Molecular Human Reproduction, Vol. 6, No. 5, 415-421,
May 2000
© 2000 European Society of Human Reproduction and Embryology
Molecular endocrinology |
Cloning and characterization of bonnet monkey GnRH receptor
Department of Biochemistry and Department of Molecular Reproduction, Development and Genetics, Indian Institute of Science, Bangalore 560 012, India
Abstract
Gonadotrophin releasing hormone (GnRH) plays an important role in the reproductive processes of both males and females. It is synthesized by the hypothalamus and binds to a specific receptor on the pituitary to bring about the release of the gonadotrophins, lutineizing hormone and follicle stimulating hormone, which in turn bring about the release of the gonadal steroids. Although the structure of the GnRH receptor (GnRHR) has been elucidated from a number of sources, no information is available about the receptor from the non-human primate species. Here we report the cloning and characterization of the receptor from the pituitary of the bonnet monkey. Antiserum to a bacterially expressed recombinant fragment was used in Western blot analysis and fluorescence microscopy to demonstrate the presence of GnRHR in both human and monkey placentae and pituitary.
antibody/cloning/gonadotrophin releasing hormone receptor/monkey/pituitary
Introduction
Gonadotrophin releasing hormone (GnRH) is a decapeptide synthesized by the hypothalamus, which plays a key role in the regulation of mammalian reproductive processes (Hazum and Conn, 1988
; Clayton, 1989
; Conn et al., 1995
). It is secreted by the hypothalamic neurons in a pulsatile manner, from where it is transported to the pituitary by means of the hypothalamo-hypophyseal portal system. It regulates the synthesis and secretion of the gonadotrophins LH and FSH, from the anterior pituitary gonadotrophs, which in turn regulate the hormonal and gametogenic functions of the gonads (Fink, 1988
). This effect of GnRH is brought about by the binding of this peptide to high affinity receptors located on the surface of the gonadotrophs (Clayton, 1989
).
The GnRH receptor (GnRHR) belongs to the extremely large and diverse family of proteins known as the G-protein coupled receptors (GPcR), which are characterized by the presence of seven transmembrane segments (Huckle and Conn, 1988
) linked together by extracellular and intracellular domains. Although the GnRHR gene has been cloned in the mouse (Reinhart et al., 1992
; Tsutsumi et al., 1992
), the rat, (Eidne et al., 1992
; Kaiser et al., 1992
) and the sheep pituitary (Brook et al., 1993
), among primates, information is available only about the human GnRHR (Kakar et al., 1992
; Chi et al., 1993
). There is a high degree of homology between the cloned GnRHR, particularly between mice and rats, in which 93% of the nucleotide sequences and 95% of the amino acid sequences are conserved (Kaiser et al., 1992
). The GnRHR is composed of 327 (rat and mouse) and 328 (human) amino acids with seven apparent transmembrane regions, characteristic of the family of GPcR. An unusual structural feature of the GnRHR is the lack of the characteristically long intracellular C-terminal tail which is reported to be involved in mediation of down-regulation and desensitization of some GPcR (Dohlman et al., 1991
). The GnRHR has also been found in a variety of other reproductive tissues such as placenta (Currie et al., 1981
; Lin et al., 1995
), as well as several non-reproductive tissues such as human liver, heart and kidney (Kakar and Jennes, 1995
), where its functions are not established. Of the extrahypothalamic sites, the presence of the GnRHR mRNA in the human placenta has attracted considerable interest, in view of the reported regulation of synthesis and secretion of human chorionic gonadotrophin (HCG), by GnRH in the placenta (Khodr and Siler Khodr, 1978
; Mathialagan and Rao, 1986
). Recent studies have established the presence of both GnRH and its receptor mRNA in both cyto- and syncytiotrophoblast cells of human placenta (Lin et al., 1995
; Wolfahrt et al., 1998
). Using human placental cells (JEG-3) transfected with a construct containing the human GnRH upstream promoter region, it has been demonstrated (Chen et al., 1998
) that both oestradiol and cortisol may be physiologically involved in the regulation of GnRH gene expression in the human placenta. Based on these results it is suggested that the paracrine and autocrine regulation of HCG secretion by placental GnRH is mediated through the regulation of GnRHR message (Lin et al., 1995
). Thus while there are several reports regarding the role of GnRH in regulation of HCG in the human placenta, relatively much less information is available on the presence of GnRHR mRNA in the human placenta. It is only very recently that the presence of GnRHR mRNA in cyto- and syncytiotrophoblasts has been demonstrated using the technique of in-situ reverse transcriptionpolymerase chain reaction (RTPCR) (Wolfahrt et al., 1998
). In addition, all the published reports so far deal with the demonstration of GnRHR mRNA and not the protein in the placenta (Wolfahrt et al., 1998
). Also considerable controversy exists regarding the stage at which the GnRHR mRNA is present in the placenta (Boyle et al., 1998
). It has also been reported by several investigators that the human placental GnRHR has lower affinity to the ligand compared to the pituitary receptor (Currie et al., 1981
; Belisle et al., 1984
) and therefore it will be of interest to compare the GnRHR from the pituitary and the placenta of the same species. Earlier studies from our laboratory have established that the pregnant bonnet monkey can be used as an experimental model system to investigate the role of placental GnRH in regulation of mCG (monkey chorionic gonadotrophin) (Rao and Moudgal, 1984
; Rao and Chakraborti, 1990
). Thus the characterization of the GnRHR from the pituitary and the placenta of the same species, in which both in-vivo and in-vitro studies can be carried out, will be of importance. As a first step towards this, we report the cloning and characterization of the GnRHR mRNA from the bonnet monkey pituitary and localization of GnRHR protein in the placenta and pituitary using an antiserum raised to a fragment of the monkey pituitary GnRHR.
Materials and methods
Materials
Tri reagent, Freund's complete reagent, Ficoll, formamide, salmon sperm DNA, protease inhibitors [phenylmethylsulphonyl fluoride (PMSF), soya bean trypsin inhibitor, p-amino benzamidine, leupeptin and aproteinin], bovine serum albumin (BSA), Tween 20, Ponceau, goat anti-rabbit gammaglobulin conjugated to fluorescein isothiocyanate (FITC) were obtained from Sigma, St Louis, MO, USA. Enhanced chemiluminescence (ECL) kit, Megaprime DNA labelling kit, Hybond nitrocellulose, Moloney Murine Leukaemia Virus (MMLV) reverse transcriptase, nylon membrane, and Sephadex G-50 were obtained from AmershamPharmacia Biotech, Little Chalfont, Buckinghamshire, UK. Goat anti-rabbit gammaglobulin conjugated to horseradish peroxidase was obtained from Bangalore Genei, Peenya, Bangalore, India. [
32P]dCTP (specific activity: 3000 Ci/mmol) was obtained from NEN, Life Science Products Inc., Boston, MA, USA. The expression vector pGEX 5X-2 was obtained from Pharmacia-biotech, UK. Triton X-100 was obtained from Boehringer Mannheim GmbH, Mannheim, Germany.
cDNA cloning
Pituitaries from adult bonnet monkeys which were killed following reproductive toxicity studies at the Primate Research Laboratory, IISc, Bangalore, were collected in TRI reagent. Total RNA was isolated by the protocol provided by the manufacturer, estimated, and subjected to reverse transcription by random hexamer priming using MMLV reverse transcriptase. PCR was carried out using specific sets of primers. Two primer sets that were based on the human pituitary GnRHR sequence were used for PCR amplification. Set I was expected to give an amplification product of 382 bp corresponding to the position 436798 of the coding sequence of the GnRHR (amino acids 146266), and set II, an amplification product of 959 bp corresponding to the position 1 to 949 of the coding sequence of the GnRHR (amino acids 1316). The primers used for PCR were: set I, sense 5' GCGGATCCCCTAGCTTTGAAAAGCAAC3' and antisense 5' CGAATTCTTATAGAGTCTTCAGCCGTGCTCT3'; set II: sense 5' CTGGGAAAATATGGCAAACAGT 3' and antisense 5' ATGGGTTTAAAAAGGCAAAGA 3'.
The conditions used for PCR were 94°C for 2 min, 52°C for 1 min, 72°C for 90 s for 40 cycles, for set I and 94°C for 2 min, 54°C for 1min and 72°C for 90 s, for set II using an MJ Research thermal cycler (MJ Research Inc., Waterdown, MA, USA).
The 382 bp product was then subjected to restriction digestion using BamHI and EcoRI since the primers have been synthesized with EcoRI and BamHI linkers to facilitate cloning. The expression vector pGEX 5X-2 was subjected to restriction digestion using the above-mentioned restriction endonucleases, following which both the 382 and the 959 bp products were agarose gel purified and ligation reaction was carried out using the required molar concentrations of the vector and the insert. E.coli DH5
cells were then transformed with the ligation mix and the presence of the insert was ascertained by restriction digestion of the plasmid DNA from different colonies (Sambrook et al., 1989
).
Southern hybridization
The PCR products were analysed on a 1% agarose gel and the products were transferred onto nylon membrane. The human pituitary GnRHR cDNA (a kind gift from Dr Stuart C.Sealfon, Mount Sinai Medical Centre, New York, NY, USA) labelled with [
32P]dCTP by the random primer method (using the Megaprime DNA labelling kit), was used as the probe. Twenty-five nanograms of the human pituitary cDNA was labelled using the manufacturer's protocol for a period of 30 min and the labelled DNA was separated from unlabelled deoxynucleotides using a Sephadex G-50 column. Hybridization was carried out in hybridization solution containing Ficoll, polyvinylpyrrolidone (PVP) and BSA (5xDenhardt's solution containing 0.5 g Ficoll 400, 0.5 g PVP and 0.5 g BSA), 6xSSC (1xSSC contains 8.765 g NaCl, 4.41 g sodium citrate per litre), 50% formamide and 100 µg of salmon sperm DNA. Hybridization was carried out at 42°C according to a published protocol (Sambrook et al., 1989
).
Sequencing of the PCR products
DNA sequencing was performed on an ABI prism 310 automated genetic analyser using Dye-terminator chemistry. The sequencing reactions were performed using a Big Dye terminator cycle sequencing kit from Perkin Elmer Applied Biosystems.
Expression of the GnRHR fragment and production of antibodies
The PCR product of 315 bp (64 bp corresponding to position 436491 of the coding sequence of the GnRHR were lost during cloning, because digestion of the PCR product with BamHI restriction endonuclease resulted in the loss of 64 bp due to presence of an internal BamHI site in the PCR product) was cloned into the expression vector pGEX 5X-2 and the protein was expressed as a GST (glutathione-S-transferase) fusion protein of 37 kDa (corresponding to amino acids 165 to 265 of the GnRHR sequence). The over-expressed protein was purified from E.coli BL 21 cells, by subjecting the E.coli cell lysate to preparative sodium dodecyl sulphatepolyacrylamide gel electrophoresis (SDSPAGE), excising the band of interest and eluting the protein from the gel pieces by electroelution. This protein was then used to immunize rabbits. Rabbits were immunized with a primary dose of 250 µg of the purified protein in Freund's complete adjuvant. This was followed by booster doses of 100 µg and 50 µg of the purified protein, at weekly intervals, following which the rabbits were bled 7 days after the last booster and the serum tested for the presence of antibody by enzyme-linked immunosorbent assay (ELISA) using the purified protein (corresponding to 315 bp, which was expressed in E.coli) as the antigen.
Membrane preparation and Western blotting
Tissue (rat pituitary, monkey pituitary and human placenta) was homogenized in 2 ml of homogenization buffer containing 10 mmol/l TrisHCl pH 7.4, 250 mmol/l sucrose and protease inhibitors (2 mmol/l soya bean trypsin inhibitor, 2 mmol/l PMSF, 2 mmol/l p-aminobenzamidine, 5 µg/ml leupeptin, 2.5 µg/ml aproteinin), and was centrifuged at 400 g for 10 min at 4°C; the supernatant was centrifuged at 30 000 g for 1 h at 4°C in a Beckman J2-21M/E centrifuge using a JA-20 rotor to obtain a crude enriched membrane preparation with minor modifications to a published protocol (Nett et al., 1981
). The supernatant was discarded and the pellet was resuspended in buffer containing 10 mmol/l TrisHCl, pH 7.4, 0.1 mol/l NaCl, 0.2 mol/l MgSO4. The protein content was estimated by Lowry's method (Lowry et al., 1951
) using BSA as standard. Crude membrane protein (250 µg) was analysed by SDSPAGE (10%) following which proteins were transferred onto nitrocellulose membrane (Towbin et al., 1979
) for 2 h at 250 mA. The membrane was stained with Ponceau to check for the transfer (Sambrook et al., 1989
) and the membrane was incubated with 5% non-fat milk for a period of 2 h. This was followed by incubation with the GnRHR antiserum at dilution of 1:1000 for a period of 2 h. The membrane was washed extensively with Tris-buffered saline (TBS) pH 7.4 containing 0.05% Tween 20, followed by washes with TBS. The blot was then incubated in 1:15 000 dilution of goat anti-rabbit gammaglobulin conjugated to horseradish peroxidase for 1 h and was washed extensively before developing using an ECL chemiluminiscence kit.
Processing of placental tissue for confocal microscopy
Fresh human placental tissue collected at medical termination of pregnancy or following Caesarean delivery was washed extensively to get rid of blood contamination. In every case, consent of the patient was obtained by the physician concerned before collection of the placenta by medical termination of pregnancy, Caesarean delivery or amniocentesis. Individual villi were then fixed overnight in 4% formalin and this was then followed by wash with phosphate-buffered saline (PBS), pH 7.3 to remove all traces of formalin. Villi were incubated in a 1% solution of bovine serum albumin in PBS, for 1 h to take care of non-specific adsorption. Following four washes with PBS, the villi were incubated with the appropriate dilution of antiserum to GnRHR fragment or normal rabbit serum for a period of 2 h at 37°C. The tissue was then washed extensively with PBS containing 0.2% Triton X-100, followed by a minimum of 10 washes with PBS and then incubated in a solution containing 1:200 dilution of goat anti-rabbit gammaglobulin conjugated to FITC for 1 h. Interference due to non-specific binding was eliminated by washing extensively with PBS containing 0.2% Triton X-100 followed by PBS. The tissue was then mounted onto glass slides (Fisher, USA) and visualized using a confocal microscope (Leica, Germany).
Results
RTPCR
The results presented in Figure 1a and b
, indicate that fragments of 382 and 959 bp are amplified upon RTPCR from the bonnet monkey pituitary with the specific set of primers used (set I and set II respectively), and this is the size expected following genuine amplification from GnRHR mRNA, with the primers employed, based on the human pituitary GnRHR cDNA sequence. The absence of any amplification in the control lanes where the template was omitted establishes the purity of the reagents used for PCR.
|
Southern hybridization
It can be seen that the signals corresponding to 382 and 959 bp are obtained following hybridization to human GnRHR cDNA probe and no signal was seen in the no RT control lane, thus establishing the specificity of the PCR reaction (Figure 2a and b
|
Sequencing of the PCR product
Final confirmation of the PCR product was carried out by sequencing of the 959 bp PCR product on an ABI prism machine (Genebank accession No. AF 156930) (Figure 3
|
|
Western blotting
A signal corresponding to 68 kDa was observed with extracts from rat, monkey pituitary and human placenta, and no signal was seen in the normal rabbit serum-treated controls. In the case of rat and monkey pituitary, another signal of approximate molecular weight of 70 kDa was observed though the signal corresponding to 68 kDa was the most predominant signal (Figure 5ac
|
Immunofluorescence
The tissue, after incubation with antibody, was mounted onto a glass slide and visualized using a confocal microscope at a magnification of x200. The staining pattern indicated that the expression of the GnRHR protein was localized to the cell membrane in both the first trimester and term placenta as evidenced by the fact that the fluorescence was restricted to the periphery (Figure 6b and c
|
Discussion
Recent studies (Lin et al., 1995
; Boyle et al., 1998
; Wolfahrt et al., 1998
) have demonstrated the presence of GnRHR mRNA in human placenta using in-situ hybridization and RTPCR. Although results of these studies indicate the presence of GnRHR mRNA in human placenta, controversy still exists as to the stage at which it is present or predominantly expressed, or the cell type in which it is present. Thus, it has been reported that GnRHR mRNA is present in cytotrophoblast and syncytiotrophoblast cell layers and that the intensity of signal varied with gestation ages, being abundant at 6 weeks, peaking at 9 weeks, declining at 12 and 20 weeks and undetectable at term (Lin et al., 1995
). In contrast, the message was detected by a modified RTPCR protocol in 6 week and 8 week placental samples but not in 5 week and 7 week samples (Boyle et al., 1998
). However, using in-situ RTPCR and soluble phase RTPCR, GnRHR gene expression was detected in all first and third trimester placentae with abundant signals for GnRHR message, both in cyto- and syncytiotrophoblasts, although the GnRHR message was at the limit of detection in cultured trophoblasts (Wolfahrt et al., 1998
). It has been suggested that the reason for the variation in the expression of the GnRHR mRNA in the human placenta is that the message is extremely low (Boyle et al., 1998
). Alternatively, GnRHR mRNA may have a short half-life or the mRNA may be translated as rapidly as it is transcribed with the result that it does not accumulate in the cell. It is also suggested that more than one form of GnRHR mRNA may be present at different stages of gestation (Boyle et al., 1998
). It is pertinent to note in this connection that, in addition to our failure to demonstrate GnRHR mRNA by Northern analysis, we have not been able to demonstrate the GnRHR mRNA even by application of RTPCR in the human placentae despite using several sets of primers which were designed based on the human pituitary sequence, suggesting the possibility that the human placenta may have more than one form of the GnRHR mRNA. Any one of the above reasons alone or in combination may be responsible for the difficulties associated with detection of GnRHR message in human placentae of different gestational stages. Considering these problems, we felt that an immunological approach using antibodies to larger fragment of the receptor to demonstrate the presence of GnRHR protein may yield more reliable results. In order to obtain specific antiserum to GnRHR, we have cloned and expressed a part of the GnRHR protein from the bonnet monkey. Our results establish that the nucleotide sequence of the bonnet monkey pituitary GnRHR has 97% homology with the human pituitary GnRHR although the 3' sequence is not complete. The results of restriction map analysis and Southern hybridization provide additional evidence for the conclusion that there is extensive homology.
Although the use of antiserum to the full-length protein would have been more appropriate for immunological studies, we were unsuccessful in expressing the full-length fragment. However, expression of the small fragment of 382 bp was achieved as a GST-fusion protein and this corresponds to amino acids which encompass one transmembrane region, one extracellular loop and one intracellular loop.
Antibodies were raised to the fusion protein in rabbits and one of the rabbits produced high-titre antibodies indicating that the region expressed is highly immunogenic. Significant binding of the antigen by the antiserum was noticed even at a dilution of 1 in 80 000 in an ELISA. Though studies have been reported on the production of antibodies to peptide fragments [antiserum has been raised to amino acids 2336 in the extracellular region of the murine GnRHR (Nett et al., 1981
); antiserum has been raised to amino acids 129 in the extracellular region of the human pituitary GnRHR sequence (Karande et al., 1995
)], this is the first report of production of antibodies to the transmembrane and extracellular loop. In addition to the ELISA, the ability of the antiserum to recognize the antigen used for immunizing the rabbits was ascertained in Western blot analysis. This antiserum has been successfully employed to demonstrate the presence of the GnRHR in rat pituitary and the human placental extracts. Before employing the antiserum for Western blot studies with pituitary and placental extracts, and to localize the GnRHR in placental villi and pituitary sections, we have also ascertained that the signals obtained by Western analysis are not due to GST protein by subjecting the rat pituitary extracts to Western blot analysis using antiserum to GST. It was observed that when antiserum to GST was used to probe rat pituitary extracts in a Western blot, we were able to detect only a lower molecular weight signal of ~53 kDa (data not shown) corresponding to the reported molecular weight of GST (Motoyamat and Dauterman, 1979
) and when probed with an antiserum raised by us, no signal corresponding to 53 kDa was detected. While with the rat pituitary extract we observed two signals corresponding to approximate sizes of 68 and 70 kDa, with placental extracts we were able to observe only one signal of 68 kDa. It is of significance to note that in all the three cases, i.e. rat, monkey pituitary and placental extracts, the predominant signal obtained corresponded to the molecular weight of 68 kDa. Although the estimated molecular weight of the human GnRHR based upon predicted amino acid sequence is 37 kDa, a range of molecular weights (from 40 to 63 kDa) have been reported for rat pituitary GnRHR (Iwashita et al., 1985), despite the high degree of sequence homology at the nucleotide level between rat and human (Stojilkovic et al., 1994
). One obvious explanation for the discrepancy could be the extent of glycosylation (Iwashita et al., 1985) although no data are available on this. Glycosylation of G protein-coupled receptors has been known to play a role in cell surface expression, protein folding, ligand recognition as well as receptor effector coupling (Wheatley and Hawtin, 1999
). However, the fragment that we have expressed does not contain any potential glycosylation sites. Our estimate of molecular weight of 68 kDa for rat pituitary and human placental GnRHR is in close agreement with 70 kDa reported by Perrin et al. (1993) from cloned rat pituitary and mouse pituitary tumour cell line GnRHR using a photo affinity labelling approach. Upon preincubation of the antiserum with rat pituitary membrane extracts there was also a reduction in the intensity of the signal in case of rat pituitary, thus further establishing that the antiserum indeed recognized the GnRHR. However, the results obtained using immunofluorescence and confocal microscopy were more uniform in that both the tissues tested, namely first trimester and term human placenta, fluorescence was observed in the periphery of the villi which is in agreement with the observation that the GnRHR is membrane bound. In this connection, GnRHR mRNA has been detected in human placental villi regardless of gestational age (Wolfahrt et al., 1998
), results supported in the present paper. Our study is different from the rest in that we consistently found the presence of the GnRHR protein in the first trimester and term placenta in contrast to the reports based on in-situ hybridization referred to earlier (Lin et al., 1995
) and in agreement with other observations (Wolfahrt et al., 1998
). Also our studies did not reveal any difference in the intensity of the signal, suggesting that at the protein level there is no difference.
Acknowledgments
The authors would like to acknowledge the financial assistance from Indian Council of Medical research, the Council of Scientific and Industrial Research, and the Department of Science and technology, Government of India. The authors also wish to acknowledge the help provided by the DNA sequencing facility and the confocal microscopy facility, IISc, Bangalore. The authors also wish to thank the staff of K.C. general hospital and Dr Kamini Rao, Bangalore Assisted Conception Centre, for help in collecting human placental samples.
Notes
1 To whom correspondence should be addressed ![]()
References
Belisle, S., Guevin, J.F., Bellabarba, D. and Lehoux, J.G. (1984) Luteinizing hormone-releasing hormone binds to enriched human placenta membranes and stimulates in vitro the synthesis of bioactive human chorionic gonadotropin in human pregnancies. J. Clin. Endocrinol. Metab., 59, 119126.[Abstract]
Boyle, T.A., Belt-Davis, D.I. and Duello, T.M. (1998) Nucleotide sequence analyses predict that human pituitary and human placental gonadotropin releasing hormone receptors have identical primary structures. Endocrine, 9, 281287.[ISI][Medline]
Brook, J., Taylor, P.L., Saunders, P.T.K. et al. (1993) Cloning and sequencing of sheep pituitary gonadotropin-releasing hormone receptor and changes in expression of its mRNA during the oestrus cycle. Mol. Cell. Endocrinol., 94, R23R27.
Chen, Z.G., Chou, C.S., Hsu, M.I. et al. (1998) Glucocorticoids modulate human gonadotropin releasing hormone upstream promoter activity in transfected human placental cells. Mol. Hum. Reprod., 4, 9399.
Chi, L., Zhou, W., Prikhozhan, A. et al. (1993) Cloning and characterisation of the human GnRH receptor. Mol. Cell. Endocrinol., 91, R1R6.[ISI][Medline]
Clayton, R.N. (1989) Gonadotropin-releasing hormone: its action and receptors (review). J. Endocrinol., 120, 1119.[ISI][Medline]
Conn, P.M., Janovick, J.A., Stanislaus, D. et al. (1995) Molecular and cellular basis of gonadotropin releasing hormone action in the pituitary and central nervous system. In Litwack, G. (ed.), Vitamins and Hormones. Academic Press, New York, Vol. 50, pp. 151214.
Currie, A.J., Fraser, H.M. and Sharpe, R.M. (1981) Human placental receptors for luteinising hormone releasing hormone. Biochem. Biophys. Res. Commun., 99, 332338.[ISI][Medline]
Dohlman, H.G., Thorner, J., Caron, M.G. et al. (1991) Model systems for the study of seven-transmembrane-segment receptors. Annu. Rev. Biochem., 60, 653688.[ISI][Medline]
Eidne, K.A., Sellar, R.E., Couper, G. et al. (1992) Molecular cloning and characterisation of the rat pituitary gonadotropin releasing hormone (GnRH) receptor. Mol. Cell. Endocrinol., 90, R5R9.[ISI][Medline]
Fink, G. (1988) In Knobil, E. and Neill, J.D. (eds), The Physiology of Reproduction. Raven Press, New York, pp. 13491377.
Hazum, E. and Conn, P.M. (1988) The molecular mechanism of GnRH action. I. The GnRH receptor. Endocr. Rev., 9, 379386.[ISI][Medline]
Huckle, W.R. and Conn, P.M. (1988) Molecular mechanism of gonadotropin releasing hormone (GnRH) action. II. The effector system, Endocr. Rev., 9, 387395.[ISI][Medline]
Iwashita, M. and Catt, K.J. (1985) Photoaffinity labelling of pituitary and gonadal receptors for gonadotropin releasing hormone. Endocrinology, 117, 738746.[Abstract]
Kaiser, U.B., Zhao, D., Cardona, G.R. et al. (1992) Isolation and characterisation of cDNAs encoding the rat pituitary gonadotropin releasing hormone receptor. Biochem. Biophys. Res. Commun., 189, 16451652.[ISI][Medline]
Kakar, S.S. and Jennes, L. (1995) Expression of gonadotropin-releasing hormone and gonadotropin-releasing hormone receptor mRNAs in various non-reproductive human tissues. Cancer Lett., 98, 5762.[ISI][Medline]
Kakar, S.S., Musgrove, L.C., Devor, D.C. et al. (1992) Cloning, sequencing and expression of human gonadotropin releasing hormone (GnRH) receptor. Biochem. Biophys. Res. Commun., 189, 289295.[ISI][Medline]
Karande, A.A., Rajeshwari, K., Schol, D.J. et al. (1995) Establishment of immunological probes to study human gonadotropin-releasing hormone receptors. Mol. Cell. Endocrinol., 114, 5156.[ISI][Medline]
Khodr, G.S. and Siler Khodr, T.M., (1978) The effect of luteinizing hormone-releasing factor on human chorionic gonadotropin secretion. Fert. Steril., 30, 301304.[ISI][Medline]
Lin, L.S., Roberts, V.J and Yen, S.S.C. (1995) Expression of human gonadotropin-releasing hormone receptor gene in the placenta and its functional relationship to human chorionic gonadotropin secretion. J. Clin. Endocrinol. Metab., 80, 580584.[Abstract]
Lowry, O.H., Rosebrough, N.J., Farr, A.L. et al. (1951) Protein measurement with the Folin phenol reagent. J. Biol. Chem., 193, 265275.
Mathialagan, N. and Rao, A.J. (1986) Gonadotropin releasing hormone (GnRH) stimulates both secretion of human Chorionic Gonadotropin (hCG) by first trimester human placental minces in vitro. Biochem. Int., 13, 757765.[ISI][Medline]
Motoyamat, N., Dauterman, W.C. (1979) Comparative studies on the molecular weight of Glutathione S-Transferases from mammalian livers and an insect. Comp. Biochem. Physiol, 63B, 451454.
Nett, T.M., Crowder, M.E., Moss, G.E. et al. (1981) GnRHReceptor Interaction. V. Downregulation of pituitary receptors for GnRH in ovariectomized ewes by infusion of homologous hormone. Biol. Reprod., 24, 11451155.
Perrin, M.H., Bilezikjian L.M., Hoeger, C. et al. (1993) Molecular and functional characterisation of GnRH receptors cloned from rat pituitary and mouse pituitary tumor cell line. Biochem. Biophys. Res. Commun., 191, 11391144.[ISI][Medline]
Rao, A.J. and Moudgal, N.R. (1984) Effect of LHRH injection on serum chorionic gonadotropin levels in pregnant bonnet monkey (Macaca radiata). IRCS Med. Sci., 12, 11051106.
Rao, A.J. and Chakraborti, R. (1990) Effect of acute and chronic administration of gonadotropin releasing hormone agonist Buserelin, on serum chorionic gonadotropin, oestradiol-17ß and progesterone during early pregnancy in the South Indian Bonnet Monkey (Macaca radiata). Anim. Reprod. Sci., 22, 261269.
Reinhart, J., Mertz, L.M. and Catt, K.J. (1992) Molecular cloning and expression of cDNA encoding the murine gonadotropin releasing hormone receptor. J. Biol. Chem., 267, 2128121284.
Sambrook, D., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbour Laboratory, New York.
Stojilkovic S.S., Reinhart, J. and Catt, K.J. (1994) Gonadotropin-releasing hormone receptors: Structure and signal transduction pathways. Endocr. Rev., 15, 462499.[ISI][Medline]
Towbin, H.T., Staehelin, T. and Gordon, J. (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA, 76, 4350.
Tsutsumi, M., Zhou, W., Millar, R.P. et al. (1992) Cloning and functional expression of a mouse gonadotropin-releasing hormone receptor. Mol. Endocrinol., 6, 11631169.[Abstract]
Wheatley, M. and Hawtin, S.R. (1999) Glycosylation of G-protein-coupled receptors for hormones central to normal reproductive functioning: its occurrence and role. Hum. Reprod. Update, 5, 356364.
Wolfahrt, S., Kleine, B. and Rossmanith, W.G. (1998) Detection of gonadotropin releasing hormone and its receptor mRNA in human placental trophoblasts using in situ-reverse transcription polymerase chain reaction. Mol. Hum. Reprod., 5, 9991006.
Submitted on August 18, 1999; accepted on January 27, 2000.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
M. R. Silver, N. V. Nucci, A. R. Root, K. L. Reed, and S. A. Sower Cloning and Characterization of a Functional Type II Gonadotropin-Releasing Hormone Receptor with a Lengthy Carboxy-Terminal Tail from an Ancestral Vertebrate, the Sea Lamprey Endocrinology, August 1, 2005; 146(8): 3351 - 3361. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.A. Bramley, K. Campbell, and G.S. Menzies Human placental GnRH-like factors: II. Inhibition of enzymatic degradation of GnRH-II and [D-Trp6]GnRH ethylamide tracers by human term placental cytosol fractions reveals the presence of GnRH-binding protein(s) Mol. Hum. Reprod., May 1, 2003; 9(5): 291 - 300. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rama and A.J. Rao Embryo implantation and GnRH antagonists: The search for the human placental GnRH receptor Hum. Reprod., February 1, 2001; 16(2): 201 - 205. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wolfahrt, B. Kleine, H. Jarry, and W. G. Rossmanith Endogenous regulation of the GnRH receptor by GnRH in the human placenta Mol. Hum. Reprod., January 1, 2001; 7(1): 89 - 95. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








