Molecular Human Reproduction, Vol. 7, No. 1, 11-20,
January 2001
© 2001 European Society of Human Reproduction and Embryology
Testis and spermatogenesis |
Identification of human candidate genes for male infertility by digital differential display
1 Department of Medical Genetics, Institute of Medical Biochemistry and Genetics, University of Copenhagen, Blegdamsvej 3, DK-2200 Copenhagen N, 2 Fertility Clinic, Department of Gynecology and Obsterics, Odense University Hospital, DK-5000 Odense C, 3 Laboratory of Reproductive Biology, Center for Children, Women and Reproduction, Rigshospitalet, Section 5712, Blegdamsvej 9, DK-2100 Copenhagen, Denmark, 4 Department of Human Genetics, Medizinische Universitaet zu Lübeck, Ratzeburger Alle 160, D-23538 Lübeck, Germany, 5 Medical Genetics, `La Paz' Hospital, P.Castellana 261, E-28046 Madrid, Spain, 6 Human Genetisk Institut, Bartholin Bygningen, Aarhus Universitet, DK-8000 Aarhus C, Denmark, 7 Department of Clinical Genetics, University Hospital, SE-22185 Lund, Sweden, 8 Institute of Human Genetics, University of Bonn, Wilhelmstr. 31, D-53111 Bonn, Germany, 9 Center for Medical Genetics, University Hospital, Dutch-speaking Free University of Brussels, Laarbeeklaan 101, BE-1090 Brussels, Belgium, 10 Department of Clinical Genetics, East Hospital, SE-41685 Goeteborg, Sweden, and 11 Laboratorie de Cytogenetique, Centre Hospitalier, BP 1125, F-73011 Chambery Cedex, France
Abstract
Evidence for the importance of genetic factors in male fertility is accumulating. In the literature and the Mendelian Cytogenetics Network database, 265 cases of infertile males with balanced reciprocal translocations have been described. The candidacy for infertility of 14 testis-expressed transcripts (TETs) were examined by comparing their chromosomal mapping position to the position of balanced reciprocal translocation breakpoints found in the 265 infertile males. The 14 TETs were selected by using digital differential display (electronic subtraction) to search for apparently testis-specific transcripts in the TIGR database. The testis specificity of the 14 TETs was further examined by reverse transcription–polymerase chain reaction (RT–PCR) on adult and fetal tissues showing that four TETs (TET1 to TET4) were testis-expressed only, six TETs (TET5 to TET10) appeared to be differentially expressed and the remaining four TETs (TET11 to TET14) were ubiquitously expressed. Interestingly, the two tesis expressed-only transcripts, TET1 and TET2, mapped to chromosomal regions where seven and six translocation breakpoints have been reported in infertile males respectively. Furthermore, one ubiquitously, but predominantly testis-expressed, transcript, TET11, mapped to 1p32-33, where 13 translocation breakpoints have been found in infertile males. Interestingly, the mouse mutation, skeletal fusions with sterility, sks, maps to the syntenic region in the mouse genome. Another transcript, TET7, was the human homologue of rat Tpx-1, which functions in the specific interaction of spermatogenic cells with Sertoli cells. TPX-1 maps to 6p21 where three cases of chromosomal breakpoints in infertile males have been reported. Finally, TET8 was a novel transcript which in the fetal stage is testis-specific, but in the adult is expressed in multiple tissues, including testis. We named this novel transcript fetal and adult testis-expressed transcript (FATE).
chromosomal mapping/male infertility/testis-expressed transcripts/translocation breakpoints
Introduction
Human infertility is a common problem which affects 13% of couples (Van Assche et al., 1996
); both female and male factors are known to contribute (Chandley, 1979), but failures related to germ cell formation have been studied more intensively in males than in females. One reason is that the production of germ cells from the undifferented spermatogonia to the mature spermatozoa occurs during adulthood, whereas the production of the oocyte takes place during fetal life. Moreover, the extracorporal position of the testis makes studies of gametogenesis more feasible in the male than in the female.
Although several external factors (including xenobiotics) have been claimed to affect male reproduction (Sharpe and Skakkebæk, 1993), evidence that genetic factors play an important role is accumulating. A reduction in sperm count and fertility has been found to be associated with an increased rate of chromosomal abnormalities (Chandley, 1979; Retief et al., 1984; Van der Ven et al., 1997). The rate of abnormalities has been reported to be as high as 15.4% in azoospermic men, while the rate is 4.1% in men with oligozoospermia. One reason might be related to impaired chromosome pairing and crossing-over in meiosis (Goldman and Hulten, 1993). Another possibility is that some chromosomal breakpoints may interfere with genes important for testicular development and function.
Chromosomal breakpoints that delete or inactivate specific genes have proven to be very useful in the identification of disease-causing genes (Tommerup, 1993). Indeed, the clustering of Yq-deletions in a subgroup of infertile males was originally detected as microscopically visible de-novo deletions on the long arm of the Y chromosome in azoospermic men (Tiepolo and Zuffardi, 1976). This cytogenetic observation has been confirmed at the molecular level, as a fraction of males suffering from idiopathic oligozoospermia or azoospermia have microdeletions within the Yq11 region (Reijo et al., 1995; Vogt et al., 1996; Kremer et al., 1997; Van der Ven et al., 1997), with an estimated overall frequency of Yq microdeletions in azoospermia and oligozoospermia of 12.2 and 3.4% respectively (Simoni et al., 1998). Further analysis of the Yq11 region has revealed three non-overlapping spermatogenesis loci, suggesting the presence of several spermatogenesis genes (Vogt et al., 1996). Two candidate gene families have been identified in the deleted regions, the RBM (RNA Binding Motif) and DAZ (Deleted in AZoospermia) (Ma et al., 1993; Reijo et al., 1995) families. These two gene families encode proteins with homology to RNA-binding proteins and both families display a testis-specific expression pattern, which supports their potential role in spermatogenesis. Within the DAZ region, only one transcriptional unit (termed the DAZ gene) has been identified. So far, attempts to identify DAZ point mutations or intragenetic deletions in sterile men have failed (Vereb et al., 1997). Thus, the involvement of DAZ in infertility is only circumstantial.
With a frequency ranging from 3.4–12.2%, Yq-microdeletions can only account for a minority of the azoospermia/oligozoospermia cases, suggesting that X-linked or autosomal genes are likely to be involved as well. Furthermore, chromosomal abnormalities in infertile men have been reported to be distributed equally between sex and autosomal chromosomes (Retief et al., 1984). One of the few known autosomal candidate genes in humans is the recently isolated DAZLA (DAZ-like autosomal) gene. This gene was mapped to 3p24 and is expressed exclusively in testis and ovary (Yen et al., 1996; Nishi et al., 1999). In addition, the predicted protein sequence shares a high degree of identity with DAZ (83%) and a Drosophlia male infertility gene, boule (42%). Mutations in the boule gene have been shown to cause meiotic cell cycle arrest during spermatogenesis in the fly (Eberhart et al., 1996). Furthermore, the genomic structure of the DAZLA gene indicates that it is probably the human homologue of boule.
The expression pattern of a gene may be used as an indicator for its potential function and involvement in disease conditions. In an attempt to identify new candidate genes for male infertility, we used a digital differential display approach to search for testis-specific human transcripts. Digital differential display (i.e. electronic subtraction) is based on the public genome databases (dbEST, UniGene), that contain a vast amount of indirect expression data on human genes in the form of Expressed Sequence Tags (ESTs). Recently, ordering of overlapping ESTs has generated a non-redundant set of human transcript sequences, allowing a computer-based search for transcripts that are tissue-specific (Adams et al., 1995). In this study, we selected 29 testis-expressed transcripts (TETs) using the Search for Tissue Specific Transcript program in the TIGR Human Gene Index database. From these, 14 TETs were mapped to chromosomes by radiation hybrid mapping. Reverse transcription–polymerase chain reaction (RT–PCR) semi-quantitative expression analysis revealed that four transcripts were only testis-expressed, six were differentially expressed and four transcripts were ubiquitously expressed in adult tissues. By comparing the map positions to the location of breakpoints in 265 infertile men with balanced reciprocal translocations, collected from the literature and from the Mendelian Cytogenetics Network database (E.Van Assche et al., unpublished data), we identified one X-linked and 11 autosomal candidate male infertility genes, of which four were expressed only in the testis.
Materials and methods
Chromosomal breakpoints in 265 infertile males
In the literature and the Mendelian Cytogenetics Network database (http://mcndb.imbg.ku.dk), 265 cases of infertile males with balanced reciprocal translocations have been described. The cause of infertility was in some cases unexplained, while in others it was explained by a low quantity of spermatozoa (azoospermia or oligozoospermia), by abnormal sperm motility or morphology or by Sertoli cell-only syndrome. Comparison of the karyotype of these 265 infertile males has shown that many of the chromosomal breakpoints were clustered, indicating that the implicated breakpoint regions might contain one or more genes with a function in male fertility (E.Van Assche et al., unpublished data). In this study, the chromosomal position of these breakpoint clusters was used to further examine the candidacy for infertility of a collection of TETs by comparing their chromosomal map position with the position of the breakpoint regions.
Selection of transcripts and data analysis
The large-scale sequencing of tissue-specific cDNA libraries worldwide has produced millions of novel expressed sequence tags (ESTs), representing both known and unknown genes. The ordering of overlapping ESTs has generated a non-redundant set of clusters. Each cluster contains sequences that represent a unique human transcript, as well as related information such as the tissue types in which the transcript is expressed. This organization of sequence information allows a computer-based search for transcripts that are expressed exclusively or predominantly in a single tissue. At present, this search can be performed on the TIGR database (Adams et al., 1995; http://www.tigr.org/tdb/hgi/searching/xpress_search.html) and the Digital Differential Display Program at UniGene division at the NCBI servers (Schuler, 1997; http://www.ncbi.nlm.nih.gov/ UniGene/ddd.cgi?ORG=Hs). In this study, the TIGR Human Gene Index website was used to search for 100% testis-specific human transcripts. This expression search gave a total of 131 transcripts (date: 01.07.98). The TET sequences were analysed and compared with various databases using the FASTA software at the EMBL servers (http://www2.ebi.ac.uk/fasta3/).
Primer selection and radiation hybrid mapping
Pairs of perfect matching primers were designed for each TET (Table I) using the program Oligo (National Biosciences Inc). Primer sets were tested by PCR on human genomic DNA (1 µg), and the resulting PCR products were resolved on 5% Metafor agarose gels (FMC BioProducts). The DNA PCR kit from Perkin Elmer was used, according to the manufacturer's protocol. The PCR reactions were carried out in a final volume of 15 µl and consisted of 1x reaction buffer, 10 mmol/l dNTP, 10 pmol each of sense and antisense primer, 15 mmol/l MgCl2 and 1 IU of the Thermostable Ampli Taq DNA polymerase from Perkin Elmer. The PCR conditions used were 94°C for 5 min; then 40 cycles of 94°C for 20 s, annealing for 20 s, 72°C for 20 s; followed by 72°C for 5 min. Annealing temperatures and sizes of the predicted PCR products are given in Table I. The human radiation hybrid mapping panel, GeneBridge 4 (HGMP Resource Center, Hinxton Hall, Hinxton, Cambridge, UK) was used for mapping. DNA from each hybrid cell line (50 ng) was subjected to PCR using the conditions given above. The resulting data vector was submitted to http://www-genome.wi.mit.edu./cgi-bin/contig/rhmapper.pl. to obtain flanking genetic markers. The most probable cytogenetic location of the markers were obtained from The NCBI genome division (http://www.ncbi.nlm.nih.gov/Entrez/Genome/org.html).
|
Preparation of cDNA panels from 11 different human fetal tissues
The fetal tissues were collected from legal abortions performed at the Odense University Hospital. Ethics approval was obtained from the Scientific Committee of Fyn and Vejle Counties (case number 95/191). Tissues were snap-frozen in liquid nitrogen immediately after dissection. The fetal age was determined according to previously described criteria (Evtouchenko et al., 1996
). A total of eight different fetuses aged 6–11 weeks were used for this study. Total RNA was isolated from liver (7 weeks), kidney (9 weeks), adrenal gland (7 weeks), heart (8 weeks), lung (8 weeks), small intestine (7 weeks), amnions (6 weeks), limb (11 weeks), sex ducts (7 weeks), and testis and ovary (7 weeks) by the acid guanidine thiocyanate–phenol–chloroform extraction method (Chomczynski and Sacchi, 1987). Total RNA (2.5 µg) from each tissue were treated with 5 IU DNase 1 (Life Technologies, Denmark) in a final volume of 40 µl for 15 min at room temperature. The integrity of the RNA after DNase treatment was tested by electrophoresis on a 1% agarose gel. Then, RNA was reverse-transcribed using a mixture of the three anchor primers 5'AAGC(T)11A 3', 5'AAGC(T)11C 3' and 5'AAGC(T)11G 3'. The four bases, AAGC, added to the 5'-end of the anchor primer sequences introduce a restriction site that facilitates cloning. Reverse transcription reaction mixtures consisted of 2.0 µg of RNA, 25 µl 5x first strand buffer, 12.5 µl 100 mmol/l dithiothreitol (DTT), 25 µl primer (final concentration 10 µmol/l), 3.5 µl PRIME RNase inhibitor (final concentration 1.0 IU/µl) and 20 µl dNTP (final concentration 10 mmol/l) in a final volume of 125 µl. The reaction mixtures were heated to 65°C for 5 min and then transferred to 37°C. After incubation at 37°C for 10 min 5 µl (200 IU/µl) of Superscript 2 reverse transcriptase (Life Technologies) was added (final concentration 8 IU/µl). Reverse transcription was allowed to proceed for 1 h at 37°C. The reaction was stopped by heating to 95°C for 5 min and then cooled on ice. The 11 resulting cDNA preparations were tested by PCR with specific human ß-actin primers as a control for integrity and concentration. The sense primer was 5' AAGTGTGACGTTGACATCCG 3' and the antisense primer 5'GATCCACATCTGCTGGAAGG 3' (GenBank accession no. X00351). The reaction was carried out in a final volume of 15 µl using 1 µl of cDNA. PCR conditions were 94°C for 5 min; then 23 cycles of 94°C for 20 s, 55°C for 20 s, 72°C for 20 s; followed by 72°C for 5 min. The cDNA panel was further tested for contamination with genomic DNA: the specific primer pair designed from TET14, sense 5'CATCTACCACCGCAAGT 3' and antisense 5' CCCATTCTCAGCATTTCT 3', was found to flank an intron of 606 bp. As a result, the primer set yielded a PCR fragment of 720 bp on genomic DNA and a fragment of 114 bp on cDNA. Using this difference in size, contamination with genomic DNA was excluded. PCR conditions were as described for the ß-actin gene.
Preparation of a cDNA panel from eight different adult human tissues
Total RNA from liver, lung, heart, kidney, adrenal gland, testis and whole brain were purchased from Clontech (Clontech Laboratories Inc, USA). DNase treatment and first-strand synthesis were performed as described for the fetal cDNA panel.
Semi-quantitative RT–PCR expression analysis
The tissue distribution of the 14 TETs was analysed by 35 cycles of PCR on the fetal and adult cDNA panels, using the same primers and PCR conditions as described for radiation hybrid (RH) mapping. In addition, the determination of expression of SRY in the fetal testis, fetal ovary and adult testis was included in the analysis. The generated PCR products were analysed by resolution on 2% agarose gels.
Results
Transcript selection and DNA sequence analysis
To identify human TETs, a digital differential display approach was used. A testis-specific expression search at the TIGR database (Adams et al., 1995) initially identified 131 apparently testis-specific transcripts. Following elimination of sequence redundancy, the number was reduced to 99. In the digital display system, the abundance of a transcript can be expressed as the number of times that particular transcript has been isolated as a cDNA clone, and 29 transcripts appearing to be the most abundant were selected. Primer pairs for these 29 transcripts were designed and tested on genomic DNA with PCR. Of 17 transcripts, that generated a fragment of expected size, 14 were successfully mapped to chromosomes by radiation hybrid mapping. The 14 mapped transcripts were named Testis Expressed Transcript and numbered in succession (TET1–14). The GenBank accession numbers are given in Table I
and a flow chart of the digital differential display approach is given in Figure 1.
|
Searches performed with the FASTA program revealed that 12 of the 14 TETs had no significant homology with any current database entry. However, as the query nucleotide sequences are not full length, it cannot be excluded that some of them might represent known genes. One transcript, TET7 was identical to a known gene, TPX1. This gene encodes a polypeptide with 55% similarity to a rat sperm-coating glycoprotein, and is testis-specific in the mouse (Kasahara et al., 1987
, 1989). In addition, the deduced amino acid sequence of TET12 was 63% homologous with the hen serine protease inhibitor, ovostatin (Nielsen et al., 1994).
Expression analysis of TETs
The expression patterns of TET1-14 were analysed by RT–PCR on a cDNA panel covering eight different adult human tissues (Figure 2). All 14 transcripts were found to be expressed in testis and could further be divided into three categories: (i) testis-expressed only transcripts; (ii) differentially expressed transcripts; and (iii) ubiquitously expressed transcripts. We prefer the term `testis-expressed only' rather than `testis-specific', since the expression analysis was limited to eight adult tissues and 11 fetal tissues. Four transcripts (TET1-4) were testis-expressed only and six transcripts (TET5-10) were found to be differentially expressed, as a product was produced in two or more tissues. A characteristic feature of the differentially expressed transcripts is that they all appear to be up-regulated in testis. The abundance of these transcripts appears to be weakly reflected in the number of times they have been isolated as ESTs in testis libraries: TET5 and TET10 have been isolated three times each, while TET7 and TET8 have been isolated nine and seven times respectively. In comparison, TET6 appears to be weakly expressed in testis and lung. However, this transcript has been isolated four times as an EST. In addition, TET9 was isolated 35 times as an EST sequence from various testis libraries although it appears to be only slightly up-regulated in testis relative to the compared tissues. Thus, only a moderate correlation seems to exist between the relative frequency of a unique EST in a library and the actual abundance of the corresponding transcript in the tissue. The group of differentially expressed transcripts also includes TPX-1 (TET7), which previously had been demonstrated to be testis-specific in mouse (Kasahara et al., 1987). Our data indicate that the human TPX1 is a predominately testis-expressed gene with some expression in lung and kidney as well. The last category of transcripts includes TET11–14 which are expressed in all examined tissues. With regard to TET11 and TET14, our finding that they are not testis-specific but expressed in several different tissues is supported by the isolation of identical transcripts from human T-cell libraries (accession no. AA306268) and a placenta library (accession no. R82847) respectively. In addition, EST sequences identical to TET12 have been found in multiple tissues, including heart and lung (accession nos. W92314 and AI290954), which is in agreement with our data.
|
The expression pattern of the 14 transcripts was further analysed in human fetal tissues at the age of 6–12 weeks (Figures 3 and 4
). Eight transcripts (TET1-4, TET6-7 and TET10-11) were not detected in any of the examined fetal tissues. One transcript, TET8, was found to be testis-expressed only in the fetal stages analysed. The age of the fetal testis and ovary used in this study was 7 weeks. We further determined the expression of SRY in the fetal gonads and adult testis (Figure 4). SRY expression was evident in both fetal and adult testis, but not in the fetal ovary, which is in agreement with previous findings (Clepet et al., 1993). Finally, TET9 was found to be expressed only in the fetal adrenal gland. The expression pattern of the 14 TETs is summarized in Figure 1 and Table II.
|
|
|
Mapping of TETs by radiation hybrid mapping
Transcript-specific primers and PCR conditions used for expression analysis were applied to a human radiation hybrid mapping panel for chromosomal mapping of the 14 TETs. The panel consists of 86 different somatic cell hybrids which have been generated by fusion of an X-ray irradiated human cell line with a normal rodent cell line. Each hybrid contains fragments of the human genome which have been incorporated into the rodent genome and which have been analysed for the content of 404 human sequence-tagged sites (STSs) markers. The complete panel covering all human chromosomal DNA allows the examination for co-retention by PCR. The generated co-retention profile (the data vector) was submitted to the Whitehead Institute (Cambridge, MA, USA) to obtain chromosomal assignments and the distance to the genetic markers (Table II
). The most probable cytogenetic map positions were obtained by querying the NCBI Genome division. All 14 TETs were mapped with a lod score >3.
Searching GeneMap'99 (Deloukas et al., 1998) (date: 10 January 2000) at the NCBI server revealed that TET3, TET7 and TET11 had been previously mapped to 6p22.1, 6p21 and 1p31-32 respectively (accession no. AI026687; 20; accession no. AI027705), which agrees well with our data. Furthermore, the chromosomal assignments for an additional four TETs have emerged from the human genome sequencing project during the course of this study. These include TET8, TET9, TET12 and TET14, whose nucleic acid sequences are contained within genomic clones (accession no. AF002992; AC004029; AC006208) derived from the chromosomal regions Xq28, 7q31, and 3p21.1–9 respectively. This is consistent with our map positions (Table II). The chromosomal localization of the remaining seven transcripts had not been previously determined.
Comparison with chromosomal breakpoint regions in infertile males
The mapping results of the 14 TETs were compared with the location of breakpoints in 265 infertile males with balanced reciprocal translocations collected from the literature and from the Mendelian Cytogenetics Network database (http://mcndb.imbg.ku.dk) (Van Assche et al., unpublished data) (Table II). The four testis-expressed only transcripts (TET1-4), all mapped to a region containing one or more breakpoints, and five of six differentially expressed transcripts (TET5-9) were also located at a breakpoint region. Thus, the overall frequency of matches to a breakpoint region were 100 and 83% for testis-expressed only and differentially-expressed transcripts respectively. Of the remaining four transcripts with an ubiquitous expression pattern, three (TET11-13) were also found to map to breakpoint regions.
The karyotype and available clinical data on sperm quantity, motility and morphology for 36 of the 265 infertile male cases used in this study, are presented in Table III. The 36 cases include 23 published and 13 novel cases. The chromosomal breakpoints identified in these 36 cases occur in five different clusters in the chromosomal regions 9q21-22, 3p13-14, 1q22-23, 1p36, and 1p32-33, where TET1, TET2, TET5, TET6 and TET11 map to respectively. These breakpoint regions were selected because they have the highest number of cases of breakpoints in infertile males. The number of cases within each cluster range from three to 13. The cause of infertility was in some cases unexplained, while other cases are explained by a low quantity of spermatozoa, abnormal sperm motility or morphology or Sertoli cell-only syndrome. In four of the five breakpoint regions, the reported sperm quantity varied from azoospermia (0x106/ml) to normospermia (>20x106/ml). In the breakpoint region 3p13-14, only azoospermia and oligozoospermia (<20x106/ml) were observed. Moreover, in the breakpoint region 1q22-23, five of the seven cases were presented with sperm quantities which did not exceed 1.8x106/ml.
|
Discussion
In this study, we tested digital differential display as an approach to identify novel testis-specific transcripts. The expression of 14 putative TETs identified by the TIGR database was confirmed in adult human testis, as determined by RT–PCR. However, only four of the TETs were found to be expressed exclusively in the adult testis, and solely one TET was testis-specific in the fetus. Six transcripts showed a differential expression pattern, and the remaining four transcripts were detected in all tissues studied here, and might thus represent novel genes with a house keeping function. In general, the expression pattern of the 14 TETs differs between adult and fetal tissues. This is to be expected, in particular concerning adult TETs, since many TETs are related to spermatogenesis.
Of the 14 testis-expressed genes examined in this study, interest is especially focused on those mapping to chromosomal regions where clustering of breakpoints in infertile men occur. In particular, two of the testis-expressed only transcripts, TET1 and TET-2 map to 9q21-22 and 3p13-14, where clusters of seven and six breakpoints respectively are positioned (Table II). In addition, two differentially-expressed transcripts, TET5 and TET-6 are assigned to 1q22-23 and 1p36, where seven and three breakpoints respectively are found. Moreover, TET11, that is detectable in all examined tissues, but predominantly in testis, maps to 1p32-33, where 13 breakpoints have been found. Interestingly, three of these five emphasized candidate genes are located on chromosome 1. Indeed, of the 265 translocation breakpoints reported in infertile men, 76 are located on chromosome 1, suggesting the occurrence of several genes with a function in male fertility on this chromosome (Mendelian Cytogenetics Network database) (E.Van Assche et al., unpublished data).
The potential involvement of chromosome 1-linked genes in male infertility is supported by the study of sterile mouse mutants. One mutant, (skeletal fusions with sterility) sks, was identified, and the responsible locus mapped to 16 cM on chromosome 4 (Handel et al., 1988). Both male and female mice carrying this recessive mutation are sterile and have fusions of vertebrae and ribs. The mutation causes meiotic arrest of the spermatocytes at the pachytene stage in the males, while females are functionally infertile, but have normal ovarian histology. The syntenic map position on the human genome is 1p32-34 (http://www.ncbi.nlm.nih.gov/Homology). Thus, TET11, which maps to the same region and shows a ubiquitous but testis-upregulated expression pattern, also represents a human candidate gene for the murine sks mutation.
TET7 is the human homologue of mouse Tpx-1, which is testis-specific in the mouse (Kasahara et al., 1987). However, according to our data TPX-1 appears as a predominantly testis-expressed gene with some expression in lung and kidney as well. A recent study on the rat showed that Tpx-1 is involved in the specific cell–cell interaction between Sertoli and spermatogenic cells (Maeda et al., 1999). Tpx-1 starts to accumulate in the 15 day-old rat in the pachytene spermatocyte and expression continues in the elongating spermatid. The association between somatic Sertoli cells and spermatogenic cells plays an important role in the maturation and differentiation of the spermatogenic cell. It can be speculated that the defects in genes involved in this specific cell–cell interaction (including TPX-1), might affect the production of functional spermatozoa and, consequently, fertility. Thus TPX-1, which maps to 6p21, where three cases of chromosomal breakpoints in infertile males have been reported, represents a candidate gene for these three cases of infertility.
Using digital differential display, we have identified a novel transcript, FATE, which was found to be testis-expressed only in fetal life, while in adult life it was expressed in numerous tissues including testis, lung, heart, kidney, adrenal gland and whole brain. The age of the fetal testis and ovary used in this study was 7 weeks. This is ~1 week after onset of sexual differentiation of the gonads (Jirasek, 1968). Convincing evidence for the essential role of SRY/Sry in gonadal sex differentiation in human and mouse has been presented (Page et al., 1990). Indeed, normal testis differentiation of chromosomally female mice transgenic for Sry have been described (Koopman et al., 1991). Therefore, the SRY/Sry transcript is considered to be one of the earliest markers of testicular differentiation. To gain more insight into those molecular events that take place in the fetal testis used in this study and thereby the developmental stage at which FATE accumulates, we determined the expression of SRY in the fetal gonads as well as in the adult testis. We found that SRY was expressed in both fetal and adult testis and not in the fetal ovary, as expected. In the mouse, the expression of Sry is confined to the fetal testis and the germ cells of adult testis, and the onset of Sry expression coincides with the initiation of sex differentiation of the gonad (Hacker et al., 1995). In contrast, human SRY has been demonstrated in a variety of fetal and adult tissues, including adult testis (Clepet et al., 1993), which is in agreement with our data. The temporal expression pattern of SRY in the human fetus and its exact role in gonadal sex differentiation is still unknown. It would be interesting to compare the expression of SRY and FATE in human fetal testis and other tissues from sexually undifferentiated stages and throughout fetal life. On the basis of these data, we propose that FATE plays a role in early testicular differentiation/function. Due to the shortage of human tissue, the isolation of a murine homologue of FATE would greatly facilitate further study of the early expression of FATE and the detection of the cell type(s) in which FATE accumulates, thereby elucidating the biological function of this transcript.
In conclusion, digital differential display combined with cytogenetic data is a feasible strategy to identify candidate genes for male infertility: a trait which, by its nature, will not be amenable to classical genetic mapping methods, e.g. linkage analysis.
Acknowledgments
This work was supported by The Danish Environmental Research Programme, the Danish Research Councils (9700832), Danish Biotechnological Research and Development Programme (9502022), the Danish Cancer Society, Novo Nordisk Foundation, Åge Bangs Foundation, The Danish Research Center for Growth and Regeneration, The German Genome Programme/Deutsche Forschungsanstalt fur Luftund Raumfahrt e.V. (4763) and the EU-Commission (BMH4-CT97-2268). Thanks are due to Pat A.Jacobs for providing case number 400055.
Notes
12 To whom correspondence should be addressed. E-mail: tommerup{at}imbg.ku.dk 
References
Adams, M.D., Kerlavage, A.R., Fleischmann, R.D. et al. (1995) Initial assessment of human gene diversity and expression patterns based upon 83 million nucleotides of cDNA sequences. Nature, 377 (Suppl.), 3–174.[Medline]
Bourrouillou, G., Dastugue, N. and Colombies, P. (1985) Chromosome studies in 952 infertile males with a sperm count below 10 million/ml. Hum. Genet., 71, 366–367.[Web of Science][Medline]
Chandley, A.C., Edmond, P.E., Christie, S. et al. (1975) Cytogenetics and infertility in man. Ann. Hum. Genet., 39, 231–254.[Web of Science][Medline]
Chandley, A.C., Seuanez, H. and Fletcher, J. (1976) Meiotic behavior of five human reciprocal translocations. Cytogenet. Cell Genet., 17, 98–111.[Web of Science][Medline]
Chandley, A.C. (1979) The chromosomal basis of human infertility. Br. Med. Bull., 35, 181–185.
Chandley, A.C., McBeath, S., Speed, R.M. et al. (1987) Pericentric inversion in human chromosome 1 and the risk for male sterility. J. Med. Genet., 24, 325–334.
Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162, 156–159.[Web of Science][Medline]
Clepet, C., Schafer, A. J., Sinclair, A. H. et al. (1993) The human SRY transcript. Hum. Mol. Genet., 2, 2007–2012.
Coco, R., Gallego, M.S., Brugo, S. et al. (1986) Cytogenetic findings in 301 sterile and/or infertile men with abnormal spermograms. Medicina (Buenos Aires), 46, 303–310.
Deloukas, P., Schuler, G.D., Gyapay, G. et al. (1998) A physical map of 30,000 human genes. Science, 282, 744–746.
Dutrillaux, B. (1985) Incidence des anomalies chromosomiques chez les hommes steriles. Contracept. Fertil. Sex., 13, 803–814.
Eberhart, C.G., Maines, J.Z. and Wasserman, S.A. (1996) Meiotic cell cycle requirement for a fly homologue of human Deleted in Azoospermia. Nature, 381, 783–785.[Medline]
Evtouchenko, L., Studer, L., Spenger, C. et al. (1996) A mathematical model for the estimation of human embryonic and fetal age. Cell Transp., 5, 453–464.
Goldman, A.S.H. and Hulten, M.A. (1993) Meiotic analysis by FISH of a human male 46,XY,t(15;20)(q11. 2;q11.2) translocation heterozygote: quadrivalent configuration, orientation and first meiotic segregation. Chromosoma, 102, 102–111.[Web of Science][Medline]
Guichaoua, M.R., Gabriel-Robez, O., Ratomponirina, C. et al. (1986) Meiotic behaviour of familial pericentric inversions of chromosomes 1 and 9. Ann. Genet., 29, 207–214.[Web of Science][Medline]
Hacker, A., Capel, B., Goodfellow, P. et al. (1995) Expression of Sry, the mouse sex determining gene. Development, 121, 1603–1614.[Abstract]
Handel, M.A., Lane, P.W., Schroeder, A.C. et al. (1988) New mutation causing sterility in the mouse. Gamete Res., 21, 409–423.[Web of Science][Medline]
Jirasek, J. E. (1968) Morphological and histochemical analysis of the development of adrenals and gonads in man. Progress in Endocrinology. Excerpta Medica, Amsterdam, The Netherlands, pp. 1100–1107.
Kasahara, M., Figueroa, F. and Klein J. (1987) Random cloning of genes from mouse chromosome 17. Proc. Natl Acad. Sci. USA, 84, 3325–3328.
Kasahara, M., Gutknecht, J., Brew, K. et al. (1989) Cloning and Mapping of a Testis-Specific Gene with Sequence Similarity to a Sperm-Coating Glycoprotein Gene. Genomics, 5, 527–534.[Web of Science][Medline]
Koopman, P., Gubbay, J., Vivian, N. et al. (1991) Male development of chromosomally female mice transgenic for Sry. Nature, 351, 117–121.[Medline]
Kremer, J.A.M., Tuerlings, J.H.A.M., Meuleman, E.J.H. et al. (1997) Microdeletions of the Y-chromosome and intracytoplasmic sperm injection: from gene to clinic. Hum. Reprod., 12, 687–691.
Ma, K., Inglis, J.D., Sharkey, A. et al. (1993) A Y chromosome gene family with RNA-binding protein homology: Candidates for the azoospermia factor AZF controlling human spermatogenesis. Cell, 75, 1287–1295.[Web of Science][Medline]
Maeda, T., Nishida, J. and Nakanishi, Y. (1999) Expression pattern, subcellular localization and structure-function relationship of rat Tpx-1, a spermatogenic cell adhesion molecule responsible for association with Sertoli cells. Dev. Growth Differ., 41, 715–722.[Web of Science][Medline]
Matsuda, T., Nonomura, M., Okada, K. et al. (1989) Cytogenetic survey of subfertile males in Japan. Urol. Int., 44, 194–197.[Web of Science][Medline]
Nielsen, K.L., Sottrup-Jensen, L., Nagase, H. et al. (1994) Amino acid sequence of hen ovomacroglobulin (ovostatin) deduced from cloned cDNA. DNA Seq., 5, 111–119.[Web of Science][Medline]
Nishi, S., Hoshi, N., Kasahara, M. et al. (1999) Existence of human DAZLA protein in the cytoplasm of human oocytes. Mol. Hum. Reprod., 5, 495–497.
Page D.C., Fisher E.M., McGillivray B. et al. (1990) Additional deletion in sex-determining region of human Y chromosome resolves paradox of X,t(Y;22) female. Nature, 346, 279–281.[Medline]
Reijo, R., Lee, T-Y, Salo, P. et al. (1995) Divers spermatogenic defects in humans caused by Y chromosome deletions encompassing a novel RNA-binding protein gene. Nature Genet., 10, 383–393.[Web of Science][Medline]
Retief, A.E., Van Zyl, J.A., Menkveld, R. et al. (1984) Chromosome studies in 496 infertile males with a sperm count below 10 million/ml. Hum. Genet., 66, 162–164.[Web of Science][Medline]
Roger de Gardelle, G., Jaffray, J.Y., Geneix, A. et al. (1983) Karyotype abnormalities in male subfertile sterility. Apropos of 318 cases. Pathologica, 75, 687–691.[Medline]
Schuler G.D. (1997) Pieces of the puzzle: expressed sequence tags and the catalog of human genes. J. Mol. Med., 75, 694–698.[Web of Science][Medline]
Sharpe, R.M. and Skakkebaek, N.E. (1993) Are oestrogens involved in falling sperm counts and disorders of the male reproductive tract? Lancet, 341, 1392–1395.[Web of Science][Medline]
Simoni, M., Kamischke A. and Nieschlag E. (1998) Current status of the molecular diagnosis of Y-chromosomal microdeletions in the work-up of male infertility. Initiative for international quality control. Hum. Reprod., 13, 1764–1768.
Tiepolo, L. and Zuffardi, O. (1976) Localization of factors controlling spermatogenesis in the nonfluorescent portion of the human Y chromosome long arm. Hum. Genet., 34, 119–124.[Web of Science][Medline]
Tommerup, N. (1993) Mendelian cytogenetics. Chromosome rearrangements associated with mendelian disorders. J. Med. Genet., 30, 713–727.
Van Assche, E., Bonduelle, M., Tournaye, H. et al. (1996) Cytogenetics of infertile men. Hum. Reprod., 11 (Suppl. 4), 1–24.
Van der Ven, K., Montag, M., Peschka, B. et al. (1997) Combined cytogenetic and Y chromosome microdeletion screening in males undergoing intracytoplasmic sperm injection. Mol. Hum. Reprod., 3, 699–704.
Vereb, M., Agulnik, A.I., Houston, J.T. et al. (1997) Absence of DAZ gene mutations in case of non-obstructed azoospermia. Mol. Hum. Reprod., 3, 55–59.
Vogt, P.H., Edelmann, A., Kirsch S. et al. (1996) Human Y chromosome azoospermia factors (AZF) mapped to different subregions in Yq11. Hum. Mol. Genet., 5, 933–943.
Xia Jia Hui (ed.) (1996) Repository of Human Chromosomal Anomalies In China. 3rd edn. Human Science and Technology Press, pp. 11–16.
Yen, P.H., Chai, N.N. and Salido, E.C. (1996) The human autosomal DAZLA: testis specificity and a candidate for male infertility. Hum. Mol. Genet., 5, 2013–2017.
Yoshida, A., Miura, K. and Shirai, M. (1997) Cytogenetic survey of 1,007 infertile males. Urol. Int., 58, 166–176.[Web of Science][Medline]
Submitted on July 3, 2000; accepted on September 27, 2000.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  G. M. Gibbs, K. Roelants, and M. K. O'Bryan The CAP Superfamily: Cysteine-Rich Secretory Proteins, Antigen 5, and Pathogenesis-Related 1 Proteins--Roles in Reproduction, Cancer, and Immune Defense Endocr. Rev., December 1, 2008; 29(7): 865 - 897. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Wiland, A. T. Midro, B. Panasiuk, and M. Kurpisz The Analysis of Meiotic Segregation Patterns and Aneuploidy in the Spermatozoa of Father and Son With Translocation t(4;5)(p15.1;p12) and the Prediction of the Individual Probability Rate for Unbalanced Progeny at Birth J Androl, March 1, 2007; 28(2): 262 - 272. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D Modi, C Shah, G Sachdeva, S Gadkar, D Bhartiya, and C Puri Ontogeny and cellular localization of SRY transcripts in the human testes and its detection in spermatozoa Reproduction, November 1, 2005; 130(5): 603 - 613. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Mendoza-Lujambio, P. Burfeind, C. Dixkens, A. Meinhardt, S. Hoyer-Fender, W. Engel, and J. Neesen The Hook1 gene is non-functional in the abnormal spermatozoon head shape (azh) mutant mouse Hum. Mol. Genet., July 1, 2002; 11(14): 1647 - 1658. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. P. Leo, S. Y. Hsu, and A. J. W. Hsueh Hormonal Genomics Endocr. Rev., June 1, 2002; 23(3): 369 - 381. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Iguchi, H. Tanaka, Y. Nakamura, M. Nozaki, T. Fujiwara, and Y. Nishimune Cloning and characterization of the human tektin-t gene Mol. Hum. Reprod., June 1, 2002; 8(6): 525 - 530. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Jiao, P. Trifillis, and M. Kiledjian Identification of Target Messenger RNA Substrates for the Murine Deleted in Azoospermia-Like RNA-Binding Protein Biol Reprod, February 1, 2002; 66(2): 475 - 485. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||