Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Brekhman, V.
Right arrow Articles by Seligman, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brekhman, V.
Right arrow Articles by Seligman, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Human Reproduction, Vol. 6, No. 5, 465-468, May 2000
© 2000 European Society of Human Reproduction and Embryology


Embryo development

The DAZL1 gene is expressed in human male and female embryonic gonads before meiosis

Vera Brekhman1, Josef Itskovitz-Eldor1, Elena Yodko2, Michael Deutsch1 and Judith Seligman1,3

1 Developmental Biology Laboratory, Dept. OB/GYN, Rambam Medical Center, POB 9602 Haifa 31096, and 2 Department of Pathology, Rambam Medical Center and The Rappaport Faculty of Medicine, Technion – Israel Institute of Technology, Israel

Abstract

The human DAZL1 gene (known also as DAZH or DAZLA) is the autosomal homologue of the Y-chromosomal DAZ gene which has been found to be deleted in azoospermic males. Evidence suggests that the role of DAZL1 may not be restricted to spermatogenesis, but may include oogenesis as well. In order to study the function of human DAZL1 gene in the ovary, we observed its expression pattern during embryonic development. RNA in-situ hybridization showed that DAZL1 transcripts were localized to a subset of cells (somatic versus germ cells) in human embryonic ovary (23 weeks of gestation) and testis (21 weeks gestation). In the ovary, DAZL1 transcripts were found in oogonia and in oocytes and granulosa cells of primordial follicles. In the testis, DAZL1 transcripts were identified exclusively in the germ cells. Our results demonstrate high similarity between the human DAZL1 and the mouse Dazl1 gene expression patterns during embryonic development, suggesting that the human gene functions at the first phase of gametogenesis, just as in the mouse, where Dazl1 mutations cause male and female sterility.

DAZL1/embryonic gonad/meiosis/oogenesis/spermatogenesis

Introduction

The DAZ (deleted in azoospermia) gene on the long arm of the Y chromosome (Reijo et al., 1995Go) may be the most thoroughly studied pure male sterile locus in humans. Although no human DAZ point mutants have been reported, strong evidence suggests that this gene is involved in early spermatogenesis. Firstly, Drosophila and mouse mutants that have lost DAZ homologous gene function (boule and Dazl1 respectively) were found to be azoospermic, just as with human azoospermia (Eberhart et al., 1996Go; Ruggiu et al., 1997Go). Secondly, DAZ homologous genes were found in many vertebrates (Reijo et al., 1995Go, 1996Go; Cooke et al., 1996Go; Saxena et al., 1996Go; Shan et al., 1996Go; Yen et al., 1996Go; Houston et al., 1998Go) in which they appear to be expressed in the testis, exclusively in spermatogonia (Menke et al., 1996Go; Niederberger et al., 1997Go).

From the evolutionary point of view, the Y chromosomal DAZ gene arose from the DAZL1 gene on chromosome 3 via a series of structural transformations (Saxena et al., 1996Go). A recent study of DAZ and DAZL1 sequences suggested that the Y-linked DAZ plays either a limited or little role in human spermatogenesis (Agulnik et al., 1998Go). These studies imply that the DAZL1 gene is the main functional locus. Indeed, the human DAZL1 and mouse Dazl1 autosomal genes show higher similarity in nucleotide sequences compared with the two human genes (DAZ/DAZL1). Within the 82 residue RNA-binding domain, the products of human DAZL1 and mouse Dazl1 differ by only one amino acid substitution, while both differ from human Y-encoded DAZ at nine residues. In addition, DAZ has a variable number of copies of a 72 nucleotide repeat unit termed `DAZ repeat', whereas the human DAZL1 and the mouse Dazl1 has only one copy of this motif (Saxena et al., 1996Go; Seboun et al., 1997Go).

The DAZ gene expresses only in the testis, whereas the human DAZL1 and the mouse Dazl1 express in testes and ovaries (Cooke et al., 1996Go; Saxena et al., 1996Go; Seligman and Page, 1998Go). We previously showed that Dazl1 expresses during mouse embryonic developing male and female gonads well before the onset of meiosis, suggesting that Dazl1 functions at the first phase of gametogenesis at the differentiation, proliferation and/or maintenance of primordial germ cells and their substitutes (Seligman and Page, 1998Go). Our expression results are supported by recent evidence showing that the mouse Dazl1 is essential for the differentiation of male and female germ cells. As expected, disruption of the Dazl1 gene leads to loss of germ cells and complete absence of male and female gamete production (Ruggiu et al., 1997Go).

The DAZL1 protein was found in the cytoplasm of follicular human oocytes (Nishi et al., 1999Go). However, little is known about the embryonic expression, transcription units and cellular mechanisms of the human DAZL1 gene. Here, we wanted to examine the localization of DAZL1 transcripts during gonad embryonic development and compare the human and the mouse gene expression. We have localized DAZL1 transcription units in human gonads (testes and ovaries) from embryos at 15–25 weeks gestation by RNA in-situ hybridization. We observed high similarity between the human DAZL1 and mouse Dazl1 gene expression during early embryonic development; they both express in early developing male and female germ cells (prospermatogonia and oogonia respectively). Our results suggest that the human and the mouse genes exhibit similar, if not identical, function at the first phase of male and female gametogenesis.

Materials and methods

Embryo tissue dissections
Human gonads were obtained from aborted fetuses after the patients had signed a concession agreement. The human embryonic gonad work was approved by the Institutional Ethics Committee. Gonads from embryos at 15–25 weeks gestation were isolated and fixed immediately in 4% formalin to prepare paraffin-embedded cross-sections or frozen in liquid nitrogen for RNA extraction. Mouse embryonic gonads were obtained from C57BL/6J mating mice. For all mouse embryo dissections the appearance of the vaginal plug was calculated as 0.5 days post-coitum.

RNA extraction and reverse transcription–polymerase chain reaction (RT–PCR)
RNA samples were extracted from various human and mouse embryonic tissues using Trizol reagent (Gibco BRL, Grand Island, NY, USA) according to the manufacturer's instruction. Briefly, gonads were suspended in 1 ml Trizol, and 0.2 volumes of chloroform were added to each sample. After centrifugation to remove cell debris, RNA in the supernatant was precipitated with isopropanol, rinsed with ethanol, and resuspended in deionized water. These RNA samples were used to amplify the 335 bp fragment of human DAZL1 and mouse Dazl1 by RT–PCR (cDNA cycle kit; Invitrogen) by using a forward primer F1: 3' AGCCACGTCCTTTGATTTT 5' and a reverse primer R1: 3' TAAGCACTGCCCGACTTCTT 5'. The gene encoding ß-actin was used as a reference reaction using a forward primer: 3' CGACGAGGCCCAGAGCAAGAGAGG 5' and a reverse primer: 3' CGTCAGGCAGCTCATAGCTCTTCTCCAGGG 5'.

In-situ hybridization
To identify human DAZL1 and mouse Dazl1 we used a 335 bp fragment from the mouse Dazl1 cDNA including Dazl1 repeat region. This 335 bp fragment was amplified by PCR using a forward primer F1 containing SP6 promoter sequence at its 3' end and a reverse primer R1 containing T7 promoter sequence at its 3' end. We labelled the probes with SP6 and T7 digoxygenin-RNA labelling kit (Roche Molecular Biochemicals) for antisense and sense probe respectively. Hybridization to gonad sections was performed according to a well-established method (Komminoth et al., 1992Go). Slides were reacted with anti-digoxygenin antibodies and developed with NBT/BCIP reagents following Fast red staining.

Results

To compare the human DAZL1 and mouse Dazl1 expression pattern during development, RNA samples were extracted from various human embryonic tissues from ~week 23 of gestation and from mouse embryonic tissues of 14.5 days post-coitum. These RNA samples were used to amplify a 335 bp fragment of human DAZL1 and mouse Dazl1 by RT–PCR. As shown in Figure 1Go, the human DAZL1 and the mouse Dazl1 are both expressed in the human embryonic testis and ovaries. No amplification was found in the embryonic kidney, liver and lung (see Figure 1Go).



View larger version (45K):
[in this window]
[in a new window]
 
Figure 1. Analysis of human DAZL1 (A) and mouse Dazl1 (B) expression in embryonic testis, ovary, kidney, liver and lung by reverse transcription–polymerase chain reaction (RT–PCR). RNA samples were isolated from human fetuses at ~23 weeks gestation and from C57BL/6J mouse at 14.5 days post-coitum. A 335 bp fragment represents the human DAZL1 and mouse Dazl1. The gene encoding ß-actin was used as a reference reaction.

 
To characterize more precisely the expression of DAZL1 by specific germ cell types, we performed direct in-situ hybridization on sections of human embryonic ovaries and testes. We used the 335 bp PCR product from DAZL1 cDNA as a probe. This fragment was amplified by PCR using a forward primer F1 containing SP6 polymerase promoter sequence (for antisense probe) and a reverse primer R1 containing T7 polymerase promoter (for sense probe). Digoxygenin-labelled DAZL1 probes (sense and antisense) were allowed to hybridize within sections of normal embryonic ovary isolated from a fetus at 23 weeks gestation (Figure 2Go) and a testis from a fetus at 21 weeks gestation (Figure 3Go). As shown in Figure 2A,CGo, DAZL1 transcripts were detected in oogonia and in oocytes and granulosa cells of primordial follicles by DAZL1 antisense probe. In some of the oocytes, DAZL1 was abundant in the nucleus and in others DAZL1 was predominantly present in the cytoplasm or in both nucleus and the cytoplasm. As shown in Figure 2B,DGo, no reaction was observed in oogonia and follicles by hybridization with the sense probe (control reaction). In the testis, transcripts were identified exclusively in germ cells (Figure 3AGo). As shown in Figure 3BGo, no staining was observed in germ cells by hybridization with the sense probe (control reaction).



View larger version (164K):
[in this window]
[in a new window]
 
Figure 2. Localization of DAZL1 transcripts in embryonic ovary. Digoxygenin-labelled sense and antisense DAZL1 probes were allowed to hybridize with cross-sections of an ovary from a fetus at 23 weeks gestation. (A,C) Hybridization with antisense probe; (B,D) hybridization with sense probe (control); (A,B) low power magnification (x400); (C,D) high power magnification (x1000). Arrow = primordial follicle; arrowhead = oogonia.

 


View larger version (131K):
[in this window]
[in a new window]
 
Figure 3. Expression of DAZL1 in embryonic testis. Digoxygenin-labelled sense and antisense DAZL1 probes were allowed to hybridize with cross-sections of a testis from a fetus at 21 weeks gestation. (A) Hybridization with antisense probe; (B) hybridization with sense probe (control). Arrow = germ cell; arrowhead = Sertoli cell.

 
Discussion

Once the germ cells initiate sexual differentiation at ~7 weeks gestation in the human (13.5 days post-coitum in the mouse), the subsequent kinetics of germ cell development show a dramatic sexual dimorphism: oogonia enter meiotic prophase, while prospermatogonia continue to divide mitotically (McCarrey, 1993Go). In the ovarian sections at 15–25 weeks gestation, some oogonia have not entered meiosis, some oogonia have started meiosis and primordial follicles (arrested in meiotic prophase I). Prospermatogonia are present at this time in the testis, most of them are quiescent in mitosis. Here, we show that DAZL1 transcripts are localized in germ cells before meiosis and at the time meiosis commences. We could not study earlier stages of gonad development because of the difficulty in obtaining these tissues from humans. However, it is most likely that the human DAZL1 gene is expressed earlier during development before germ cell sexual differentiation, such as in the mouse in primordial germ cells (Seligman and Page, 1998Go).

Numerous genes are known to be expressed exclusively in male or female germ cells, mainly in meiotic or post-meiotic cells, but not in these earliest stages of gametogenesis (Hecht, 1993Go). The expression of human DAZL1 gene in both male and female germ cells so early during embryonic development is unusual. In the mouse, few genes are known to be expressed exclusively in male and female germ cells early during gametogenesis, but no human homologous genes were studied. The mouse germ cell nuclear antigen (GCNA1) expresses in primordial germ cells, and later in oogonia and prospermatogonia, such as the DAZL1 gene, but no DNA sequences of this antigen are available (Enders and May, 1994Go). The TIAR gene, which is also an RNA-binding protein such as DAZL1, was found to be expressed in primordial germ cells (Beck et al., 1998Go). Male and female mutant mice for TIAR are sterile, similar to Dazl1 mutant mice. However, it seems that TIAR does not function exclusively in gonads since mice mutant for this gene also exhibit other abnormalities such as growth deficit and high mortality (Beck et al., 1998Go).

The DAZL1 transcripts in the ovary are not restricted to germ cells, but include the somatic cells of the primordial follicle (granulosa cells). A similar expression of the mouse Dazl1 protein in the ovary has been shown previously by using antibodies (Ruggiu et al., 1997Go). The granulosa cells are in tight connection with the oocyte throughout gap junctions which allow the passage of proteins and RNA samples between the oocyte and granulosa cells. That is why it is not surprising that DAZL1 is also localized in granulosa cells. There is not much information about DAZL1 transcription units in the ovary. It is possible that different transcripts are present in ovarian germ cells and in the granulosa cells. We have previously identified in the human ovary a major 4.5 kb DAZL1 transcript, while in the testis a 3.5 kDa transcript is the most abundant transcript. Only very low levels of the 4.5 kb transcript were identified in the testis (Seligman and Page, 1998Go). The biological significance and function of the 3.5 and 4.5 kb transcription units remain to be studied.

It is probable that human DAZL1 and the mouse Dazl1 proteins perform similar functions in early gametogenesis processes. Our results suggest that the DAZL1 locus may be involved in infertility cases in humans. Mutation analysis and linkage studies of this locus in families with recessive inheritance pattern of infertility are needed to evaluate the role of the DAZL1 gene in infertility incidences in humans.

Acknowledgments

We thank Dr Raymond Coleman for advice and Ludmila Mazor for tissue cross-section preparation. We thank OB/GYN department staff for their assistance in this research.

Notes

3 To whom correspondence should be addressed Back

References

Agulnik, A.I., Zharkikh, A., Boettger-Tong, H. et al. (1998) Evolution of the DAZ gene family suggests that Y-linked DAZ plays little, or a limited, role in spermatogenesis but underlines a recent African origin for human populations. Hum. Mol. Genet., 7, 1371–1377.[Abstract/Free Full Text]

Beck, A.R.P., Miller, I.J., Anderson, P. et al. (1998) RNA-binding protein TIAR is essential for primordial germ cell development. Proc. Natl Acad. Sci. USA, 95, 2331–2336.[Abstract/Free Full Text]

Cooke, H.J., Lee, M., Kerr, S. et al. (1996) A murine homologue of the human DAZ gene is autosomal and expressed only in male and female gonads. Hum. Mol. Genet., 5, 513–516.[Abstract/Free Full Text]

Eberhart, C.G., Maines, J.Z. and Wasserman, S.A. (1996) Meiotic cell cycle requirement for the fly homolog of human deleted in azoospermia. Nature, 381, 783–785.[Medline]

Enders, G.C. and May, II J.J. (1994) Developmentally regulated expression of a mouse germ cell nuclear antigen examined from embryonic day 11 to adult in male and female mice. Dev. Biol., 163, 331–340.[Web of Science][Medline]

Hecht, N.B. (1993) Gene expression during male germ cell development. In Desjardins, C. and Ewing, L.L. (eds), Cell and Molecular Biology of the Testis. Oxford University Press, New York, USA, pp. 400–432.

Houston, D.W., Zhang, J., Maines, J.Z. et al. (1998) A Xenopus DAZ-like gene encodes an RNA component of germ plasm and is a functional homologue of Drosophila boule. Development, 125, 171–80.[Abstract]

Komminoth, P., Merk, F.B., Leav, I. et al. (1992) Comparison of 35S- and digoxygenin-labeled RNA and oligonucleotide probes for in situ hybridization. Expression of mRNA of the seminal vesicle secretion protein II and androgen receptor genes in the rat prostate. Histochemistry, 98, 217–28.[Web of Science][Medline]

McCarrey, J.R. (1993) Development of the germ cell. In Desjardins, C. and Ewing, L.L. (eds), Cell and Molecular Biology of the Testis. Oxford University Press, New York, USA, pp. 58–89.

Menke, D.B., Mutter, G.L. and Page, D.C. (1996) Expression of DAZ, an azoospermia factor candidate, in human spermatogonia. Am. J. Hum. Genet., 60, 237–241.

Niederberger, C., Agulnik, A.I., Cho, Y. et al. (1997) In situ hybridization shows that Dazla expression in mouse testis is restricted to premeiotic stages IV–VI of spermatogenesis. Mamm. Genome, 8, 277–278.[Web of Science][Medline]

Nishi, S., Hoshi, N., Kasahara, M. et al. (1999) Existence of human DAZLA protein in the cytoplasm of human oocytes. Mol. Hum. Reprod., 5, 495–497.[Abstract/Free Full Text]

Reijo, R., Lee, T.Y., Salo, P. et al. (1995) Diverse spermatogenic defects in humans caused by the Y chromosome deletions encompassing a novel RNA-binding protein gene. Nature Genet., 10, 383–393.[Web of Science][Medline]

Reijo, R., Seligman, J., Dinulos, M.B. et al. (1996) Mouse autosomal homolog of DAZ, a candidate male sterility gene in humans, is expressed in male germ cells before and after puberty. Genomics, 35, 346–352.[Web of Science][Medline]

Ruggiu, M., Speed, R., Taggart, M. et al. (1997) The mouse Dazla gene encodes a cytoplasmic protein essential for gametogenesis. Nature, 389, 73–77.[Medline]

Saxena, R., Brown, L.G., Hawkins,T. et al. (1996) Origins of the DAZ gene cluster on the human Y chromosome: an autosomal gene was transposed, then repeatedly amplified and pruned. Nature Genet., 14, 292–299.[Web of Science][Medline]

Seboun, E., Barbaux, S., Bourgeron, T. et al. (1997) Gene sequence, localization, and evolutionary conservation of DAZLA, a candidate male sterility gene. Genomics, 41, 227–235.[Web of Science][Medline]

Seligman, J. and Page, D.C. (1998) The Dazh gene is expressed in male and female embryonic gonads before germ cell sex differentiation. Biochem. Biophys Res. Commun., 245, 878–882.[Web of Science][Medline]

Shan, Z., Hirschmann, P., Seebacher, T. et al. (1996) A SPGY copy homologous to the mouse gene Dazla and the Drosophila gene boule is autosomal and expressed only in the human male gonad. Hum. Mol. Genet., 5, 2005–2011.[Abstract/Free Full Text]

Yen, P.H., Chai, N.N. and Salido, E.C. (1996) The human autosomal gene DAZLA: testis specificity and a candidate for male infertility. Hum. Mol. Genet., 5, 2013–2017.[Abstract/Free Full Text]

Submitted on October 7, 1999; accepted on February 8, 2000.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol Hum ReprodHome page
X.-J. Yang, T. Shinka, S. Nozawa, H.-T. Yan, M. Yoshiike, M. Umeno, Y. Sato, G. Chen, T. Iwamoto, and Y. Nakahori
Survey of the two polymorphisms in DAZL, an autosomal candidate for the azoospermic factor, in Japanese infertile men and implications for male infertility
Mol. Hum. Reprod., July 1, 2005; 11(7): 513 - 515.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
G. Cauffman, H. Van de Velde, I. Liebaers, and A. Van Steirteghem
DAZL expression in human oocytes, preimplantation embryos and embryonic stem cells
Mol. Hum. Reprod., June 1, 2005; 11(6): 405 - 411.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
A. T. Clark, M. S. Bodnar, M. Fox, R. T. Rodriquez, M. J. Abeyta, M. T. Firpo, and R. A. R. Pera
Spontaneous differentiation of germ cells from human embryonic stem cells in vitro
Hum. Mol. Genet., April 1, 2004; 13(7): 727 - 739.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
H.A. Pan, S.J. Tsai, C.W. Chen, Y.C. Lee, Y.M. Lin, and P.L. Kuo
Expression of DAZL protein in the human corpus luteum
Mol. Hum. Reprod., June 1, 2002; 8(6): 540 - 545.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
Y. M. Lin, C. W. Chen, H.S. Sun, S. J. Tsai, C. C. Hsu, Y. N. Teng, J. S. N. Lin, and P. L. Kuo
Expression patterns and transcript concentrations of the autosomal DAZL gene in testes of azoospermic men
Mol. Hum. Reprod., November 1, 2001; 7(11): 1015 - 1022.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Brekhman, V.
Right arrow Articles by Seligman, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brekhman, V.
Right arrow Articles by Seligman, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?