Molecular Human Reproduction, Vol. 6, No. 9, 789-793,
September 2000
© 2000 European Society of Human Reproduction and Embryology
Testis and spermatogenesis |
The human Y chromosome genes BPY2, CDY1 and DAZ are not essential for sustained fertility
1 Inserm U.491, Faculté de Médecine, 27 Boulevard Jean Moulin, 13385 Marseille cedex 05, 2 Institut de Médecine de la Reproduction, 6 Rue Rocca, 13417 Marseille cedex 08, and 3 Departement de Génétique Médicale, Laboratoire de Génétique Moléculaire, Hôpital de la Timone, Marseille, France
Abstract
Deletions of the AZFc interval of the human Y chromosome are found in >5% of male patients with idiopathic infertility and are associated with a severely reduced sperm count. The most common deletion type is large (>1 Mb) and removes members of the Y-borne testis-specific gene families of BPY2, CDY1, DAZ, PRY, RBMY2 and TTY2, which are candidate AZF genes. Four exceptional individuals who have transmitted a large AZFc deletion naturally to their infertile sons have, however, been described. In three cases, transmission was to an only son, but in the fourth case a Y chromosome, shown to be deleted for all copies of DAZ, was transmitted from a father to his four infertile sons. Here we present a second family of this latter type and demonstrate that an AZFc-deleted Y chromosome lacking not only DAZ, but also BPY2 and CDY1, has been transmitted from a father to his three infertile sons. Polymerase chain reaction (PCR) and Southern blot analyses revealed no difference in the size of the AZFc deletion in the father and his sons. We propose that the father carries rare alleles of autosomal or X-linked loci which suppress the infertility that is frequently associated with the absence of AZFc.
azoospermia/AZFc/infertility/spermatogenesis/Y chromosome
Introduction
Deletions of the Y chromosome have been described in >5% of patients with an idiopathic male infertility and are associated with a severely reduced sperm count, <5x106 spermatozoa/ml compared with the normal value of 20x106 spermatozoa/ml (Vogt, 1998
). Three distinct AZF (azoospermia factor) intervals which are required for normal fertility have so far been defined on the Y chromosome (AZFa, b and c). By far the most frequently deleted interval is AZFc, also known as the `KLARD interval' or the `DAZ region' (Ma et al., 1992; Reijo et al., 1995), which is situated in the distal Yq euchromatin. At the time of consultation at an infertility clinic, most AZFc-deleted cases manifest an azoospermic or severely oligozoospermic phenotype and testis biopsies have revealed either no or single active tubules, consistent with the view that the AZFc-deleted testis retains only small patches of spermatogenic activity (Vogt, 1998). The production of spermatozoa in many AZFc-deleted individuals indicates that the AZFc interval does not contain genes essential for spermatogenesis, and that the reduced sperm count associated with AZFc deletions is the result of a reduction in the efficiency of the mitotic stages of spermatogenesis.
The most common type of AZFc deletion is large (>1 Mb) and results in the loss of members of several transcribed testis-specific multi-copy gene families. The gene families with members in the AZFc interval are DAZ, BPY2, CDY1, PRY, TTY2 and RBMY2 (Reijo et al., 1995; Lahn and Page, 1997; Yen, 1998) and these genes represent candidates for AZF. Polymerase chain reaction (PCR)-based analyses indicate that all copies of BPY2, CDY1 and DAZ lie within the AZFc interval (Reijo et al., 1995; Silber et al., 1998; Lahn and Page, 1999) and Southern blot analysis has confirmed this in the case of DAZ (Grimaldi et al., 1998; Krausz et al., 1999). PRY, TTY2 and RBMY2 are known to have additional members located outside the AZFc interval (Lahn and Page, 1997).
More than 100 infertile males with a deletion of the AZFc interval have now been identified in numerous studies (Vogt, 1998). There are, however, exceptional individuals who have transmitted large AZFc deletions to their infertile sons without recourse to assisted fertilization techniques. Three such individuals who have transmitted a large AZFc deletion to a single infertile son have been described, #1506 (Kobayashi et al., 1994), MÜ2v (Vogt et al., 1996), and the father of patient 9 (Pryor et al., 1997). In two of these studies, the AZFc-deleted father was concluded to be sub-fertile, since he was unable to father further children (Vogt et al., 1996; Pryor et al., 1997). These cases, together with those of infertile AZFc-deleted patients where a progression from oligozoospermia to azoospermia has been observed (Girardi et al., 1997; Simoni et al., 1997), suggest that the AZFc deletion phenotype worsens with time, and that AZFc-deleted individuals may even be fertile for a few years following the onset of puberty.
A truly remarkable family has recently been described, in which a Y chromosome with a large AZFc deletion that includes all copies of the DAZ gene cluster was transmitted from a father to his four infertile sons, conceived over a period of 13 years (Chang et al., 1999). This family represents an AZFc deletion phenotype distinct from those reported previously. Here, we present a second family of this type and demonstrate that an AZFc-deleted Y chromosome, lacking not only DAZ, but also BPY2 and CDY1, has been transmitted from a father to his three infertile sons.
Materials and methods
Patients and clinical assessment
Patient samples were collected using approved protocols and the informed consent of all individuals was obtained. Spermiograms were performed on all three brothers and showed that they all had an extremely low or zero sperm count. The father refused to undergo a spermiogram. The concentration of FSH was ascertained for the three brothers: 13–639 (17.7 mIU/ml), 13–629 (15.4 mIU/ml) and 13–694 (9.6 mIU/ml). The normal range of FSH concentrations is 1–10 mIU/ml. The karyotypes of all four individuals were shown to be normal.
Patient 13-639 had tried to have children since 1991, without success. A spermiogram, performed in 1995, showed 1000 spermatozoa/ml in his ejaculate and histological examination of a testicular biopsy revealed an absence of spermatogenesis in the tubules analysed at that time. In 1997, he and his partner chose to attempt an IVF cycle with intracytoplasmic sperm injection (ICSI). A spermiogram carried out at this time revealed azoospermia and a testicular biopsy carried out the same day revealed hypospermatogenesis. Three spermatozoa were identified in the biopsy material, but attempts to isolate and inject them were unsuccessful: two could not be detached from the cellular debris and one adhered to the needle following aspiration.
Patient 13-629 had tried to have children since 1994, without success. A spermiogram, performed in 1995, showed 100 000 spermatozoa/ml in his ejaculate. Three spermiograms were performed in 1997: in April (10 000 spermatozoa/ml), June (10 000 spermatozoa/ml) and November (5000 spermatozoa/ml). The couple had two attempts at ICSI, resulting in the birth of a healthy daughter in 1998.
Patient 13-694 had tried to have children since 1994, without success. He had 15 spermiograms between June 1997 and September 1999. The results of these ranged from azoospermia to 5000 spermatozoa/ml. There was no evidence of a reduction in the sperm count over this period, and in fact the lowest count predated the highest. Five ICSI attempts were carried out, all of which resulted in embryos, but no pregnancy followed embryo transfer.
Paternity testing
The paternity of the father 13-1379, strongly suggested by the presence of the Y chromosome deletion, was confirmed using five tightly linked highly-polymorphic microsatellite markers from chromosome 17.
PCR and Southern blot analysis
PCR and Southern blot analysis were performed on the father (13-1379) and his three sons (13-629, 13-639 and 13-694), a control male and female, and an unrelated male individual with an AZFc-deleted Y chromosome. PCR amplifications were performed on an MJR PTC100 (MJ Research Inc) block using 50 ng of genomic DNA, 200 µmol/l of each dNTP, 200 nmol/l of each primer and 0.2 IU of Taq polymerase (New England Biolabs) with its accompanying buffer. PCR conditions were: first cycle: 2 min at 92°C (denaturation); 1 min 45 s at 57°C (annealing); 2 min at 72°C (extension), followed by 35 cycles of 40 s at 94°C; 45 s at 57°C; 1 min 45 s at 72°C; and then a final extension time of 10 min, except for primers sY146, sY152, sY243, sY269: annealing temperature: 58°C, 49°C, 54°C and 51°C respectively. The `sY' primers are as described previously (Vollrath et al., 1992; Reijo et al., 1995). Primer pairs were derived for TTY2: oMJ705 ATCACCACAGATGGCCTCTG, oMJ706 ACTCAAACTGGAGCACCAGG; RBMY1: oMJ487 GCACCTGCCACGCATATAG, oMJ488 CCACATGCTTCACGAGGATC; PRY: oMJ702 ACAATCCCAAGAGACCACTC, oMJ704 GTCTTCTTCATGAACGTGGC; BPY2: oMJ639 GGGATTATCACATATTGCGG, oMJ640 ATGATAGTCGCGTCAGCTGG; CDY1: oMJ620 TTTGTCCACAAAACTGTGAG, oMJ623 GACATTAGTGGGTGTATC.
Southern blots were performed as previously described (Mitchell et al., 1991). The CDY1 probe is a 428 bp fragment derived from the 5' half of the coding region of the gene by reverse transcription (RT)–PCR from testis poly A+ RNA (Clontech). The DAZ probe is a 434 bp fragment derived from the 5' half of the coding region of the gene, outside the 72 bp DAZ repeat, by PCR from the DAZ cDNA pDP1577 (Reijo et al., 1995), and the BPY2 probe is a 307 bp fragment derived from the 3' untranslated region of the cDNA by RT–PCR from testis poly A+ RNA. All fragments were subcloned into a pGEM-T plasmid (Promega) and sequenced. To generate each probe, the inserts were subsequently amplified by PCR and purified using the Qiaquick PCR purification kit (Qiagen). Primers used were as follows:
- CDY1: oMJ624 ACATGGACTACAACCAGTAG, oMJ623
- DAZ: oMJ612 TGCTGCAAATCCTGAGACTC, oMJ613 TTG-GATTCCGCCAGACGTTC
- BPY2: oMJ639, oMJ640.
Results
Using PCR, we analysed a cohort of 150 azoospermic or oligozoospermic patients (sperm concentration <20x106/ml) with a panel of 24 Y chromosome markers (unpublished data). Interestingly, three of the infertile patients (13-629, 13-639 and 13-694) shown to have an AZFc deletion are brothers, suggesting that their deleted Y chromosome was received from their father (13–1379). The extended family is shown in Figure 1, together with the results of paternity testing. Clinical details for the three infertile sons and their father are given in the text and are summarized in Figure 2. The estimated age of the father at the time of conception of his first three sons was 25, 27 and 28 years old respectively. At the time of conception of his fourth son, who was not available for testing, the father was 30 years old. Figure 2 clearly shows that at least two of the sons, 13-629 and 13-639, had extremely low sperm counts at an age at which their father was still fertile. The son 13-694 did not attempt to begin a family until he was older than his father had been at the time he conceived his fourth son.
|
|
The father's DNA was tested by PCR exactly as for that of his sons, and at this level of resolution he and his sons were seen to possess an identically deleted Y chromosome (Figure 3
). The presence of the Yq heterochromatin marker sY160 and a normal karyotype in all four individuals shows that the deletion of the AZFc interval is interstitial. PCR with 13 AZFc interval markers on DNA from blood lymphocytes revealed no evidence of mosaicism. However, this does not exclude the possibility that an intact Y chromosome could be present in a small percentage of cells in the father's blood.
|
Our PCR analysis of this AZFc-deleted family indicated that all copies of BPY2, CDY1 and DAZ were deleted. Since PCR might fail to detect members of these gene families whose sequence varied at the binding sites for the primers used, we performed Southern blot analysis to define the copy number of BPY2, CDY1 and DAZ in the father and his three sons (Figure 4
). A BsaI restriction enzyme site difference was identified between CDY1 and CDY2 by sequence comparison, and the use of BsaI restricted genomic DNA allowed the clear discrimination of fragments corresponding to CDY1 and CDY2 by Southern blot analysis. No copies of BPY2, CDY1 or DAZ were detected in blood lymphocyte DNA from either the father or his three infertile sons. Thus, our results demonstrate unequivocally that efficient spermatogenesis can be sustained over a period of at least 3 years (and possibly 5 years), in a man with a Y chromosome bearing an AZFc deletion that results in the loss of the three candidate azoospermia genes BPY2, CDY1 and DAZ.
|
Discussion
The family presented in this study (and that presented by Chang et al., 1999), appear to represent exceptional cases where a large AZFc deletion is not associated with a significant reduction in fertility. It has previously been suggested that spermatogenesis is compromised in individuals who have transmitted an AZFc-deleted chromosome to an only son (Vogt et al., 1996; Pryor et al., 1997), and so their phenotype may not truly differ from that of infertile males carrying a similar deletion who have not fathered children. We have established that the father in the family presented here definitely sustained fertility until the age of 28 years, and the intervals at which the three sons tested in this study were born, indicates that he had no problems with his fertility. On the other hand, his three sons have been unable to father children and show a drastic reduction in their sperm count. The most recent sperm counts of the sons 13-629 and 13-639 are lower than those ascertained at earlier dates, but due to the variability of an individual's sperm count these results should not be taken as evidence of a deterioration of the phenotype.
The presence of a low level of mature spermatozoa in the ejaculate of the son 13–639, in 1995, coincided with a failure to find spermatogenic activity by histological examination of a testicular biopsy. This apparent absence of spermatogenic activity associated with spermatozoa in the ejaculate suggests that spermatogenesis is localized to small patches in the testis of the son 13-639; this is consistent with previous histological observations of the AZFc-deleted testis (Reijo et al., 1995; Vogt et al., 1996). Three spermatozoa were recovered from a subsequent biopsy of the son 13-639, when he was found to be azoospermic, supporting the view that mature spermatozoa can generally be recovered from testicular biopsies of azoospermic patients with AZFc-deletions (Silber et al., 1998).
Understanding the basis for the different phenotypes associated with the AZFc deletion in this family should provide important clues as to the identity of AZF. We will discuss three ways in which AZFc-deleted individuals with sustained fertility might differ from their sons and also from most other reported AZFc-deleted cases: (i) the deletion has increased in size between father and son; (ii) the father is mosaic and his germline bears cells in which the AZFc interval is present; (iii) the father, but not his sons, carries a rare allele or a combination of alleles on the X chromosome or the autosomes that suppress the phenotypic expression of the AZFc-deletion.
If the first proposition is correct, and the deletion has expanded between the father and his sons, then the absence of BPY2, CDY1 and DAZ from the fertile father's Y chromosome excludes these genes as candidate AZF genes. The transmission of an expanded deletion from a father to a single son has previously been reported in the distal part of the AZFc interval (Stuppia et al., 1996). In families with multiple sons, however, it seems a less likely possibility and we find no molecular evidence that this has occurred. If the extent of the deletion has increased to include the AZF gene in the family presented here, then the deleted Y chromosome of the father must be inherently unstable during spermatogenesis, since the additional deletion has been passed on to three sons. Furthermore, infertile males have been reported with an AZFc deletion whose proximal and distal breakpoints lie within those that we have defined on the father's Y chromosome; WHT2564, WHT2613 and KLARD are not deleted for the markers sY153 or sY158 (Reijo et al., 1995; Silber et al., 1998), both of which are absent from the father's Y chromosome. This suggests that the AZFc gene is already deleted from the father.
The second proposition that mosaicism in the father explains his sustained fertility also seems unlikely. Although PCR revealed no evidence of mosaicism in his blood lymphocytes, it remains possible that, at the time the father conceived his children, germ cells carrying a non-deleted Y chromosome were present in significant numbers in his testes. Nevertheless, since the AZFc-deletion appears to affect the efficiency of spermatogenesis, it is difficult to imagine that an AZFc-deleted cell line could compete with a non-deleted line and transmit the deleted Y chromosome preferentially to three offspring. Logically, all three sons would receive the intact chromosome from the father. The intact chromosome would have to be inherently unstable and have deleted when transmitted to each of the sons.
The third proposition, that the differences in phenotypic expression are due to variation in the genetic background, seems to us the most probable explanation. Since the occurrence of AZFc deletions in the fertile population is rare, the alleles that suppress the AZFc phenotype must themselves be rare. The failure to transmit the genetic background to any of seven infertile sons in the two families gives some clues as to the nature of the alleles involved. If AZFc phenotypic rescue is effected by autosomal dominant alleles, it is likely that at least two unlinked loci are involved. A single X-linked allele, on the other hand, would not be transmitted to any sons, since sons never receive their father's X chromosome. A further possibility would be that rescue is effected by a rare autosomal recessive allele for which the father is homozygous but which is absent from the mother. In this scenario, the sons would all be heterozygous and infertile.
The identification of the AZF gene in the AZFc interval is fraught with difficulties. The deletions that result in the loss of the AZF are all large and are probably mediated by unequal recombination (Vogt, 1998). Smaller deletions, which could delimit a critical interval more precisely, may not be detectable using the current PCR-based screening techniques, because of the multi-copy nature of most of the sequences that compose the AZFc interval (Kirsch et al., 1996; Yen, 1998). The detection of point mutations associated with infertility in the multi-copy gene families of the AZFc interval is very challenging, and the identification of a mutation in a single member of a gene family would be difficult to interpret. It is therefore unclear how the AZF gene will be identified using a classical positional cloning approach on the Y chromosome. Attempting to understand the genetic basis for sustained fertility in AZFc-deleted individuals may provide an alternative route to the identification of the AZF and its role in spermatogenesis.
Acknowledgments
We are grateful to the family members who participated in this study by generously donating samples. We thank J.Belougne for sequencing, D.C.Page for the kind gift of plasmid pDP1577 and M.A.Mitchell for proof-reading the manuscript. This work was in part supported by a grant from the Groupement de recherches et d'études sur les génomes (GREG). N.S. was supported by a studentship from the Ministère de l'éducation nationale, de l'enseignement supérieur et de la recherche (MENESR).
Notes
4 To whom correspondence should be addressed at: Inserm U.491, Faculté de Médecine, 27 Boulevard Jean Moulin, 13385 Marseille cedex 05, France. E-mail: mitchell{at}ibdm.univ-mrs.fr 
References
Chang, P.L., Sauer, M.V. and Brown, S. (1999) Y chromosome microdeletion in a father and his four infertile sons. Hum. Reprod., 14, 2689–2694.
Girardi, S.K., Mielnik, A. and Schlegel, P.N. (1997) Submicroscopic deletions in the Y chromosome of infertile men. Hum. Reprod., 12, 1635–1641.
Grimaldi, P., Scarponi, C., Rossi, P. et al. (1998) Analysis of Yq microdeletions in infertile males by PCR and DNA hybridization techniques. Mol. Hum. Reprod., 4, 1116–1121.
Kirsch, S., Keil, R., Edelmann, A. et al. (1996) Molecular analysis of the genomic structure of the human Y chromosome in the euchromatic part of its long arm (Yq11). Cytogenet. Cell. Genet., 75, 197–206.[ISI][Medline]
Kobayashi, K., Mizuno, K., Hida, A. et al. (1994) PCR analysis of the Y chromosome long arm in azoospermic patients: evidence for a second locus required for spermatogenesis. Hum. Mol. Genet., 3, 1965–1967.
Krausz, C., Quintana-Murci, L., Barbaux, S. et al. (1999) A high frequency of Y chromosome deletions in males with nonidiopathic infertility. J. Clin. Endocrinol. Metab., 84, 3606–3612.
Lahn, B.T. and Page, D.C. (1997) Functional coherence of the human Y chromosome. Science, 278, 675–680.
Lahn, B.T. and Page, D.C. (1999) Retroposition of autosomal mRNA yielded testis-specific gene family on human Y chromosome. Nature Genet., 21, 429–433. [Published erratum appears in Nature Genet., 22, 209].[ISI][Medline]
Ma, K., Sharkey, A., Kirsch, S. et al. (1992) Towards the molecular localization of the AZF locus: mapping of microdeletions in azoospermic men within 14 subintervals of interval 6 of the human Y chromosome. Hum. Mol. Genet., 1, 29–33.
Mitchell, M.J., Woods, D.R., Tucker, P.K. et al. (1991) Homology of a candidate spermatogenic gene from the mouse Y chromosome to the ubiquitin-activating enzyme E1. Nature, 354, 483–486.[Medline]
Pryor, J.L., Kent-First, M., Muallem, A. et al. (1997) Microdeletions in the Y chromosome of infertile men. N. Engl J. Med., 336, 534–539.
Reijo, R., Lee, T.Y., Salo, P. et al. (1995) Diverse spermatogenic defects in humans caused by Y chromosome deletions encompassing a novel RNA-binding protein gene. Nature Genet., 10, 383–393.[ISI][Medline]
Silber, S.J., Alagappan, R., Brown, L.G. et al. (1998) Y chromosome deletions in azoospermic and severely oligozoospermic men undergoing intracytoplasmic sperm injection after testicular sperm extraction. Hum. Reprod., 13, 3332–3337.
Simoni, M., Gromoll, J., Dworniczak, B. et al. (1997) Screening for deletions of the Y chromosome involving the DAZ (Deleted in AZoospermia) gene in azoospermia and severe oligozoospermia. Fertil. Steril., 67, 542–547.[ISI][Medline]
Stuppia, L., Calabrese, G., Franchi, P.G. et al. (1996) Widening of a Y-chromosome interval-6 deletion transmitted from a father to his infertile son accounts for an oligozoospermia critical region distal to the RBM1 and DAZ genes. [Letter.] Am. J. Hum. Genet., 59, 1393–1395.[ISI][Medline]
Vogt, P.H. (1998) Human chromosome deletions in Yq11, AZF candidate genes and male infertility: history and update. Mol. Hum. Reprod., 4, 739–744.
Vogt, P.H., Edelmann, A., Kirsch, S. et al. (1996) Human Y chromosome azoospermia factors (AZF) mapped to different subregions in Yq11. Hum. Mol. Genet., 5, 933–943.
Vollrath, D., Foote, S., Hilton, A. et al. (1992) The human Y chromosome: a 43-interval map based on naturally occuring deletions. Science, 258, 52–59.
Yen, P.H. (1998) A long-range restriction map of deletion interval 6 of the human Y chromosome: a region frequently deleted in azoospermic males. Genomics, 54, 5–12.[ISI][Medline]
Submitted on March 7, 2000; accepted on June 26, 2000.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  W. J. Huang, Y.-W. Lin, K.-N. Hsiao, K. S. Eilber, E. C. Salido, and P. H. Yen Restricted expression of the human DAZ protein in premeiotic germ cells Hum. Reprod., June 1, 2008; 23(6): 1280 - 1289. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Ferlin, B. Arredi, E. Speltra, C. Cazzadore, R. Selice, A. Garolla, A. Lenzi, and C. Foresta Molecular and Clinical Characterization of Y Chromosome Microdeletions in Infertile Men: A 10-Year Experience in Italy J. Clin. Endocrinol. Metab., March 1, 2007; 92(3): 762 - 770. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Seli and D. Sakkas Spermatozoal nuclear determinants of reproductive outcome: implications for ART Hum. Reprod. Update, July 1, 2005; 11(4): 337 - 349. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Lynch, D.S. Cram, A. Reilly, M.K. O'Bryan, H.W.G. Baker, D.M. de Kretser, and R.I. McLachlan The Y chromosome gr/gr subdeletion is associated with male infertility Mol. Hum. Reprod., July 1, 2005; 11(7): 507 - 512. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Stouffs, W. Lissens, H. Tournaye, A. Van Steirteghem, and I. Liebaers The choice and outcome of the fertility treatment of 38 couples in whom the male partner has a Yq microdeletion Hum. Reprod., July 1, 2005; 20(7): 1887 - 1896. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Gianotten, M.P. Lombardi, A.H. Zwinderman, R. J. Lilford, and F. van der Veen Idiopathic impaired spermatogenesis: genetic epidemiology is unlikely to provide a short-cut to better understanding Hum. Reprod. Update, November 1, 2004; 10(6): 533 - 539. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N Machev, N Saut, G Longepied, P Terriou, A Navarro, N Levy, M Guichaoua, C Metzler-Guillemain, P Collignon, A-M Frances, et al. Sequence family variant loss from the AZFc interval of the human Y chromosome, but not gene copy loss, is strongly associated with male infertility J. Med. Genet., November 1, 2004; 41(11): 814 - 825. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Ferras, S. Fernandes, C.J. Marques, F. Carvalho, C. Alves, J. Silva, M. Sousa, and A. Barros AZF and DAZ gene copy-specific deletion analysis in maturation arrest and Sertoli cell-only syndrome Mol. Hum. Reprod., October 1, 2004; 10(10): 755 - 761. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Kuhnert, J. Gromoll, E. Kostova, P. Tschanter, C.M. Luetjens, M. Simoni, and E. Nieschlag Case Report: Natural transmission of an AZFc Y-chromosomal microdeletion from father to his sons Hum. Reprod., April 1, 2004; 19(4): 886 - 888. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. E. Aknin-Seifer, H. Lejeune, R. L. Touraine, R. Levy, and Under the aegis of the SALF (Societe d'Andrologie Y chromosome microdeletion screening in infertile men in France:a survey of French practice based on 88 IVF centres Hum. Reprod., April 1, 2004; 19(4): 788 - 793. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Gianotten, G.H. Westerveld, N. J. Leschot, M. W.T. Tanck, R. J. Lilford, M.P. Lombardi, and F. van der Veen Familial clustering of impaired spermatogenesis: no evidence for a common genetic inheritance pattern Hum. Reprod., January 1, 2004; 19(1): 71 - 76. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.V. Hopps, A. Mielnik, M. Goldstein, G.D. Palermo, Z. Rosenwaks, and P.N. Schlegel Detection of sperm in men with Y chromosome microdeletions of the AZFa, AZFb and AZFc regions Hum. Reprod., August 1, 2003; 18(8): 1660 - 1665. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Frydelund-Larsen, C. Krausz, H. Leffers, A. M. Andersson, E. Carlsen, S. Bangsboell, K. Mcelreavey, N. E. Skakkebaek, and E. Rajpert-De Meyts Inhibin B: A Marker for the Functional State of the Seminiferous Epithelium in Patients with Azoospermia Factor c Microdeletions J. Clin. Endocrinol. Metab., December 1, 2002; 87(12): 5618 - 5624. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. D. Oates, S. Silber, L. G. Brown, and D. C. Page Clinical characterization of 42 oligospermic or azoospermic men with microdeletion of the AZFc region of the Y chromosome, and of 18 children conceived via ICSI Hum. Reprod., November 1, 2002; 17(11): 2813 - 2824. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Rolf, J. Gromoll, M. Simoni, and E. Nieschlag Natural transmission of a partial AZFb deletion of the Y chromosome over three generations: Case report Hum. Reprod., September 1, 2002; 17(9): 2267 - 2271. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Kostova, S. Rottger, W. Schempp, and J. Gromoll Identification and characterization of the cynomolgus monkey chromodomain gene cynCDY, an orthologue of the human CDY gene family Mol. Hum. Reprod., August 1, 2002; 8(8): 702 - 709. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V Gatta, L Stuppia, G Calabrese, E Morizio, P Guanciali-Franchi, and G Palka A new case of Yq microdeletion transmitted from a normal father to two infertile sons J. Med. Genet., June 1, 2002; 39(6): e27 - 27. [Full Text] [PDF]
|
|
|
|
|
|
C. Krausz and K. McElreavey Y chromosome microdeletions in `fertile' males Hum. Reprod., June 1, 2001; 16(6): 1306 - 1306. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||