin. Endocrinol. Metab., 83, 4303–4309.[Abstract/Free Full Text]

Weinbauer, G.F. and Nieschlag, E. (1998) The role of testosterone in spermatogenesis. In Nieschlag, E. and Behre, H.M. (eds), Testosterone: Action, Deficiency, Substitution, 2nd edn. Springer, Heidelberg, pp. 143–168.

Weinbauer, G.F., Behr, R., Bergmann, M. et al. (1998) Testicular cAMP responsive element modulator (CREM) protein is expressed in round spermatids but is absent or reduced in men with round spermatid maturation arrest. Mol. Hum. Reprod., 4, 9–15.[Abstract/Free Full Text]

Wieacker, P.F., Griffin, J.E., Wienker, T. et al. (1987) Linkage analysis with RFLPs in families with androgen resistence syndroms: evidence for close linkage between the androgen receptor locus and the DXS 1 segment. Hum. Genet., 76, 248–252.[Web of Science][Medline]

Wieacker, P.F., Knoke, I., Brosius, T. et al. (1998) Genetisch bedingte Veränderungen des Androgenrezeptors und deren klinische Bedeutung. Reproduktionsmedizin, 14, 215–223.

World Health Organization (1996) Laboratory Manual for the Examination of Human Semen and Sperm–Cervical Mucus Interaction. Cambridge University Press, Cambridge.

Yong, E.L., Hg, S.C., Roy, A.C. et al. (1994) Pregnancy after hormonal correction of severe spermatogenic defect due to a mutation in androgen receptor gene. Lancet, 344, 826–827.

Yong, E.L., Abdullah, A.A.R., Choo, C.K. et al. (1996) 46th Am. Soc. Hum. Genet. Meeting. Am. J. Hum. Genet., 59, Abstract 218, A43.

Yong, E.L., Ghadessy, F., Wang, Q. et al. (1998) Androgen receptor transactivation domain and control of spermatogenesis. Rev. Reprod., 3, 141–144.[Abstract]

Yu, R.N., Masafumi, I., Saunders, T.L. et al. (1998) Role of Ahch in gonadal development and gametogenesis. Nature Genet., 20, 353–357.[Web of Science][Medline]

Zhang, L., Leeflang, E.P., Yu, J. et al. (1994) Studying human mutations by sperm typing: instability of CAG trinucleotide repeats in the human androgen receptor gene. Nature Genet., 7, 531–535.[Web of Science][Medline]

Submitted on August 16, 1999; accepted on November 17, 1999.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J AndrolHome page
W. A. Badran, I. Fahmy, W. M. Abdel-Megid, K. Elder, R. Mansour, and M. Kent-First
Length of Androgen Receptor-CAG Repeats in Fertile and Infertile Egyptian Men
J Androl, July 1, 2009; 30(4): 416 - 425.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
S. G. Martinez-Garza, M. C. Gallegos-Rivas, M. Vargas-Maciel, J. M. Rubio-Rubio, M. E. de los Monteros-Rodriguez, C. Gonzalez-Ortega, P. Cancino-Villarreal, L. G. V. de Lara, and A. M. Gutierrez-Gutierrez
Genetic Screening in Infertile Mexican Men: Chromosomal Abnormalities, Y Chromosome Deletions, and Androgen Receptor CAG Repeat Length
J Androl, November 1, 2008; 29(6): 654 - 660.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. A. Davis-Dao, E. D. Tuazon, R. Z. Sokol, and V. K. Cortessis
Male Infertility and Variation in CAG Repeat Length in the Androgen Receptor Gene: A Meta-analysis
J. Clin. Endocrinol. Metab., November 1, 2007; 92(11): 4319 - 4326.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. Bhasin
Approach to the Infertile Man
J. Clin. Endocrinol. Metab., June 1, 2007; 92(6): 1995 - 2004.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
A. Ferlin, A. Garolla, A. Bettella, L. Bartoloni, C. Vinanzi, A. Roverato, and C. Foresta
Androgen receptor gene CAG and GGC repeat lengths in cryptorchidism
Eur. J. Endocrinol., March 1, 2005; 152(3): 419 - 425.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
Y. Ruhayel, K. Lundin, Y. Giwercman, C. Hallden, M. Willen, and A. Giwercman
Androgen receptor gene GGN and CAG polymorphisms among severely oligozoospermic and azoospermic Swedish men
Hum. Reprod., September 1, 2004; 19(9): 2076 - 2083.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
A. Ferlin, L. Bartoloni, G. Rizzo, A. Roverato, A. Garolla, and C. Foresta
Androgen receptor gene CAG and GGC repeat lengths in idiopathic male infertility
Mol. Hum. Reprod., June 1, 2004; 10(6): 417 - 421.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
D. Milatiner, D. Halle, M. Huerta, E. J. Margalioth, Y. Cohen, A. Ben-Chetrit, M. Gal, T. Mimoni, and T. Eldar-Geva
Associations between androgen receptor CAG repeat length and sperm morphology
Hum. Reprod., June 1, 2004; 19(6): 1426 - 1430.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
G. Sasaki, T. Ogata, T. Ishii, K. Kosaki, S. Sato, K. Homma, T. Takahashi, T. Hasegawa, and N. Matsuo
Micropenis and the 5{alpha}-Reductase-2 (SRD5A2) Gene: Mutation and V89L Polymorphism Analysis in 81 Japanese Patients
J. Clin. Endocrinol. Metab., July 1, 2003; 88(7): 3431 - 3436.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
J. J. Kurinczuk
Safety issues in assisted reproduction technology: From theory to reality--just what are the data telling us about ICSI offspring health and future fertility and should we be concerned?
Hum. Reprod., May 1, 2003; 18(5): 925 - 931.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
L. Mengual, J. Oriola, C. Ascaso, J. L. Ballesca, and R. Oliva
An Increased CAG Repeat Length in the Androgen Receptor Gene in Azoospermic ICSI Candidates
J Androl, March 1, 2003; 24(2): 279 - 284.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
K. Thangaraj, M. B. Joshi, A. G. Reddy, N. J. Gupta, B. Chakravarty, and L. Singh
CAG Repeat Expansion in the Androgen Receptor Gene Is Not Associated With Male Infertility in Indian Populations
J Androl, November 1, 2002; 23(6): 815 - 818.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. Dejager, H. Bry-Gauillard, E. Bruckert, B. Eymard, F. Salachas, E. LeGuern, S. Tardieu, R. Chadarevian, P. Giral, and G. Turpin
A Comprehensive Endocrine Description of Kennedy's Disease Revealing Androgen Insensitivity Linked to CAG Repeat Length
J. Clin. Endocrinol. Metab., August 1, 2002; 87(8): 3893 - 3901.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
A. Mifsud, A. T. Choon, D. Fang, and E.L. Yong
Prostate-specific antigen, testosterone, sex-hormone binding globulin and androgen receptor CAG repeat polymorphisms in subfertile and normal men
Mol. Hum. Reprod., November 1, 2001; 7(11): 1007 - 1013.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
C. Krausz, L. Quintana-Murci, E. R.-D. Meyts, N. Jorgensen, M.A. Jobling, Z.H. Rosser, N.E. Skakkebaek, and K. McElreavey
Identification of a Y chromosome haplogroup associated with reduced sperm counts
Hum. Mol. Genet., September 1, 2001; 10(18): 1873 - 1877.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
Y. Suzuki, I. Sasagawa, T. Tateno, J. Ashida, T. Nakada, K. Muroya, and T. Ogata
Mutation screening and CAG repeat length analysis of the androgen receptor gene in Klinefelter's syndrome patients with and without spermatogenesis
Hum. Reprod., August 1, 2001; 16(8): 1653 - 1656.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
O. Khorram, P. Patrizio, C. Wang, and R. Swerdloff
Reproductive Technologies for Male Infertility
J. Clin. Endocrinol. Metab., June 1, 2001; 86(6): 2373 - 2379.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. von Eckardstein, A. Syska, J. Gromoll, A. Kamischke, M. Simoni, and E. Nieschlag
Inverse Correlation between Sperm Concentration and Number of Androgen Receptor CAG Repeats in Normal Men
J. Clin. Endocrinol. Metab., June 1, 2001; 86(6): 2585 - 2590.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
K. Muroya, I. Sasagawa, Y. Suzuki, T. Nakada, T. Ishii, and T. Ogata
Hypospadias and the androgen receptor gene: mutation screening and CAG repeat length analysis
Mol. Hum. Reprod., May 1, 2001; 7(5): 409 - 413.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
I. Sasagawa, Y. Suzuki, T. Tateno, T. Nakada, K. Muroya, and T. Ogata
CAG repeat length of the androgen receptor gene in Japanese males with cryptorchidism
Mol. Hum. Reprod., November 1, 2000; 6(11): 973 - 975.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
D.S. Cram, B. Song, R.I. McLachlan, and A.O. Trounson
CAG trinucleotide repeats in the androgen receptor gene of infertile men exhibit stable inheritance in female offspring conceived after ICSI
Mol. Hum. Reprod., September 1, 2000; 6(9): 861 - 866.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (62)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Dadze, S.
Right arrow Articles by Wieacker, P.F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dadze, S.
Right arrow Articles by Wieacker, P.F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?