Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (17)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Goodwin, L. O.
Right arrow Articles by Pergolizzi, R. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Goodwin, L. O.
Right arrow Articles by Pergolizzi, R. G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Human Reproduction, Vol. 6, No. 6, 487-497, June 2000
© 2000 European Society of Human Reproduction and Embryology


Testis and spermatogenesis

Presence of N-cadherin transcripts in mature spermatozoa*

Leslie O. Goodwin1,3, David S. Karabinus2 and Robert G. Pergolizzi1

1 Department of Research, North Shore University Hospital-New York University School of Medicine, Manhasset, New York, and 2 Department of Obstetrics & Gynecology, The University of Arizona, Tucson, AZ, USA

Abstract

The essential mechanism involved in sperm–oolemma fusion has yet to be elucidated. Recognition and binding is initiated by specific cell surface receptor engagement between gametes. Fusion between hamster oolemma and spermatozoa is prevented in the presence of trypsin in Ca2+-free media, as is oocyte activation, implicating a cadherin-like adhesion. Cadherins are a family of Ca2+-dependent adhesion molecules that bind homotypically with their target, are morphoregulatory and function eptopically to affect tissue form and function. Cadherins and cadherin-associated molecules have been identified in testes and germinal cells, as well as ejaculated spermatozoa. Moreover, cadherins are also present in oocytes and may suggest a cadherin-mediated adhesion in sperm–oocyte interaction. We have detected antigenic epitopes recognized by N-cadherin monoclonal antibodies diffusely distributed over the entire sperm head. In addition, Western blot analysis confirmed the presence of an antibody reactive peptide in spermatozoa, testis and ovary protein extracts at the expected molecular weight for authentic N-cadherin. Total RNA was isolated from mature motile spermatozoa, as well as ovary and testis tissue, and served as template for reverse transcription–polymerase chain reaction (RT–PCR) with N-cadherin specific primers. Alignment of sequences from PCR products of testis, ovary and spermatozoa with published N-cadherin sequence was identical except for occasional base changes. We intend to develop methods to analyse this transcript from small numbers of spermatozoa from a variety of donors to determine if defects in cadherin distribution or structure may predict reduced male fertility.

adhesion/cadherins/RNA extraction from spermatozoa/sperm-oocyte fusion mechanisms

Introduction

The species-specific recognition and binding of spermatozoa to an oocyte is the initiating step in the process of fertilization. The binding and penetration of the zona pellucida by the spermatozoa is a prerequisite to fusion with the egg plasma membrane, the oolemma. An extensive literature exists on the events and molecules involved in sperm–zona binding (Miller and Ax, 1990Go; Wassarman, 1990Go; Bleil, 1991Go; Dunbar et al., 1991Go; Benoff, 1997Go; Oehninger et al., 1997Go) which activates a signalling cascade mediated through G-proteins (Benoff, 1998Go) and tyrosine phosphorylation (Goodwin et al., 1998aGo) that culminates in the acrosome reaction (AR). The AR is necessary for zona-bound spermatozoa to penetrate this structure and gain access to the oolemma (Liu and Baker 1994aGo,bGo; Benoff et al., 1996Go). Unlike sperm–zona binding, the molecules and events involved with sperm–oolemma binding and fusion governing initiation of embryonic development are poorly understood (Yanamagachi, 1994).

In contrast to mouse oolemma sensitivity to protease treatment (Boldt et al., 1988Go), a recent study demonstrated uninhibited fusion of hamster oolemma with spermatozoa after oolemma exposure to protease and glycosidase treatment (Ponce et al., 1993Go). However, when trypsin digestion was used in Ca2+-free medium, fusibility between hamster oolemma and spermatozoa was significantly reduced (Ponce et al., 1993Go). This differential response to protease treatment conditions illustrates potential inter-species differences in fundamental sperm–oocyte fusion mechanisms; the sensitivity of fusion to Ca2+ in the medium is characteristic of the cadherin family of adhesion molecules. An analysis of adhesion molecules on the surface of human oocytes by indirect immunofluorescence has demonstrated the presence of several classes of these molecules including the integrins, cadherins and selectins (Almeida et al., 1995Go; Campbell et al., 1995Go; Fusi et al., 1996Go).

Cadherins are cell surface proteins that are Ca2+-dependent adhesion molecules and are essential for intercellular adhesive events (for review, see Takeichi, 1991, 1995). Cadherins bind in a homophilic manner and play a crucial role in cell–cell recognition and sorting preferences (Miyatani et al., 1989Go; Nose et al., 1990Go). The regulated expression of these adhesive molecules confers the ability to determine cell polarity and tissue morphology. Members of this family are differentially expressed in adult tissues (Nose et al., 1987Go; Matsunaga et al., 1988Go; Hirai et al., 1989aGo,bGo) and during embryogenesis, thus implicating cadherins as important regulators of morphogenesis (Hyafil et al., 1980Go; Hatta and Takeichi, 1986Go; Nose and Takeichi 1986Go; Duband et al., 1987Go; Hatta et al., 1987Go).

The cadherins have been identified as important transducers of positional information signals to the cytoplasm, initiating or potentiating dramatic changes in cellular differentiation (Gallin et al., 1986Go; Edelman 1989Go) and cytoskeletal reorganization (McNeill et al., 1990Go). Furthermore, cadherins themselves may convey signals regulating basic cellular processes including migration, proliferation, apoptosis and cell differentiation (for review, see Barth et al., 1997; Steinberg and McNutt, 1999). It has been noted that the ectopic expression of an individual cadherin type sorts or aggregates homotypically and induces specific cellular differentiation events leading to tissue segregation or formation (Marrs et al., 1995Go; Hermiston et al., 1996Go; Larue et al., 1996Go). The ecto-domain of cadherins, in the presence of Ca2+, show a conformational change from disordered to a rigid rod-like structure that form homodimers (cis-dimers) in the plane of the membrane (Shapiro et al., 1995Go; Pertz et al., 1999Go). These molecules are linked to the actin cytoskeleton by catenins which adjoin and tether the cadherins by binding to specific sites in the conserved cytoplasmic tail (Mathur et al., 1994; Takeichi, 1995; for review, see Barth et al., 1997). Cadherin-mediated cell–cell adhesion is regulated in part by the Rho family GTPases (for review, see Kaibuchi et al., 1999). The model of cell–cell adhesion is modulated from a weak to a strong attachment (Takeda et al., 1995Go; Angres et al., 1996Go) by the lateral clustering (Yap et al., 1997Go; Katz et al., 1998Go) or by co-operative interactions of the cadherin cis-dimers (Brieher et al., 1996Go) forming a trans-dimer zipper of multiple cis-dimers with its binding partner (Pertz et al., 1999Go). This adhesive aggregation of the ectodomain is then further stabilized by cadherin cytodomain association and interaction with catenins and cytoskeletal elements (for review, see Steinberg and McNutt 1999). The catenins have been shown to interact with several signalling pathways that include tyrosine kinases and phosphatases (Barth et al., 1997Go; Daniel and Reynolds, 1997Go) and Wnt/Wingless pathway (evolutionary conserved) which is involved in cell lineage decisions, axis formation, central nervous system development and pattern formation (Herman et al., 1995Go; Kirkpatrick and Peifer, 1995Go; Miller and Moon, 1996Go). The dynamic interplay between signalling and cytoskeletal complexes regulates adhesion as well as their basic cellular developmental processes including migration, proliferation, apoptosis and cell differentiation (for review, see Huber et al., 1996).

The presence of N-cadherin (Volk and Geiger, 1984Go) but not E-cadherin (Gumbiner and Simons, 1986Go) in human seminiferous epithelium and on the surface of spermatogonia and primary spermatocytes has been demonstrated by immunoblotting and immunofluorescence respectively (Andersson et al., 1994Go). This presented the intriguing possibility that a homophilic interaction between human oocytes and spermatozoa may be effected through the surface binding of N-cadherins. The presence of N-cadherin adhesion molecules on motile ejaculated spermatozoa has been detected with N-cadherin monoclonal antibody (Goodwin et al., 1998bGo; this report). Cadherin adhesion molecules on human oocytes and spermatozoa have also been detected using an anti-pan-cadherin antibody (Rufas et al., 2000Go). In addition, specific localization of N- and E-cadherin molecules on the human sperm head have been examined using specific antibodies (Rufas et al., 2000Go). To date there has been no report on the expression of N-cadherin transcripts in ejaculated spermatozoa. Here, we report the detection of the presence of N-cadherin transcripts by reverse transcription–polymerase chain reaction (RT–PCR) from RNA extracted from fresh and cryopreserved mature motile spermatozoa, in parallel we have shown the presence of this protein in human testis, ovary and spermatozoa by immunoblotting and surface expression of N-cadherin on motile spermatozoa by immunocytochemistry.

Materials and methods

Products and reagents
All PCR reagents were purchased from Perkin-Elmer (Foster City, CA, USA). All other enzymes were obtained from New England Biolabs (Beverly, MA, USA). The 1 Kb DNA ladder molecular weight markers were purchased from Gibco (GibcoBRL, Grand Island, NY, USA). Unless otherwise noted, all other reagents were purchased from Sigma Chemical Co (St Louis, MO, USA).

Human semen specimens
All protocols employing human semen specimens were reviewed and approved by the Arizona Health Sciences Center Human Subjects Committee. Semen specimens from number coded fertile donors were collected by masturbation and allowed to liquefy for up to 1 h after collection. Sperm concentration and motility were then evaluated using a computer-assisted semen analysis (CASA) system (Motion Analysis, Santa Rosa, CA, USA) as previously described (Gonzalez-Estrella et al., 1994Go). Only fresh specimens with the following characteristics were used in these studies: >50x106 spermatozoa/ml, >50% motility, and >10% normal forms as determined by morphological evaluation using strict criteria (Kruger et al., 1988Go). Stained smears prepared from raw specimens were evaluated for the incidence of immature forms, as indicated by the presence of any residual cytoplasm in the sperm head–neck region, as previously described (Goodwin et al., 2000Go). For RNA recovery, raw semen specimens were divided into two parts: one for RNA extraction from fresh spermatozoa, the other for RNA extraction from cryopreserved spermatozoa.

To recover a highly viable population of motile spermatozoa from fresh specimens for immunofluorescence studies and RNA extraction, raw semen was diluted with warmed Ham's F-10 medium supplemented with 2.5% (w:v) human serum albumin (HSA; Baxter Healthcare, McGaw Park, IL, USA). Diluted semen was divided equally among four sterile conical tubes (Falcon 2059; Becton Dickenson Labware, Franklin Lakes, NJ, USA) and centrifuged for 10 min at 300 g. After discarding the supernatant, the sperm pellets were overlaid with fresh HSA-supplemented medium and the spermatozoa were allowed to swim-up for 60 min at 37°C. The overlays were then gently aspirated so as not to disturb the pellet, combined in a sterile tube, and evaluated using CASA. The appropriate number of spermatozoa were transferred volumetrically for immunofluorescence or RNA extraction.

Spermatozoa were cryopreserved by diluting raw semen with an equal volume of TEST Yolk Buffer (TYB; Irvine Scientific, Irvine, CA, USA) and allowing diluted semen to equilibrate for 15 min at room temperature. After packaging diluted semen in 0.05 ml cryostraws (IMV, l'Aigle, France), semen was cooled for 90 min at 4°C, suspended in liquid nitrogen vapour for 15 min, then plunged into liquid nitrogen for storage.

For preparing cryopreserved spermatozoa for RNA extraction, straws were thawed at room temperature and emptied into a round bottom centrifuge tube. After CASA evaluation, frozen–thawed semen was diluted with warmed 37°C Ham's F-10 supplemented with 5% HSA and centrifuged for 10 min at 300 g. The supernatant was discarded and the sperm pellets were resuspended to 4.0 ml with HSA-supplemented Ham's F-10. The sperm suspension (1 ml) was layered over each of four two layer discontinuous Percoll (Sigma Chemical Co) columns (95 and 47.5%) as previously described (Karabinus and Gelety, 1997Go). The bottom layers were pooled after centrifugation, diluted with HSA-supplemented Ham's F-10, washed, resuspended in HSA-supplemented Ham's F-10, and evaluated using CASA. The appropriate number of spermatozoa were then transferred volumetrically for RNA extraction.

Isolation of human tissue RNA
Total RNA was isolated from various human tissues (ovary and testis), obtained at autopsy, using guanididium isothiocyanate following a modified protocol (Chomcznski and Sacchi, 1987Go) as previously described (Goodwin et al., 1997Go). The purity and percentage recovery of the RNA was determined spectrophotometrically.

Human testis polyA+ RNA
Human testis polyA+ RNA was purchased from Clontech (Palo Alto, CA, USA). The polyA+ RNA was from a pool of samples from 20 individuals aged 2–70 years, and purified using a modification of the guanidium thiocyanate RNA purification method (Chomcynski and Sacchi, 1987) and oligo (dT) cellulose columns (Sambrook et al., 1989Go). Each lot of polyA+ RNA was checked for integrity on denaturing agarose gel.

Human sperm RNA extraction
RNA extraction was performed using reagents from a Purescript RNA isolation kit (Gentra Systems, Inc, Minneapolis, MN, USA) using a modification of manufacturer instructions, as previously described (Goodwin et al., 2000Go). After preparation, as described above, spermatozoa recovered from raw or cryopreserved semen specimens (4.5–5x106 spermatozoa/tube) were pelleted in 1.5 ml polypropylene microcentrifuge tubes at 13 300 g for 20 s. The pellets were resuspended by vortexing and 300 µl of Cell Lysis Solution (Cat. No. R-5002; Gentra Systems) was added to the contents and gently resuspended three times, to lyse the cells. Then 12 µl of 1 mol/l dithiothreitol (DTT; Sigma Chemical Co) was added to each tube, inverted 25 times to mix and incubated for 4 h in a 55°C waterbath and mixed by periodic inversion. After cooling to room temperature 100 µl of Protein-DNA Precipitation Solution (Cat. No. R-5003; Gentra Systems Inc) was added to each tube, and placed in an ice bath for 5 min. Tubes were centrifuged for 3 min at 13 300 g, and the supernatant was removed and combined with 300 µl of isopropanol (2-propanol; Sigma Chemical Co), and the RNA was precipitated at –20°C for 1 h to overnight. The precipitated RNA was collected by centrifugation at 13 300 g for 30 min at 4°C and the supernatant discarded. The pellets were washed with 1 ml of 70% ethanol and centrifuged at 13 300 g for 5 min at 4°C, and the RNA pellet was resupended in sterile water and the RNA concentration determined spectrophotometrically, or visualized by electrophoresis and ethidium bromide staining on an 1.2% agarose gel.

The efficiency of RNA extraction was tested by increasing the number of spermatozoa extracted and holding the amount of extraction reagents constant. Spermatozoa recovered from two different fresh semen specimens provided by one donor were used. Each ejaculate was processed to recover RNA in three separate extractions using the following number of spermatozoa per extraction: two samples of 5x106 spermatozoa, two samples of 10x106 spermatozoa, and two samples of 20x106 spermatozoa, representing respectively, one-, two- and four times the recommended number of spermatozoa per extraction. The products of the paired extractions were pooled and the entire amount of the pooled products was used in the first strand cDNA reaction, keeping all volumes equal, and brought up in a final volume of 120 µl. The 5, 10 and 20 µl of each of the samples were used in two separate PCR experiments with specific primers for human gyceraldehyde-3-phosphate dehydrogenase (GAPDH). In each experiment, human testis cDNA served as the positive control. 10 µl of the 100 µl PCR reaction was electrophoresed in a 1.2% agarose gel containing ethidium bromide. To determine the relative intensity of the visualized ethidium bromide PCR products as a quantitative measure, a volume analysis of the individual PCR products visualized in each lane was performed using a Gel Doc video camera and Molecular Analyst software (BioRad Laboratories) that compared the PCR products obtained from the cDNA of the various concentrations of extracted spermatozoa with that of cDNA from testis. Triplicates of two individual PCR reactions were analysed (data not shown).

First strand synthesis
First strand cDNA was synthesized according to manufacturer's instructions using a Reverse Transcription System kit (Promega, Madison, WI, USA) as previously described (Goodwin et al., 1997Go). The reaction was incubated at 42°C for 60 min and a control vector containing an insert coding for kanamycin resistance gene was transcribed in parallel as a positive control.

PCR primers
Oligonucleotide primers were synthesized on an Applied Biosystems Model 394 DNA Synthesizer (Perkin-Elmer). Sets of primers (forward [F] and reverse [R]) were designed from previously published human N-cadherin cDNA sequence (Accession no. M34064; Walsh et al., 1990), human E-cadherin cDNA sequence (Accession no. Z13009; Bussemakers et al., 1993), and human GAPDH (Accession no. MI7851; Tso et al., 1985).

N-CADF1 (101F) 5' TGCGGTACAGTGTAACTGGGCCAGG

N-CADR1 (539R) 5' CGATCAAGTCCAGCTGCCACTGTC

E-CADF1 (660F) 5' TCTACAGCATCACTGCCCAAGGAGCTG

E-CADR1 (1135R) 5' AGCTTGAACCACCAGGGTATACGTAGG

GAPDHF (690F) 5' GGTCATCCCTGAGCTGAACG

GAPDHR (984R) 5' TTCGTTGTCATACCAGGAAAT

Generation of double-stranded cDNA
The above primers were used in PCR reactions with 50–100 ng human testis or ovary first strand cDNA, and 20 µl of human spermatozoa first strand cDNA (~6–10x106 spermatozoa) in a 100 µl reaction containing 1x Buffer (10 mmol/l Tris–HCl pH 8.3 and 50 mmol/l KCl), 10 mmol/l MgCl2, 200 µmol/l dNTP's, 5 IU Taq polymerase and 50 pmol/l each of the forward and reverse primers. The PCR reaction conditions for N-cadherin and E-cadherin were 94°C for 30 s, 72°C for 2 min for 45 cycles, and for GAPDH the conditions were 94°C for 30 s, 58°C for 30 s, 72°C for 1 min for 35 cycles in a Thermo-cycler model 9600 (Perkin-Elmer).

Cloning of PCR products
All PCR products were visualized by ethidium bromide staining of a 2% low melting point agarose gel and gel purified using Wizard PCR Preps (Promega, Madison, WI, USA) according to manufacturer's instructions. The purified PCR products were ligated into pT7 blue vector (Novagen, Madison, WI, USA) at 16°C overnight as previously described (Goodwin et al., 1997Go).

DNA sequence analysis
Selected clones were sequenced using automated DNA Sequencing System Model 373A (Applied Biosystems DNA Sequencer; Perkin-Elmer) following the manufacturer's protocols for fluorescence-based DNA sequencing with Taq polymerase. The sequencing primers were initiated at the nucleotide base indicated in Figure 6 and were the same primers used to generate the PCR product. Partial sequences were compiled and aligned with human N-cadherin sequence with MacVector 5.0 Program (Kodak, New Haven, CT, USA).

Indirect immunofluorescence cytochemistry
In all experiments, mouse monoclonal antibodies served as primary antibody. For the detection of N-cadherin antigenic epitopes, monoclonal antibody NCAD2 (CAMFolio, Cat. No. 550038; Becton Dickenson, San Jose, CA, USA) was used. This antibody recognizes a polypeptide sequence on human, bovine, porcine, and chicken neural cadherin (N-cadherin). Human spermatozoa were reacted sequentially with primary antibody and fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse immunoglobulin G (IgG, No. F-7634; Sigma Chemical Co) as a secondary antibody to detect bound mouse IgG as previously described (Goodwin et al., 1997Go). Localization patterns of human sperm N-cadherin labelling were assessed by inspection of mounted slides stored at 4°C for <2 weeks before analysis. Identical fields, phase contrast and epifluorescence, were photographed on 35 mm/400 ASA TMAX film (Eastman Kodak, Rochester, NY, USA).

Tissue extracts
Ovary and testis (0.5 g each) samples were obtained at autopsy, and stored in liquid nitrogen before use. The tissues were individually pulverized with a mortar and pestle under liquid nitrogen and scraped into tubes containing Laemmli sample buffer (Laemmli, 1970Go). The mixture was passed through a 23 gauge needle to shear DNA, heated in a boiling water bath for 5 min and analysed by sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE) on 7% pre-cast gels (Ready Gels; BioRad Laboratories). The protein concentration of the individual tissues was estimated following staining with Coomassie Blue dye.

Human sperm extracts
Snap frozen 1 ml aliquots of whole ejaculates or density gradient (as described above) purified spermatozoa were quickly thawed at 37°C and pipetted into glass round bottom centrifuge tubes with several ml of unsupplemented Ham's F-10 buffer and centrifuged at 800 g for 5 min. The supernatant was aspirated off and the pellet was resuspended in 100–200 µl of Laemmli's sample buffer, and transferred to microcentrifuge tubes. The pellet was resuspended and passed through a 23 gauge needle to facilitate shearing of DNA and the extract was centrifuged at 13 000 g for 15 min at 4°C, the supernatant retained and transferred to another tube and boiled for 5 min before loading on the gel.

SDS–PAGE and immunoblot analysis
SDS–PAGE was performed according to the method of Laemmli (1970) on 7% precast polyacrylamide gels as previously described (Goodwin et al., 1998cGo). Routinely, 10 µg of protein from ovary and testis were loaded on each gel. Gels were either stained with Coomassie Blue or transferred to nitrocellulose membrane (Trans blot; BioRad Laboratories), according to an established method (Towbin et al., 1979Go). The blots were blocked by 2% (v/v) Teleostean gelatin (Sigma Chemical Co) in PBST (1x PBS + 0.1% [v/v] Tween 20) for 1 h at room temperature. Primary antibody, monoclonal antibody NCAD2, was added at a predetermined dilution (1:100) in 2% (v/v) Teleostean gelatin/PBST for 1 h at room temperature. Blots were washed three times for 10 min each in PBST and incubated with biotinylated anti-mouse secondary antibody (Elite, Vectastain ABC kit; Vector Laboratories Inc, Burlingame, CA, USA) diluted (1:10 000) in 2% (v/v) Teleostean gelatin/PBST for 30 min at room temperature. After washing the blots three times again in PBST, a preformed macromolecular complex between avidin and biotinylated enzyme that still retains biotin-binding sites (Elite, Vectastain ABC kit; Vector Laboratories Inc) was added for 30 min at room temperature. The reaction was developed by using Renaissance Chemiluminescence Reagent (NEN Dupont, Boston, MA, USA) according to the manufacturer's instructions. The reaction was exposed to DuPont Reflection autoradiography film for 30 s and then viewed to determine the period of time required to expose the blot to film for optimal results.

Results

Identification of surface expression of N-cadherin by immunofluorescence staining of human prepared spermatozoa
We sought to determine whether the N-cadherin adhesion molecule was expressed on the surface of human spermatozoa. We reacted human spermatozoa with a mouse monoclonal antibody NCAD2 (Becton-Dickinson, San Jose, CA, USA) which is specific for human N-cadherin epitopes. All spermatozoa in the population stained faintly with monoclonal antibody NCAD2 (Figure 1CGo), while there was no labelling observed when the spermatozoa were exposed only to secondary antibody alone, demonstrating the specificity of the reaction (Figure 1DGo). The epitopes recognized by NCAD2 were detected over the entire head but appeared to be concentrated in the post-acrosomal region.



View larger version (82K):
[in this window]
[in a new window]
 
Figure 1. Immunocytochemical analysis of unfixed preparations of motile human spermatozoa from fertile donors. Comparison of the distribution of monoclonal antibody NCAD2 (A, C) with that of secondary antibody binding alone (B, D). Labelled spermatozoa were viewed at x400 and photographed at x1000 on 400 ASA film with exposure times for fluorescein of 50 s. (A, B) Phase contrast images of unfixed, Triton-permeabilized human spermatozoa. (C) NCAD2 binding is restricted to the head and post-acrosomal region of the spermatozoon. (D) There was no detectable signal with secondary antibody staining alone.

 
The protein identified by surface labelling on spermatozoa can be identified by immunoblot analysis of protein extracts of human spermatozoa
Proteins extracted from human spermatozoa in snap-frozen whole semen, spermatozoa recovered from washed semen, and human testis and ovary, were labelled by the specific binding of NCAD2 antibody to its cognate antigen. The results of immunoblotting indicated that N-cadherin protein was clearly present in these protein extracts (Figure 2Go). All lanes showed labelling of a peptide band at the expected molecular weight of N-cadherin ~135 kDa. The band is broad, consistent with a glycosylated protein. The protein extract from human ovary in lane 1 and human testis in lane 2 appeared to have comparable amounts of N-cadherin present, and the whole semen human sperm extract in lane 3 also contains readily visible antibody reactive polypeptide. Lane 4 contained protein extract from spermatozoa alone, recovered from semen by density gradient centrifugation and showed a weak but detectable signal upon prolonged exposure. It is of interest that the band detected in whole semen (sperm) extracts was as readily detectable as that seen in human ovary and testis.



View larger version (138K):
[in this window]
[in a new window]
 
Figure 2. Western blot analysis of human tissues and human spermatozoa. Proteins binding monoclonal antibody NCAD2 were detected by chemiluminescence as described in the text. Molecular weights of the protein standards indicated by dots on the left are, from top to bottom, 200, 126, 71, 42 and 32 kDa. The region of immunoreactivity in size-separated proteins was readily detectable as a single band at ~135 kDa. Lane 1 = human ovary; lane 2 = human testis; lane 3 = human whole semen protein extract; lane 4 = human density gradient isolated sperm protein extract.

 
Identification of a specific PCR product from first strand cDNA of frozen and fresh spermatozoa
Using primers specific to the 5' end of the N-cadherin transcript RT–PCR was performed on a variety of raw and frozen sperm samples processed for RNA extraction, the results of which are shown in Figure 3Go. Approximately 50 ng of first strand cDNA from human testis and ovary were used as template for PCR amplification using N-cadherin primers 101F and 539R, as positive controls. In parallel, 20 µl of human sperm cDNA from cryopreserved or fresh samples were also used as template. The products were electrophoresed on a 2% low melting point agarose gel containing ethidium bromide. The arrow indicates the position of the 438 bp PCR product amplified in human testis, ovary and human spermatozoa (both fresh and cryopreserved preparations) cDNA.



View larger version (56K):
[in this window]
[in a new window]
 
Figure 3. Analysis of polymerase chain reaction (PCR) amplification with N-cadherin specific primers 101F and 539R, of human testis (HT), human ovary (HO) and human sperm (HS) cDNA templates by agarose gel electrophoresis containing ethidium bromide. MW = molecular weight standards run in this lane, for reference a dot is placed next to the 506/517 and the 1018 marker. HS indicates 20 µl of paired human sperm cDNA extracts from either fresh (noted by R) or cryopreserved (noted by F) preparations from four different individuals. HT corresponds to a PCR amplicon when 50 ng of human testis cDNA is used as template and HO to the respective product when 50 ng of human ovary cDNA is used as template. The arrow indicates the position of the 438 bp PCR product amplified in human testis, ovary and human sperm cDNA.

 
The presence of an abundant 438 bp band in human testis and ovary and a less robust but easily detectable band from human sperm cDNA samples (Figure 3Go) indicate the relative quantities of N-cadherin transcript initially present in the respective tissues. The gene specific primers used in the PCR amplification were designed to traverse two intron-exon boundaries in the N-cadherin gene (exons 5–7; Wallis et al., 1994Go). This represents a total of 2.2 kb of genomic DNA, the expected size of the amplicon if the amplification was due to the presence of contaminating genomic DNA and not mRNA. In addition, we split one of the extracted RNA samples into half and performed first strand synthesis with and without the reverse transcriptase enzyme (RT). There was no detectable signal or PCR product in the sample omitting the RT (data not shown). All of the cDNA samples, human testis, ovary and spermatozoa showed a single band emphasizing the specificity of these primers for this transcript. The products from each amplification were cut out of the gel, purified and subjected to DNA sequence analysis. We have directly sequenced the PCR products from human testis, ovary and spermatozoa and cloned and sequenced the product from testis and ovary. We have determined the amplicons from each sample contain only one sequence which corresponds to the tissue specific N-cadherin transcript.

In parallel we have attempted to amplify gene specific sequence for E-cadherin (Bussemakers et al., 1993Go) in human testis and spermatozoa (Figure 4Go). The specific primers we used were designed to traverse exons 5–8 of E-cadherin (Berx et al., 1995Go) from nucleotides 660–1135 generating a 475 nucleotide amplicon from transcribed nucleic acid. The expected size of the product if the result were due to contaminating genomic DNA would be 3.6 kb. The only tissue that shows any product is testis, despite using amounts of sperm cDNA that routinely produce the N-cadherin product. This gel analysis depicts a representative experiment from three separate attempts to amplify E-cadherin-specific transcript from the fresh and frozen human sperm cDNA template material used in the other experiments.



View larger version (106K):
[in this window]
[in a new window]
 
Figure 4. Agarose gel analysis of polymerase chain reaction (PCR) amplification with primers specific to E-cadherin. Approximately 50 ng of first strand cDNA from human testis (HT), and 20 µl of first strand cDNA from extracts of six different individual human donor sperm preparations were used as template for PCR amplification using E-cadherin primers 660F and 1135R. MW = molecular weight standards run in this lane, for reference a dot is placed next to the 506/517 and the 1018 marker. H2O = control lane which does not contain template. The arrow indicates the position of the 475 bp PCR product amplified in the human testis sample but completely absent from the human sperm cDNA of both fresh and cryopreserved (not shown) preparations. The amplification product from human testis was purified and subjected to DNA sequence analysis.

 
Alignment of sequenced products from human testis and human spermatozoa with human N-cadherin sequence
The published sequence for human N-cadherin cDNA (Walsh et al., 1990Go) is shown in Figure 5Go with the region of amplification of human testis and sperm N-cadherin indicated by underlining. We aligned the directly sequenced 438 bp PCR products from human testis and spermatozoa with previously published cDNA sequence from N-cadherin (Figure 5Go). Sequence identity was > 98%, with a few base changes, indicated by inclusion in the alignment. A number of single base changes were noted in the direct sequencing of the human testis and sperm PCR products (shown in Figure 5Go) resulting in a change in amino acid residue, as indicated by the presence of an asterisk above the amino acid. In human sperm samples 1, 2 and 3 an adenine replaced a cytosine at nucleotide 157, resulting in an amino acid change from leucine 53 in the published sequence to a conservative substitution of isoleucine. The change of cytosine 163 for thymidine caused an amino acid substitution of proline 55 to serine, which may affect the secondary structure of the extracellular domain. Another amino acid change occurred at isoleucine 63, which substituted a non-polar hydrophobic isoleucine for a polar neutral threonine. Of note was the base change of cytosine 108 for a thymidine in human sperm sample 2, which encodes a stop codon (TAG) instead of glutamine 70, resulting in premature termination and a truncated N-cadherin protein. A significant change was alanine 80 to valine, though this is a conservative change, it alters the HAV motif and will probably affect the binding and/or specificity of the binding between homophilic N-cadherin molecules. An additional amino acid change affecting the extracellular domain was the substitution of asparagine 90 for a lysine at that position slightly altering the charge from neutral to basic, due to the change of cytosine 271 to guanine. An amino acid change outside of the 113 amino acid extracellular binding domain but present within the region of PCR amplification was proline 157 to a leucine.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 5. Alignment and comparison of human N-cadherin nucleotide coding sequence with human testis and sperm in the region of amplification with N-cadherin primers 101F and 539R. The human testis and sperm sequence is aligned below, base changes are noted and identity is indicated by a dash.

 
Discussion

The molecules involved in the gamete specific binding of spermatozoa and oolemma lead to a fusion of the cell membranes in events linked to fertilization. Cell-specific recognition and adhesion are essential for the proper morphogenic formation and organization of various multicellular structures. Cell adhesion molecules such as the cadherins have been shown to be absolutely required for the temporal and morphoregulatory control of a variety of cell and tissue types.

In these studies we have determined the presence of the calcium-dependent morphoregulatory molecule N-cadherin in human spermatozoa, by immunofluorescence and detection of RNA transcript by isolation and reverse transcribing RNA extracted from human ovary, testis, and spermatozoa and by amplifying specific transcript from these tissues. We have amplified sequences from human ovary and testis as well as from both frozen and raw sperm mRNA homologous to human N-cadherin, from nucleotides 101–539, the 5' end of coding sequence and the region of the cadherins that is least conserved among the cadherin family of adhesion molecules (Goodwin et al., 1990; for review, see Takeichi, 1990, 1991; Barth et al., 1997). We have aligned the respective nucleotide and amino acid sequences of the testis and sperm cDNA to show overall identity (Figure 5Go). The sequence identity between the testis and individual human sperm sequences is >98%, with only an occasional base change.

Mature ejaculated human spermatozoa express antigenic epitopes on their plasma-membrane surface which are recognized by mouse monoclonal antibody NCAD2 against human N-cadherin. The localization of these molecules is throughout the sperm head with concentration in the post-acrosomal region. The staining pattern is present but weak, and the signal may be enhanced by acrosome reacting the sperm population and/or acetone fixation as previously reported (Miller et al., 1992Go). The localization of an adhesion molecule such as N-cadherin to the post-acrosmal region of human spermatozoa is consistent with the observations of binding and fusion of acrosome-reacted spermatozoa and zona pellucida-free hamster oocytes (Talbot and Chacon, 1982Go) and of human sperm–oocyte fusion (Sathananthan et al., 1986Go). Andersson et al. (1994) demonstrated the expression of N-cadherin in spermatagonia and spermatocytes by immunohistochemistry of tissue sections, but were unable to detect the epitopes on more mature spermatozoa. The reason for the difference in these findings could be due to several factors including the use of a different antibody. The antibody used in this study, NCAD2, is a mouse monoclonal directed against human N-cadherin, whereas an anti-N-cad-cyt antibody previously used (Andersson et al., 1994Go) was a polyclonal antibody raised in rabbits against a ß-galactosidase fusion protein. This protein was made by cloning a fragment from the chicken N-cad cDNA which encoded five extracellular amino acids, and the transmembrane and a small part of the cytoplasmic tail. The alteration of the sperm head shape as well as plasma membrane changes associated with sperm maturation may have masked these epitopes. The choice of antibody appears to be crucial in the detection of specific cadherin molecules in both surface staining and immunoblot detection. Rufas et al. (2000) were able to detect N-cadherin surface expression using a polyclonal N-cadherin antibody but unable to detect the presence of the specific peptide with an immunoblotting technique. We tested two other monoclonal antibodies against human N-cadherin in immunoblot assays (Pharmigen and Zymed), and had a much reduced signal in the sperm lysate lanes (data not shown). Whether this difference in signal is concentration or conformation dependent is not known.

The present results show that RNA extracted from human testis, ovary and both fresh and frozen thawed human spermatozoa contained N-cadherin transcript. This result is consistent with previous results (Munro and Blaschuk, 1996Go), which showed expression of N-cadherin transcript in mouse testis throughout development and peaking at 21 days but continuing through adulthood. With the human sperm samples, although nearly identical quantities of extract were analysed from each specimen, a fainter signal was evident for samples extracted from frozen–thawed versus fresh specimens (Figure 3Go). The reason for this difference is not clear. The percentage of motile spermatozoa in prepared raw versus prepared frozen–thawed specimens was greater (99.0 ± 3.9 versus 86.5 ± 0.8%); however, the 13.0-percentage point difference between the two treatments for percentage of motile spermatozoa would not entirely account for the nearly two-fold greater intensity of the signal for raw specimens, assuming no RNA was contributed by non-viable spermatozoa. Although it would appear that cryopreservation adversely affected the presence, detection, and/or recoverability of N-cadherin transcript in frozen–thawed semen relative to fresh semen, the mechanism of that effect is open to speculation. RNA degradation is catalysed in the presence of Mg2+ (AbouHaidar and Ivanov, 1999Go) at concentrations found in semen (Mann, 1964Go) and egg yolk (Posati and Orr, 1976Go), and in the presence of Tris (AbouHaidar and Ivanov, 1999Go). Citrate and polyvalent alcohols, e.g. glycerol, inhibit RNA degradation (AbouHaidar and Ivanov, 1999Go). Since Mg2+, Tris, citrate, and glycerol are constituents of the freezing medium (TYB) employed for sperm cryopreservation in this study, perhaps the degradative effects of Mg2+ and Tris on RNA were not completely offset by the inhibitory effects of the citrate and glycerol in the freezing medium, and resulted in a net reduction, but not elimination, of available RNA in frozen–thawed spermatozoa. Whether this reduction in transcript relates to fertility potential of cryopreserved versus fresh spermatozoa is unclear. The freezing medium may not be a likely contributor to impairing the putative function of N-cadherin since fusion of human spermatozoa to hamster oolemma has been shown to be unaffected by TYB (Francavilla et al., 1997Go), species differences notwithstanding. In addition, cryopreservation has been shown to only slightly affect the function of other gamete-related adhesion molecules (Glander et al., 1998Go).

The concentration of antigenic epitopes reactive with NCAD2 antibody on human sperm surface (immunofluoresence data) and in protein extracts from motile human sperm samples (Western blot analysis) appear relatively low. However, extracts from whole semen appear to contain a considerable amount of protein reactive with N-cadherin antibody. This may be due to the contribution from the different epithelial cell types lining the male tubular genitalia from urethra (Kawakita et al., 1994Go) to the seminiferous tubule (Lustig et al., 1998Go) and including the accessory sex glands (Soler et al., 1997Go). The immunofluoresence and immunoblot findings are consistent with the relative paucity of transcript for N-cadherin detectable by RT–PCR, suggesting the transcript for N-cadherin is very stable, and the surface protein expression due to several rounds of translation at some earlier stage in development (Hecht, 1995Go). Alternatively, the protein itself may be remarkably stable, and the transcription of this molecule tightly regulated (Miller, 1997Go; Kramer and Krawetz, 1997Go) to ensure transcription of N-cadherin is restrained in favour of expression of other adhesion molecules (Rufas et al., 2000Go), such as the expression of E-cadherin on the murine oocyte surface within 6 h of fertilization at the time of pronuclear formation (Clayton et al., 1995Go). The spatial and temporal expression of one form of cadherin on gametes, modulated or switched to another after fusion and fertilization, presents a powerful mechanism for the adhesion dependent morphoregulatory changes essential for embryogenesis. This shift or change in specific cadherin expression has been observed in many organogenic and tissue differentiation systems (Hatta et al., 1987; Radice et al., 1997; for review, see Huber et al., 1996; Redies and Takeichi, 1996).

In contrast, attempts to amplify E-cadherin from human spermatozoa were unsuccessful, though we were able to amplify a transcript in the control human testis cDNA (Figure 4Go). This finding is different from previous results (Andersson et al., 1994Go), who could not detect any surface expression of E-cadherin in human testis but found it was expressed in the human epididymus epithelium by immunohistochemistry. As RT–PCR is a much more sensitive method, we may have detected very small levels of E-cadherin transcript made in one particular cell type and expressed at very low levels (Hecht 1995Go; Kramer and Krawetz, 1997Go; Miller 1997Go). Or, alternatively, it is possible there was some small amount of epithelium present in the testicular tissue used to make the pooled human testis mRNA sample. Finally, the E-cadherin transcript may be present in a very low concentration, but may be tightly regulated to prevent translation from occurring. We did not look for E-cadherin protein expression on human spermatozoa in the light of not detecting any E-cadherin transcript by RT–PCR (Figure 4Go). However, Rufas et al. (2000), reported surface expression of E-cadherin antigenic epitopes reactive with an E-cadherin polyclonal antibody on 20–50% of human spermatozoa. Whether the presence of E-cadherin plays an adhesive role or participates in some weak heterotypic interaction with the oocyte remains to be determined.

Cadherins provide transmembrane transmission of signals which mediate both morphological and biochemical responses. The most unique characteristics of the members of the cadherin family reside in the extracellular domain of the molecule (Takeichi, 1995Go), where the binding affinity and specificity is determined (Hatta and Takeichi, 1986Go; Nose et al., 1990Go) and Ca2+-binding regions are found (Ozawa et al., 1990Go). It was for that reason we chose to amplify sequence in that region of the N-cadherin transcript, resulting in the unequivocal demonstration of the presence of this transcript in ejaculated motile spermatozoa. Moreover, this transcript is translated and expressed on the surface of the sperm head as determined by immunofluorescence detection of N-cadherin antigenic epitopes (Figure 1CGo). With the presence of such a dynamic adhesion molecule on the spermatozoa and oocyte it is tempting to speculate that N-cadherin participates in binding between gametes, particularly since it appears to occur in high concentration in the post-acrosomal region which has been shown to be the area of initial contact between spermatozoa and oolemma (Talbot and Chacon, 1982Go; Sathananthan et al., 1986Go). The homophilic interaction between N-cadherin molecules on the surfaces of PC12 cells has been shown to initiate a signalling cascade leading to calcium channel depolarization and culminating in neurite outgrowth (Doherty et al., 1991Go). The engagement and adhesion of these cell surface adherent molecules on the spermatozoa and oolemma surface could result in a cascade of signalling and cytoskeletal–intercellular events that initiate and regulate the process of biochemical and cellular processes required for embryogenesis.

It is of interest that one of the base substitutions found in the sequence of human testis PCR product resulted in an amino acid residue change in the amino terminal portion of the protein which is responsible for binding specificity (Nose et al., 1990Go). Within this 113 amino acid extracellular region is the HAV motif flanked by a non-conserved consensus of residues. This region is conserved not only in cadherins (for review, see Takeichi, 1990, 1991) but also desmosomal cadherins (Goodwin et al., 1990Go; Koch et al., 1990Go, 1991Go; Mechanic et al., 1991Go), as well as in strain A haemagglutinins (Blaschuck et al., 1990a,b). The integrity of this region is seen in the ability to inhibit compaction of mouse embryos when incubated in the presence of peptides containing this motif. Recently another differentiation process involving cell–cell fusion, namely formation of multinucleated bone-resorbing osteoclasts from haematopoietic precursors, was found to be inhibited by the presence of a peptide containing the HAV motif (Mbalaviele et al., 1995Go). Mutations to amino acids which flank this motif result in a change of specificity of the cadherin interactions, but do not inhibit adhesion (Nose et al., 1990Go). The alteration of the HAV motif to HVV would alter the Ca2+ binding in the ectodomain of cadherin molecules and inhibit the formation of trans-dimers (Pertz et al., 1999Go), thereby greatly reducing or preventing any homoassociation of N-cadherin expressing cells such as spermatozoa and oolemma. That we detected a base change resulting in an amino acid substitution in this critical binding region is surprising, in light of the control exercised over recognition and binding. However, the testis mRNA was from a pool of specimens from 20 individuals aged 2–70 years, with the mutant transcript probably representative of a single individual in that population, as none of the individual sperm samples that were analysed showed this mutation. Regardless of the origin, this mutation presents intriguing possibilities for the analysis of failed fertilization and may present one critical region of the molecule on which to focus the development of a diagnostic test for fertilization potential.

It is clear that the results of the present study show that N-cadherin is present in ejaculated human spermatozoa. That cadherins have also been identified on human oocytes lead to the possibility that these adhesion molecules may participate in sperm–oocyte interaction. Although the questions stimulated by this report outnumber the answers that have been presented, future investigations will certainly clarify the role these molecules play in human gamete interactions.

Acknowledgments

This study was supported by funds from the Division of Molecular Genetics Dept. of Research, North Shore University Hospital and The University of Arizona Foundation. Appreciation is expressed to Craig Gawel, for performing the fluorescence-based automated DNA sequencing, to Dorothy Guzowski, for oligonucleotide synthesis, and to Susan Benoff, for stimulating and helpful discussions.

Notes

3 To whom correspondence should be addressed at: Department of Research, North Shore University Hospital-New York University School of Medicine, Manhasset, New York, USA. E-mail lgoodwin{at}nshs.edu Back

* Presented in part at the 54th Annual Meeting for the American Society for Reproductive Medicine, San Francisco, CA, USA, October 4–9, 1998 Back

References

AbouHaidar, M.G. and Ivanov, I.G. (1999) Non-enzymatic RNA hydrolysis promoted by the combined catalytic activity for buffers and magnesium ions. Z. Naturforsch, 54, 542–548.

Almeida, E.A.C., Huovila, A-P. J., Sutherland, A.E. et al. (1995) Mouse egg integrin {alpha}6ß1 functions as a sperm receptor. Cell, 81, 1095–1104.[Web of Science][Medline]

Andersson, A-M., Edvardsen, K. and Shakkebaek, N.E. (1994) Expression and localization of N- and E-cadherin in the human testis and epididymis. Int. J. Androl., 17, 174–180.[Web of Science][Medline]

Angres, B., Barth, A. and Nelson, W.J. (1996) Mechanism for transition from initial to stable cell–cell adhesion: kinetic analysis of E-cadherin-mediated adhesion using a qualitative adhesion assay. J. Cell Biol., 134, 549–557.[Abstract/Free Full Text]

Barth, A.I., Nathke, I.S. and Nelson, W.J. (1997) Cadherins, catenins and APC protein: interplay between cytoskeletal complexes and signaling pathways. Curr. Opin. Cell Biol., 9, 683–690.[Web of Science][Medline]

Benoff, S., Barcia, M., Hurley, I.R. et al. (1996) Classifications of male factor infertility relevant to IVF insemination strategies using mannose ligands, acrosome status and anti-cytoskeletal antibodies. Hum. Reprod., 11, 1905–1918.[Abstract/Free Full Text]

Benoff, S. (1997) Carbohydrates and fertilization: an overview. Mol. Hum. Reprod., 3, 599–637.[Abstract/Free Full Text]

Benoff, S. (1998) Modeling human sperm–egg interactions in vitro: signal transduction pathways regulating the acrosome reaction. Mol. Hum. Reprod., 4, 453–471.[Abstract/Free Full Text]

Berx, G., Staes, K., Van Henger, J. et al. (1995) Cloning and Characterization of the Human Invasion Suppressor Gene E-cadherin (CDH1). Genomics, 26, 281–289.[Web of Science][Medline]

Blaschuk, O.W., Pouliot, Y. and Holland, P.C. (1990a) Identification of a conserved region common to cadherins and influenza strain A hemagglutinins. J. Mol. Biol., 211, 679–682.[Web of Science][Medline]

Blaschuk, O.W., Sullivan, R., David, S. et al. (1990b) Identification of a cadherin cell adhesion recognition sequence. Dev. Biol., 139, 227–229.[Web of Science][Medline]

Bleil, J.D. (1991) In Wasserman, P.M. (ed.), Elements of Mammalian Fertilization. CRC Press. Boca Raton, FL, USA, pp. 133–51.

Boldt, J., Howe, A.M. and Preble, J. (1988) Enzymatic alteration of the ability of mouse egg plasma membrane to interact with sperm. Biol. Reprod., 39, 19–27.[Abstract]

Brieher, W.M., Yap, A.S., and Gumbiner, B.M. (1996) Lateral dimerization is required for the homophilic binding activity of C-cadherin. J. Cell Biol., 135, 487–496.[Abstract/Free Full Text]

Bussemakers, M.J., van Bokhoven, A., Mees, S.G. et al. (1993) Molecular cloning and characterization of the human E-cadherin cDNA. Mol. Biol. Rep., 17, 123–128.[Web of Science][Medline]

Campbell, S., Swann, H.R., Seif, M.W. et al. (1995) Cell adhesion molecules on the oocyte and preimplantation human embryo. Hum. Reprod., 10, 1571–1578.[Abstract/Free Full Text]

Chomcznski, P. and Sacchi, N. (1987) Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162, 156–159.[Web of Science][Medline]

Clayton, L., McConnell, J.M.L. and Johnson, M.H. (1995) Control of the surface expression of uvomorulin after activation of mouse oocytes. Zygote, 3, 177–189.[Web of Science][Medline]

Daniel, J.M. and Reynolds, A.B. (1997) Tyrosine phosphorylation and cadherin/catenin function. Bioessays, 19, 883–891.[Web of Science][Medline]

Doherty, P., Ashton, S.V., Moore, S.E. et al. (1991) Morphoregulatory activities of NCAM and N-cadherin can be accounted for by G protein-dependent activation of L- and N-type neuronal Ca2+ channels. Cell, 67, 21–33.[Web of Science][Medline]

Duband, J.L., Dufour, S., Hatta, K. et al. (1987) Adhesion molecules during somitogenesis in the avian embryo. J Cell Biol., 104, 1361–1374.[Abstract/Free Full Text]

Dunbar, B.S., Prasad, S.V. and Timmons, T.M. (1991) In Dunbar, B.S. and O'Rand, M.G. (eds), A Comparative Overview of Mammalian Fertilization. Plenum Press, New York, USA, pp. 97–114.

Edelman, G.M. (1989) Topobiology. Sci. Am., 260, 76–88.

Francavilla, F., Romano, R., Santucci, R. et al. (1997) Occurrence of the interference of sperm-associated antibodies on sperm fertilizing ability as evaluated by the sperm–zona pellucida binding test and by the TEST-yolk buffer enhanced sperm penetration assay. Am. J. Reprod. Immunol., 37, 267–274.

Fusi, F.S., Montesano, M., Bernocchi, N. et al. (1996) P-selectin is expressed on the oolemma of human and hamster oocytes following sperm adhesion and is also detected on the equatorial region of acrosome-reacted human spermatozoa. Mol. Hum. Reprod., 2, 341–347.[Abstract/Free Full Text]

Gallin, W.J., Chuong, C.M., Finkel, L.H. et al. (1986) Antibodies to liver cell adhesion molecule perturb inductive interactions and alter feather pattern and structure. Proc. Natl Acad. Sci., 83, 8235–8239.[Abstract/Free Full Text]

Glander, H.J., Schaller, J., Rohwedder, A. et al. (1998) Adhesion molecules and matrix proteins on human spermatozoa. Andrologia, 30, 289–296.[Web of Science][Medline]

Goodwin, L.O., Leeds, N.B., Hurley, I.R. et al. (1997) Isolation and characterization of the primary structure of testis-specific L-type calcium channel: implications for contraception. Mol. Hum. Reprod., 3, 255–268.[Abstract/Free Full Text]

Goodwin, L.O., Leeds, NB, Jacob, A. et al. (1998a) [Abstr. no. 5.] In American Society of Andrology, 23rd Annual Meeting, p.26.

Goodwin, L.O., Karabinus, D.S. and R.G. Pergolizzi, (1998b) N-cadherin transcripts present in mature sperm: potential contribution to gamete fusion. [Abstract # O328]. In 54th Annual Meeting for the American Society for Reproductive Medicine, San Francisco, CA, USA, October 4–9, 1998.

Goodwin, L.O., Leeds, N.B., Hurley, I.R. et al. (1998c) Alternative splicing of exons in the alpha1 subunit of the rat testis L-type voltage-dependent calcium channel generates germ line-specific dihydropyridine binding sites. Mol. Hum. Reprod., 4, 215–226.[Abstract/Free Full Text]

Goodwin, L.O., Karabinus, D.S., Pergolizzi, R.G. and Benoff, S. (2000) L-type voltage-dependent calcium {alpha}-1C subunit mRNA is present in ejaculated human spermatozoa. Mol. Hum. Reprod. 6, 101–110.

Goodwin, L.O., Hill, J.E., Raynor, K. et al. (1990) Desmoglein shows extensive homology to the cadherin family of cell adhesion molecules. Biochem. Biophys. Res. Commun., 173, 1224–1230.[Web of Science][Medline]

Gonzalez-Estrella, J.A., Coney, P.J., Ostash, K. and Karabinus, D. (1994) Dithiothreitol effects on the viscosity and quality of human semen. Fertil. Steril., 62, 1238–1243.[Web of Science][Medline]

Gumbiner, B. and Simons, K. (1986) A functional assay for proteins involved in establishing an epithelial occluding barrier: identification of a uvomorulin-like polypeptide. J. Cell Biol., 102, 457–468.[Abstract/Free Full Text]

Hatta, K. and Takeichi, M. (1986) Expression of N-cadherin adhesion molecules associated with early morphogenetic events in chick development. Nature, 320, 447–449.[Medline]

Hatta, K., Takagi, S., Fujisawa, H. et al. (1987) Spatial and temporal expression pattern of N-cadherin cell adhesion molecules correlated with morphogenetic processes of chicken embryos. Dev. Biol., 120, 215–227.[Web of Science][Medline]

Hecht, N.B. (1995) The making of a spermatozoon: a molecular perspective. Dev. Gen., 16, 95–103.[Web of Science][Medline]

Hermiston, M.L., Wong, M.H. and Gordon, J.L. (1996) Forced expression of E-cadherin in the mouse epithelium slows cell migration and provides evidence for nonautonomous regulation of cell fate in a self-renewing system. Genes Dev., 10, 985–996.[Abstract/Free Full Text]

Herman, M.A., Vassilieva, L.L., Horvitz, H.R. et al. (1995) The C. elegans gene lin-44, which controls the polarity of certain asymmetric cell divisions, encodes a Wnt protein and acts cell nonautonomously. Cell, 83, 101–110.[Web of Science][Medline]

Hirai, Y., Nose, A., Kobayashi, S. et al. (1989a) Expression and role of E- and P-cadherin adhesion molecules in embryonic histogenesis. I. Lung epithelial morphogenesis. Development, 105, 263–270.[Abstract]

Hirai, Y., Nose, A., Kobayashi, S. et al. (1989b) Expression and role of E- and P-cadherin adhesion molecules in embryonic histogenesis. II. Skin morphogenesis. Development, 105, 271–277.[Abstract]

Huber, O., Bierkamp, C. and Kemler, R. (1996) Cadherins and catenins in development. Curr. Opin. Cell Biol., 8, 685–691.[Web of Science][Medline]

Hyafil, F., Morello, D., Babinet, C. et al. (1980) A cell surface glycoprotein involved in the compaction of embryonal carcinoma cells and cleavage stage embryos. Cell, 21, 927–934.[Web of Science][Medline]

Kaibuchi, K., Kuroda, S., Fukata, M. et al. (1999) Regulation of cadherin-mediated cell–cell adhesion by the Rho family GTPases. Curr. Opin. Cell Biol., 11, 591–596.[Web of Science][Medline]

Karabinus, D.S. and Gelety, T.J. (1997) The impact of sperm morphology evaluated by strict criteria on intrauterine insemination success. Fertil. Steril., 67, 536–541.[Web of Science][Medline]

Katz, B.Z., Levenberg, S., Yamada, K.M. et al. (1998) Modulation of cell-cell adherens junction by surface clustering of the N-cadherin cytoplasmic tail. Exp. Cell Res., 243, 415–424.[Web of Science][Medline]

Kawakita, M., Moroi, S., Kyotani, K. et al. (1994) Study on E-cadherin expression in relation to invasion and metastasis in urothelial cancer patients. Hinyokika Kiyo, 12, 1077–1080.

Kirkpatrick, C. and Peifer, M. (1995) Not just glue: cell–cell junctions as cellular signaling centers. Curr. Opin. Genet. Dev., 5, 56–65.[Medline]

Koch, P.J., Walsh, M.J., Schmelz, M. et al. (1990) Identification of desmoglein, a constitutive desmosomal glycoprotein, as a member of the cadherin family of adhesion molecules. Eur. J. Cell Biol., 53,1–12.[Web of Science][Medline]

Koch, P.J., Goldschmidt, M.D, Walsh, M.J. et al. (1991) Complete amino acid sequence of the epidermal desmoglein precursor polypeptide and identification of a second type of desmoglein gene. Eur. J. Cell Biol., 55, 200–208.[Web of Science][Medline]

Kramer, J.A. and Krawetz, S.A. (1997). RNA in spermatozoa: implications for the alternative haploid genome. Mol. Hum. Reprod., 3, 473–478.[Abstract/Free Full Text]

Kruger, T.F., Acosta, A.A., Simmons, K.F. et al. (1988) Predictive value of abnormal sperm morphology in in vitro fertilization. Fertil. Steril., 49, 112–117.[Web of Science][Medline]

Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of the bacteriophage T4. Nature, 227, 680.[Medline]

Larue, L., Antos, C., Butz, S. et al. (1996) A role for cadherins in tissue formation. Development, 122, 3185–3194.[Abstract]

Liu, D.Y. and Baker H.W. (1994a) Acrosome status and morphology of human spermatozoa bound to the zona pellucida and oolemma determined using oocytes that failed to fertilize in vitro. Hum. Reprod., 9, 673–679.[Abstract/Free Full Text]

Liu, D.Y. and Baker H.W. (1994b) Disordered acrosome reaction of spermatozoa bound to the zona pellucida: a newly discovered sperm defect causing infertility with reduced sperm–zona pellucida penetration and reduced fertilization in vitro. Hum. Reprod., 9, 1694–1700.[Abstract/Free Full Text]

Lustig, L., Meroni, S., Cigorraga, S. et al. (1998) Immunodetection of cell adhesion molecules in rat Sertoli cell cultures. Am. J. Reprod. Immunol., 39, 399–405.

Mann, T. (1964) The Biochemistry of Semen and the Male Reproductive Tract. Wiley, New York, USA.

Marrs, J.A., Andersson-Fisone, C., Jeong, M.C. et al. (1995) Plasticity in epithelial cell phenotype: modulation by differential expression of cadherin cell adhesion molecules. J. Cell Biol., 129, 507–519.[Abstract/Free Full Text]

Mathur, M. Goodwin, L.O. and Cowin. P. (1994) Interactions of the cytoplasmic domain of the desmosomal cadherin Dsg1 with plakoglobin. J. Biol. Chem., 269, 14075–14080.[Abstract/Free Full Text]

Matsunaga, M., Hatta, H. and Takeichi, M. (1988). Role of N-cadherin adhesion molecules in the histogenesis of neural retina. Neuron, 1289, 295–302.

Mbalaviele, G., Chen, H., Boyce, B.F. et al. (1995) The role of cadherin in the generation of multinucleated osteoclasts from mononuclear precursors in murine marrow. Am. Soc. Clin. Inv., 95, 2757–2765.

McNeill, H., Ozawa, M., Kemler, R. et al. (1990) Novel function of the cell adhesion molecule uvomorulin as an inducer of cell surface polarity. Cell, 62, 309–316.[Web of Science][Medline]

Mechanic, S., Raynor, K., Hill, J.E. et al. (1991) Desmocollins form a distinct subset of the cadherin family of cell adhesion molecules. Proc. Natl Acad. Sci. USA, 88, 4476–4480.[Abstract/Free Full Text]

Miller, D., Brough, S. and Al-Harbi, O. (1992) Characterization and cellular distribution of human spermatozoal heat shock proteins. Hum. Reprod., 7, 637–645.[Abstract/Free Full Text]

Miller, D. (1997) RNA in the ejaculate spermatozoon: a window into molecular events in spermatogenesis and a record of the unusual requirements of haploid gene expression and post-meiotic equilibration. Mol. Hum. Reprod., 3, 669–676.[Abstract/Free Full Text]

Miller, D.J. and Ax, R.L. (1990) Carbohydrates and fertilization in animals. Mol. Reprod. Dev., 26, 184–98.[Web of Science][Medline]

Miller, J.R. and Moon, R.T. (1996) Signal transduction through beta-catenin and specification of cell fate during embryogenesis. Genes Dev., 10, 2527–2539.[Free Full Text]

Miyatani, S., Shimamura, K., Hatta, M. et al. (1989) Neural cadherin: role in selective cell-cell adhesion. Science, 245, 631–635.[Abstract/Free Full Text]

Munro, S.B. and Blaschuk, O.W. (1996) A comprehensive survey of the cadherins expressed in the testes of fetal, immature and adult mice utilizing the polymerase chain reaction. Bio. Reprod., 55, 822–827.[Abstract]

Nose, A. and Takeichi, M. (1986) A novel cadherin cell adhesion molecule: its expression patterns associated with implantation and organogenesis of mouse embryos. J. Cell Biol., 103, 2649–2658.[Abstract/Free Full Text]

Nose, A., Nagafuchi, A. and Takeichi, M. (1987) Isolation of placental cadherin cDNA: identification of a novel gene family of cell-cell adhesion molecules. EMBO J., 6, 3655–3661.[Web of Science][Medline]

Nose, A., Tsuji, K. and Takeichi, M. (1990) Localization of specificity determining sites in cadherin cell adhesion molecules. Cell, 61, 147–155.[Web of Science][Medline]

Oehninger, S., Mahony, M., Ozgur, K. et al. (1997) Clinical significance of human sperm–zona pellucida binding. Fertil. Steril., 67, 1121–1127.[Web of Science][Medline]

Ozawa, M., Engel, J. and Kemler, R. (1990) Single amino acid substitutions in one Ca2+ binding site of uvomorulin abolish the adhesive function. Cell, 63, 1033–1038.[Web of Science][Medline]

Pertz, O., Bozic, D., Koch, A.W. et al. (1999) A new crystal structure, Ca2+ dependence and mutational analysis reveal molecular details of E-cadherin homoassociation. EMBO J., 18, 1738–1747.[Web of Science][Medline]

Pessot, C.A., Brito, M., Figueroa, J. et al. (1989) Presence of RNA in the sperm nucleus. Biochem. Biophys. Res. Commun., 158, 272–278.[Web of Science][Medline]

Ponce, R.H., Yanagimachi, R., Urch, U.A. et al. (1993) Retention of hamster oolemma fusibility with spermatozoa after various enzyme treatments: a search for the molecules involved in sperm–egg fusion. Zygote, 1, 163–171.[Medline]

Posati, L.P. and Orr, M.L. (1976) Composition of foods: Dairy and egg products. Raw, Processed, Prepared. USDA-ARS Agricultural Handbook. No. 8–1. US Government Printing Office, Washington DC, USA.

Radice, G.L., Rayburn, H., Matsunami, H. et al. (1997) Developmental defects in mouse embryos lacking N-cadherin. Dev. Biol., 181, 64–78.[Web of Science][Medline]

Redies, C. and Takeichi, M. (1996) Cadherins in the developing central nervous system: an adhesive code for segmental and functional subdivisions. Dev. Biol., 180, 413–423.[Web of Science][Medline]

Rufas, O., Fisch, B., Ziv, S. et al. (2000) Expression of cadherin adhesion molecules on human gametes. Mol. Hum. Reprod. 6, 163–169.[Abstract/Free Full Text]

Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning. Cold Spring Harbor Publications, Cold Spring Harbor, New York, USA.

Sathananthan, A.H., Ng, S.C., Edirisinghe, R. et al. (1986) Human sperm–egg interaction in vitro. Gamete Res., 15, 317.

Shapiro, L., Fannon, A.M., Kwong, P.D. et al. (1995) Structural basis of cell–cell adhesion by cadherins. Nature, 374, 327–337.[Medline]

Soler, A.P., Harner, G.D., Knudsen, K.A. et al. (1997) Expression of P-cadherin identifies prostate-specific-antigen-negative cells in epithelial tissues of male sexual accessory organs and in prostasic carcinomas. Implications for prostatic cancer biology. Am. J. Pathol., 151, 471–478.[Abstract]

Steinberg, M.S. and McNutt, P.M. (1999) Cadherins and their connections: adhesion junctions have broader functions. Curr. Opin. Cell Biol., 11, 554–560.[Web of Science][Medline]

Takeda, H., Nagafuchi, A., Yonemura, S. et al. (1995) V-Src kinase shift the cadherin-based cell adhesion from the strong to the weak state and b-catenin is not required for the shift. J. Cell Biol., 131, 1839–1847.[Abstract/Free Full Text]

Takeichi, M. (1990) Cadherins: a molecular family important in selective cell-cell adhesion. Ann. Rev. Biochem., 59, 237–252.[Web of Science][Medline]

Takeichi, M. (1991) Cadherin cell adhesion receptors as a morphogenetic regulator. Science, 251, 1451–1455.[Abstract/Free Full Text]

Takeichi, M. (1995) Morphogenetic roles of classic cadherins. Curr. Opin. Cell Biol., 7, 619–627.[Web of Science][Medline]

Talbot, P. and Chacon, R.S. (1982) Ultrastructural observations on binding and membrane fusion between human sperm and zona pellucida-free hamster oocytes. Fertil. Steril., 37, 240–248.[Web of Science][Medline]

Towbin, H., Staehlin, T. and Gordon, J. (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl Acad. Sci. USA, 76, 4350–4354.[Abstract/Free Full Text]

Tso, J.Y., Sun, X.H., Kao, T.H. et al. (1985) Isolation and characterization of rat and human glyceraldehyde-3-phosphate dehydrogenase cDNAs: genomic complexity and molecular evolution of the gene. Nucleic Acids Res., 13, 2485–2502.[Abstract/Free Full Text]

Volk, T. and Geiger, B. (1984) A 135-kd membrane protein of intercellular adherens junctions. EMBO J., 3, 2249–2260.[Web of Science][Medline]

Wallis, J., Fox, M.F. and Walsh, F.S. (1994) Structure of the human N-cadherin gene: YAC analysis and fine chromosomal mapping to 18q11.2. Genomics, 22, 172–179.[Web of Science][Medline]

Walsh, F.S., Barton, C.H., Putt, W. et al. (1990) N-cadherin gene maps to human chromosome 18 and is not linked to the E-cadherin gene. J. Neurochem., 55, 805–812.[Web of Science][Medline]

Wassarman, P.M. (1990) Profile of a mammalian sperm receptor. Development, 108, 1–17.[Abstract]

Yanagimachi, R. (1994) Mammalian fertilization. In Knobil, E. and Neill, J.D. (eds), The Physiology of Reproduction. Raven Press, New York: , USA, pp. 189–317.

Yap, A.S., Brieher, W.M., Pruschy, M. et al. (1997) Lateral clustering of the adhesive ectodomain: a fundamental determinant of cadherin function. Curr. Biol., 7, 308–315.[Web of Science][Medline]

Submitted on November 8, 1999; accepted on March 21, 2000.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Hum ReprodHome page
Y. Zhao, Q. Li, C. Yao, Z. Wang, Y. Zhou, Y. Wang, L. Liu, Y. Wang, L. Wang, and Z. Qiao
Characterization and quantification of mRNA transcripts in ejaculated spermatozoa of fertile men by serial analysis of gene expression
Hum. Reprod., June 1, 2006; 21(6): 1583 - 1590.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
J.P. Dadoune, A. Pawlak, M.F. Alfonsi, and J.P. Siffroi
Identification of transcripts by macroarrays, RT-PCR and in situ hybridization in human ejaculate spermatozoa
Mol. Hum. Reprod., February 1, 2005; 11(2): 133 - 140.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
S. Lambard, I. Galeraud-Denis, G. Martin, R. Levy, A. Chocat, and S. Carreau
Analysis and significance of mRNA in human ejaculated sperm from normozoospermic donors: relationship to sperm motility and capacitation
Mol. Hum. Reprod., July 1, 2004; 10(7): 535 - 541.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
S. Lambard, I. Galeraud-Denis, H. Bouraima, S. Bourguiba, A. Chocat, and S. Carreau
Expression of aromatase in human ejaculated spermatozoa: a putative marker of motility
Mol. Hum. Reprod., March 1, 2003; 9(3): 117 - 124.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
B. Maier, S. Medrano, S. B. Sleight, P. E. Visconti, and H. Scrable
Developmental Association of the Synaptic Activity-Regulated Protein Arc with the Mouse Acrosomal Organelle and the Sperm Tail
Biol Reprod, January 1, 2003; 68(1): 67 - 76.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Li, T. H. Vu, K.-O. Lee, Y. Yang, C. V. Nguyen, H. Q. Bui, Z.-L. Zeng, B. T. Nguyen, J.-F. Hu, S. K. Murphy, et al.
An Imprinted PEG1/MEST Antisense Expressed Predominantly in Human Testis and in Mature Spermatozoa
J. Biol. Chem., April 12, 2002; 277(16): 13518 - 13527.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (17)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Goodwin, L. O.
Right arrow Articles by Pergolizzi, R. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Goodwin, L. O.
Right arrow Articles by Pergolizzi, R. G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?