Molecular Human Reproduction, Vol. 7, No. 10, 903-911,
October 2001
© 2001 European Society of Human Reproduction and Embryology
Testis and spermatogenesis |
Sperm nuclear matrix association of the PRM1
PRM2
TNP2 domain is independent of Alu methylation
1 Section of Molecular and Cellular Biology, University of California, Davis, Davis, CA 95616, 2 Center for Molecular Medicine and Genetics, 3 Department of Pathology and the Karmanos Cancer Institute, Wayne State University School of Medicine 4 SeeDNA Biotech Inc., Windsor, Ontario, Canada, 5 Department of Obstetrics and Gynecology and the Institute for Scientific Computing, Wayne State University, Detroit, MI 48201, USA
Abstract
Genes or multigenic chromosomal regions are organized by the nuclear matrix into a series of functionally discrete genic domains. Biophysical analysis of the human chromosome 16p13.13 region has shown that the PRM1
PRM2
TNP2 protamine containing multigenic locus is bounded by two sperm nuclear matrix attachment regions (MAR). This domain exists in a transcriptionally readied or potentiated (i.e. open) chromatin state when associated with the nuclear matrix. The MAR-bounded PRM1
PRM2
TNP2 locus is nestled in an Alu repetitive element dense region. Fluorescence in-situ hybridization, analysis of sperm nuclear matrix/halo preparations showed that the PRM1
PRM2
TNP2 domain specifically localizes to the sperm nuclear matrix. This raised the question of whether nuclear matrix association and gene expression in this locus is mediated by Alu methylation. The methylation status of the various Alu elements contained within the human PRM1
PRM2
TNP2 locus was therefore assayed. The seven Alu elements tested, including those associated with the matrix attachment regions within the PRM1
PRM2
TNP2 locus, were fully methylated in sperm DNA. Conversely, these same Alu repeats were hypomethylated within the erythroleukaemic cell line, K562, which does not express any of the genes from this domain. This study shows that Alu methylation status is independent of attachment of PRM1
PRM2
TNP2 locus to the nuclear matrix and that Alu methylation does not play a leading role in the regulation of this domain.
Alu repeat/methylation/protamine/nuclear matrix/spermatozoa
Introduction
The human sperm genome is at least six times more condensed than in the somatic cell (Balhorn, 1982
). This highly condensed chromatin state is achieved by replacing ~85% of the histones with the smaller, more basic protamine contributing proteins during the terminal phase of spermiogenesis (Prigent et al., 1996
). The PRM1
PRM2
TNP2 protamine containing multigenic locus encodes the suite of proteins that package sperm DNA into this highly condensed state. This locus exists as a single, coordinately expressed chromatin domain (Choudhary et al., 1995
; Stewart et al., 1999
) bounded by two male-haploid specific nuclear matrix attachment sites (Kramer and Krawetz, 1996
). These attachment sites are thought to be central to the potentiative process that opens this segment of the genome to permit transcription (Kramer et al., 1997
).
The proteinaceous network of the nuclear matrix binds chromatin at sequence-specific regions of attachment, termed matrix attachment regions (MAR) (Ward and Coffey, 1991
; Bode et al., 2000
). The segments that remain associated with the nuclear matrix are usually biologically active, while the inactive regions segregate as independent looped domains. Thus, the nuclear matrix provides a means for organizing chromatin into discrete domains. To date, a universal MAR consensus sequence has not been identified, although a series of MAR-related motifs have been identified (Singh et al., 1997
). The regions of attachment to the nuclear matrix are often found in close association to various repetitive elements. Alu elements are reiterated at a similar frequency as MAR, and this has led to the suggestion that regulation of attachment may be mediated by the interaction of repetitive elements with the nuclear matrix (Boulikas, 1993).
The multigenic PRM1
PRM2
TNP2 locus is embedded within a repetitive element-rich segment of the human genome (Kramer et al., 1998a
). The majority of the repetitive elements are members of the Alu family. These have even been localized within the MAR-containing regions of this locus, raising the issue of their functional significance.
Alu repeats constitute approximately one-third of the possible methylation sites within the human genome (Schmid, 1991
). They are members of the Short Interspersed Element (SINE) family and contain an internal promoter which directs their transcription by RNA polymerase III (Pol III) that is repressed by methylation (Li et al., 2000
; and references therein). In Alu repeats, these sites are almost fully methylated in DNA from somatic tissues. However, a subset of Alu elements is completely unmethylated in DNA from male germ line tissues such as mature spermatozoa, total testis and seminoma (Hellmann-Blumberg et al., 1993
; Kohanek et al, 1993
; Rubin et al., 1994
). Similarly, Alu repeats are hypomethylated in K562 cells to approximately the same degree as in male germ cells. Pol III-directed Alu transcripts are present at peculiarly high levels in these cells (Li et al., 2000
). The exact composition of this subset has not been fully defined. Alu elements that are evolutionarily young tend to be more hypomethylated than older, more divergent Alu elements. Moreover, certain Alu members are completely methylated whereas others are completely unmethylated in sperm DNA (Kohanek et al., 1993
).
The functional significance, if any, of gross hypomethylation is unknown. Attractive possibilities for roles in spermatogenesis include regulating genes that are expressed only in the germ line and packaging sperm nucleoprotamine, or in the early embryo, signalling imprinted gene expression. Considering the first of these possibilities, DNA methylation generally silences gene expression through cis effects of chromatin structure (Bestor, 1998
; Jones et al., 1998
; Nan et al., 1998
). Alu methylation may equivalently silence expression of any neighbouring genes. In the male germ line, Alu hypomethylation may be associated with the derepression of genes that are expressed only during spermatogenesis. However, as shown in K562 cells, chromatin structure, not Alu hypomethylation, is now believed to be the primary regulator of Alu transcription (Li et al., 2000
).
The human PRM1
PRM2
TNP2 locus is unusually rich in Alu repeats and the expression of these genes is restricted to a specific stage in the male germ line. Various structural studies have shown that the domain remains in a potentiated (i.e. open) chromatin state (Kramer et al., 1998b
, 2000
) from the pachytene spermatocyte stage to the fully differentiated mature spermatozoon. In addition, the domain is attached to the sperm nuclear matrix by MAR (Kramer and Krawetz, 1996
). This begs the question: does repetitive element methylation mediate binding to the nuclear matrix and thus allow the potentiated chromatin state? We have directly addressed this issue using fluorescence in-situ hybridization (FISH) to define the region of human chromosome 16p13.13 that is bound to the nuclear matrix. In addition, we have examined the methylation of several of the Alu elements throughout this region including those that encompass the nuclear matrix attachment sites in DNA from different tissues. The results presented in this study clearly show that Alu germ line hypomethylation is not required for mediating the interaction of this chromosomal segment with the sperm nuclear matrix and for gene-specific expression during spermatogenesis.
Materials and methods
Fibre FISH
DNA fibres were prepared using lymphocytes isolated from human blood and treated as previously described (Heng et al., 1992
). Cosmid probes 440-e5 and 345-f2 (Kramer et al., 1998a
) were biotinylated with dATP using the BRL BioNick labelling kit. hP3.1 (U15422 coordinates 140 573 bp) (Nelson and Krawetz, 1994
) was labelled by digoxigenin (DIG) and FISH analysis was performed essentially as previously described (Heng and Tsui, 1994
).
FISH of sperm nuclear halos
Sperm nuclei were prepared fresh from spermatozoa obtained from normal healthy donors and FISH was carried out essentially as described (Yaron et al., 1998
). Sperm heads were separated from their tails by dounce homogenization, and their nuclei were isolated by centrifugation through a sucrose gradient. Sperm nuclear halos were then prepared and FISH was performed using the fluorescently labelled cosmids 440-e5, hP 3.1 and 345-f2 as probes. The location of the various segments with respect to the nuclear matrix was derived from ~100 different observations. Over-extended fibres were excluded from this analysis.
Methylation of the Alu and B1 repeat families
To examine the general methylation status of human Alu and mouse B1 repeats, two different strategies were employed. Consensus Alu restriction fragments were isolated by digesting human DNA with a combination of HaeIII and HinfI, then size selecting the product by agarose gel electrophoresis (Schmid, 1991
). Following their isolation by phenol extraction and ethanol precipitation, these size-selected products were divided into identical 5 µg aliquots and digested with one of several restriction enzymes as recommended by the manufacturer, to 10-fold over digestion. Mouse DNA was initially digested with BsmAI, then isolated by phenol extraction and ethanol precipitation, and then divided into two equal 10 µg aliquots for digestion with either HpaII or MspI.
Genomic digests from the above were resolved by 1.2% agarose gel electrophoresis, then blotted onto Hybond N+ (Amersham Pharmacia Biotech). HinfI, RsaI and BstUI digests of pUC DNA served as markers. Human Alu repeats were identified using hybridization probe #51 (Rubin et al., 1994
) and the corresponding mouse B1 repeats were identified using the [
-32P]-terminally labelled oligonucleotide probe AGTGAGTTCCAGGACAGCCAG (Quentin, 1989
). In brief, the blots were prehybridized and then hybridized at 52°C to the probe in hybridization solution (5xSSPE: 5xDenhardt's, with 0.5 µg/ml salmon sperm DNA). Following hybridization, the blots were washed several times at room temperature in 5xSSPE containing 0.5% sodium dodecyl sulphate (SDS). A final 52°C 5 min wash in fresh solution was then employed to remove non-specifically bound probe (Rubin et al., 1994
).
Assaying methylation within the protamine cluster
DNA from normal humans (100 µg) or fertile 80 day adult transgenic mice (50 µg) that faithfully recapitulate the expression of all members of the human PRM1
PRM2
TNP2 locus (Choudhary et al., 1995
; Stewart et al., 1999
) were first digested with one of several enzymes or a combination of two enzymes. DNA subjected to double digestion was first digested with one of the two restriction enzymes, then purified by phenol extraction and ethanol precipitation prior to digestion with the second restriction enzyme. A minimum 2-fold excess of restriction enzyme was always employed and digestion was continued for at least 4 h using the manufacturer's buffers and incubation temperatures. Following digestion, the DNA samples were again isolated then divided into equal aliquots prior to assessing DNA methylation by restriction analysis. In most cases, either lambda DNA or plasmid DNA was mixed with the predigested sample to provide an internal control for methylation assessment by restriction digestion. At least one additional DNA sample that did not contain exogenous lambda or plasmid DNA was also examined to assure the correct assignment of all hybridizing bands.
The digests were separated by electrophoresis on 1% agarose gels using Pst1 digests of lambda DNA as markers. The digests were then blotted onto Hybond N+. The hybridization probes were released as restriction fragments by digestion of subclones from U15422 (Nelson and Krawetz, 1994
). Subclone 7h5 (coordinates 34 82235 430 bp) and 3g5 (coordinates 32 80233 372 bp) were released with HindIIIEcoRI, clone 5g4 (coordinates 34 00834 325 bp) was released with either PvuII or SstI, and clone 4c11 (coordinates 91099548 bp) was released with PvuII. These fragments were labelled with [
-32P]dATP by nick translation. The blots were hybridized to the probe at 60°C in hybridization solution (5xSSC, 5xDenhardt's and 0.5 µg/ml of salmon sperm DNA). When the hybridization probe contained an Alu sequence fragment, the hybridization cocktail was supplemented with 25 ng/ml of sheared human DNA. Following overnight hybridization, the filter was washed several times at 60°C for prolonged periods in 0.5xSSC with 0.5% SDS. When the level of background hybridization was significant, the washing stringency was increased by raising the temperature to 65°C or by including a final wash in 0.25xSSC.
Results
Association of the PRM1
PRM2
TNP2 domain with the sperm nuclear matrix
DNA fibres from fixed human lymphocytes were stretched onto a glass slide. FISH analysis of these fibres was performed using the fluorescently labelled cosmids 440-e5, hP3.1 and 345-f2 as probes that encompass the PRM1
PRM2
TNP2 domain. As shown in Figure 1
, detection of the hybridization signals showed that the relative order of the cosmids from the 5' to 3' direction was 440-e5, hP3.1 and 345-f2. Further, cosmid 345-f2 was separated from hP3.1 by
10 kb. Together this series of probes spanned a contiguous segment of ~120 kb of human chromosome 16p13.13. One would expect that this segment should contain several sperm chromatin loops, since the average sperm loop has been estimated to be ~27 kb in size (Barone et al., 1994
). Accordingly, these cosmids were well suited as FISH probes to determine their relative level of association with the nuclear matrix.
|
DNA halos were prepared by extracting sperm nuclei with a high ionic strength reducing buffer (Barone et al., 1994
PRM2
TNP2 domain localized to the nuclear matrix core region. Analysis of the PRM1
PRM2
TNP2 domain using this probe produced a signal within the nuclear matrix in ~70% of the samples examined. This reflects the tight binding of the hP3.1 region to the nuclear matrix as mediated by the two boundary MAR of the protamine locus (coordinates 88189760 and 32 58633 536 bp) (Kramer and Krawetz, 1996
|
Of note, >50% of the region encompassing the PRM1
PRM2
TNP2 domain that is associated with the nuclear matrix is comprised of repetitive sequence element DNA. At least 64% of the repetitive DNA contained within this region are the various members of the Alu family (Kramer et al., 1998). This raised the possibility that attachment of the PRM1
PRM2
TNP2 domain to the sperm nuclear matrix may be mediated by the repetitive elements and perhaps by their methylation status.
Global levels of SINE methylation in human and mouse tissues
The methylation status of individual human Alu elements in DNA from spermatozoa, human K562 cells and transgenic mouse testis bearing the human PRM1
PRM2
TNP2 locus (Choudhary et al., 1995
; Stewart et al., 1999
) was surveyed. The results are summarized in Figure 3
, and Table I
. The K562 somatic cell line that predominately contains hypomethylated Alu elements provided an ideal control.
|
|
Human Alu repeats isolated as a consensus HaeIIIHinfI fragment (Schmid, 1991
The shorter mouse B1 repeat presents only a single consensus HpaIIMspI site conducive to methylation assessment (Quentin, 1989
). To examine the methylation of this site, transgenic mouse DNA was first digested at a B1-consensus BsmAI site and then digested with either HpaII or MspI (Figure 3B
). No appreciable digestion of the B1 repeats by HpaII was detected in either liver or testis DNA. This is indicative of virtually complete methylation of this site in both tissues.
Alu methylation of the PRM1
PRM2
TNP2 locus MAR boundary regions
The methylation status of two clusters of Alu repeats mapping 5' and 3' to the PRM1
PRM2
TNP2 gene cluster encompassing the MAR boundary regions was examined (Figure 4
). The repetitive element clusters were released by digesting DNA with one or more restriction enzymes prior to assessing the methylation status of the parent fragment. This was accomplished by digesting the parent fragment with a series of restriction enzymes that included HpaII, which does not cleave a methylated site (Figure 4
). The sizes of parent fragments generated by digestion with either NsiIHpaI (or in some cases, StyIHpaI), PstI, PvuIISacI, or BstYI are shown in Table II
. The positions of the hybridization probes used to detect these fragments by Southern analysis are shown in Figure 4
. All of the fragments detected by Southern analysis for the normal human and transgenic tissues bearing the human PRM1
PRM2
TNP2 locus correspond to the known sequence of this gene cluster.
|
|
The PvuIISacI parent fragment mapping immediately 3' to the protamine gene cluster and encompassing the 3' MAR includes the testable BstUI, HpaII and HhaI restriction sites within and around the Alu repeats (Figure 4
|
Alu repeats mapping to the adjacent downstream BstYI fragment (Table I
|
The region encompassing the 5' MAR revealed a marked difference in Alu member methylation (Figure 4
|
Discussion
Matrix attachment regions can function as boundaries for genic domains (Bode et al., 2000
) and can play key roles in the potentiation, i.e. the opening of discrete regions of chromatin in the human genome to permit transcription (Krawetz et al., 1999
). The PRM1
PRM2
TNP2 multigenic locus that our laboratory has been using as a model system to unravel this mechanism (Kramer et al., 2000
) is bounded at its ends by two regions that specifically attach to the sperm nuclear matrix (Kramer and Krawetz, 1996
). It has been demonstrated that mutations within the 3' MAR can cause loss of expression and disregulation of various members of this multigenic domain (Kramer et al., 1997
). As shown by FISH analysis, the PRM1
PRM2
TNP2 domain is firmly attached to the sperm nuclear matrix along its entire 40 kb length. In contrast, the regions abutting the PRM1
PRM2
TNP2 domain were splayed towards the loop. Interestingly, the segments contained in the abutting loop remained in a somewhat compact form, as they do not extend the entire length of the halo formed by the loop DNA. This suggests that there are certain defined exceptions to the average loop size in human spermatozoa being ~27 kb.
It has been proposed that attachment to the nuclear matrix may be mediated through a series of repetitive elements (Boulikas, 1993). More than 54% of the region of human chromosome 16 encompassing the PRM1
PRM2
TNP2 multigenic locus described in this communication is comprised of repetitive elements, over half of which are SINE (Kramer et al., 1998a
). Both MAR attachment sites contain a series of repetitive elements that may play a strategic role in regulating this locus or may simply reflect the repetitive nature of this region. The results of this study discussed below are in accord with the latter.
Alu repeats, the dominant human SINE, are grossly hypomethylated in mature sperm DNA as well as in DNA from other male germ line tissues (testis and seminoma). This unusual hypomethylation pattern, as displayed by Alu repeats, may be tightly linked to genes that are specifically expressed during male germ line development. Alternatively, there is in-vitro evidence for an Alu binding protein in spermatozoa that can specifically protect Alu repeats from methylation (Chesnokov and Schmid, 1995
). The PRM1
PRM2
TNP2 cluster provides an extreme example of genes that are only expressed in the developing male germ line. However, not one of the seven human PRM1
PRM2
TNP2 cluster Alu elements examined exhibited hypomethylation in sperm DNA. This observation argues against a requirement for Alu hypomethylation associated with the potentiation of this domain.
Trasler et al. examined the methylation status of several sites within the mouse protamine gene cluster of mouse chromosome 16 and the transition protein 1 (TP1) gene of mouse chromosome 1 by a similar strategy (Trasler et al., 1990
). While methylation of the TP1 gene CpG repeats in the 5' promoter and coding regions decreased during mouse spermatocyte development, similar sites in the protamine genes became more methylated in testis, when all three genes are expressed. Thus, for some genes, the relationship between hypomethylation and gene expression is not reflected in all repeats or is mediated by other factors such as specific sequence binding proteins or chromatin structure. Results from this investigation of the methylation of seven human PRM1
PRM2
TNP2 gene cluster Alu elements throughout and encompassing the MAR leads to a similar conclusion. There is no simple or strict requirement of one for the other.
Examination of the transgenic model that faithfully recapitulates the expression of all members of the human PRM1
PRM2
TNP2 locus (Stewart et al., 1999
) revealed site specificity in the methylation of the transgene Alu repeats. Demethylated and methylated sites are not intermingled, rather Alu elements at the 5' MAR are methylated and those at the 3' MAR are hypomethylated. Since the transgenes are inserted as multiple tandem copies, the partial methylation of certain Alu elements implies that they are fully methylated in some copies of the transgene yet unmethylated in others. This may reflect their position relative to the nuclear matrix as only a few copies of the tandemly integrated locus are attached. Dyck et al. reported a similar transgene-specific pattern of methylationhypomethylation in testis but not in other tissuesfor human IGF-I genes expressed in mouse (Dyck et al., 1999
). Like the members of the PRM1
PRM2
TNP2 domain, IGF-I is naturally expressed in the testis. The transgenic human IGF-I is partially demethylated at two HpaIIMspI sites within the construct's intron. These experiments suggest that the IGF-I transgene may be hypermethylated in non-testis tissue by activation of an antiviral defence mechanism in response to the cytomegalovirus (CMV) promoter used in this construct. However, this rationale does not explain why testis should be exempt from protection. Further, it does not explain the methylation pattern we observe for the transgenic PRM1
PRM2
TNP2 locus since viral sequences were not utilized in their creation. Rather a mechanism peculiar to testis that exempts exogenous sequences from global hypermethylation may be present.
Acknowledgements
This work was supported in part by USPHS grant GM21346 (C.W.S.) and the Agricultural Experiment Station at the University of California and in part by NIH grant (HD36512) to S.A.K. The authors would like to thank Dr J.A.Kramer and Mr S.Merchant for their initial contributions to this study.
Notes
6 To whom correspondence should be addressed at: Department of Obstetrics & Gynecology, Center for Molecular Medicine & Genetics, Institute for Scientific Computing, Wayne State University School of Medicine, 253 C.S.Mott Center, 275 E. Hancock, Detroit, MI 48201, USA. E-mail: steve{at}compbio.med.wayne.edu ![]()
References
Balhorn, R. (1982) A model for the structure of chromatin in mammalian sperm. J. Cell Biol., 93, 298305.
Barone, J.G., De Lara, J., Cummings, K.B. and Ward, W.S. (1994) DNA organization in human spermatozoa. J. Andrology, 15, 139145.
Bestor, T.H. (1998) Methylation meets acetylation. Nature, 393, 311312.[Medline]
Bode, J., Benham, C., Knopp, A. and Mielke, C. (2000) Transcriptional augmentation: modulation of gene expression by scaffold/matrix-attached regions (S/MAR elements). Crit. Rev. Eukaryot. Gene. Expr., 10, 7390.[Web of Science][Medline]
Boullikas, T. (1993) Nature of DNA sequences at the attachment regions of the nuclear matrix. J. Cell. Biochem., 52, 1422.[Web of Science][Medline]
Chesnokov, I. and Schmid, C.W. (1995) Specific Alu binding protein from human sperm chromatin prevents DNA methylation. J. Biol. Chem., 270, 1853918542.
Choudhary, S.K., Wykes, S.M., Kramer, J.A. et al. (1995) A haploid expressed gene cluster exists as a single chromatin domain in human sperm. J. Biol. Chem., 270, 87558762.
Dyck, M.K., Ouellet, M., Gagn, M. et al. (1999) Testes-specific transgene expression in insulin-like growth factor-I transgenic mice. Mol. Reprod. Dev., 54, 3242.[Web of Science][Medline]
Hellmann-Blumberg, U., Hintz, M.F., Gatewood, J. and Schmid, C.W. (1993) Developmental differences in the methylation of human Alu repeats. Mol. Cell. Biol., 13, 45234530.
Heng, H.H.Q. and Tsui, L.-C. (1994) Free chromatin mapping by FISH. In Choo, K.H.A. (ed.), Methods in Molecular Biology, Vol. 33, In Situ Hybridization Protocols. Humana Press, Totowa, NJ, pp. 109122.
Heng, H.H.Q., Squire, J. and Tsui, L-C. (1992) High resolution mapping of mammalian genes by in situ hybridization to free chromatin. Proc. Natl. Acad. Sci. USA, 93, 95099513.
Jones, P.L., Veenstra, G.J.C., Wade, P.A. et al. (1998) Methylated DNA and MeCP2 recruit histone deacetylases to repress transcription Nature Genet., 19, 187191.[Web of Science][Medline]
Kohanek, S., Renz, D. and Doerfler, W. (1993) DNA Methylation in the Alu sequences of diploid and haploid primary human cells. EMBO J., 12, 11411151.[Web of Science][Medline]
Kramer, J.A. and Krawetz, S.A. (1996) Nuclear matrix interactions within the sperm genome. J. Biol. Chem., 271, 1161911622.
Kramer, J.A., Zhang, S., Yaron, Y. et al. (1997) Genetic testing for male infertility: a postulated role for mutations in sperm nuclear matrix attachment regions. Genet. Testing, 1, 125129.[Medline]
Kramer, J.A., Adams, M.D., Singh, G.B. et al. (1998a) Extended analysis of the region encompassing the PRMI
PAM2
TNP2 domain: genomic organization, evolution and gene identification. J. Expt. Zoology, 282, 245253.
Kramer, J.A., McCarrey, J.R., Djakiew, D. and Krawetz, S.A. (1998b) Differentiation: the selective potentiation of chromatin domains. Development, 125, 47494755.[Abstract]
Kramer, J.A., McCarrey, J.R., Djakiew, D. and Krawetz, S.A. (2000) Human spermatogenesis as a model to examine gene potentiation. Mol. Reprod. Dev., 56, 254258.[Web of Science][Medline]
Krawetz, S.A., Kramer, J.A. and McCarrey, J.R. (1999) Reprogramming the male gamete genome: a window to successful gene therapy. Gene, 234, 19.[Web of Science][Medline]
Li, T.-H., Kim, C., Rubin, C.M. and Schmid, C.W. (2000) K562 cells implicate increased chromatin accessibility in Alu transcriptional activation. Nucl. Acids Res., 28, 30313039.
Nan, X., Ng, H.-H., Johnson, C.A. et al. (1998) Transcriptional repression by the methyl CpG binding protein MeCP2 involves a histone deacetylase complex. Nature, 393, 386389.[Medline]
Nelson, J.E. and Krawetz, S.A. (1994) Characterization of a human locus in transition. J. Biol. Chem., 269, 3106731073.
Prigent, Y., Muller, S. and Dadoune, J.P. (1996) Immunoelectron microscopical distribution of histone H2B and H3 and protamines during human spermiogenesis. Mol. Hum. Reprod., 2, 929935.
Quentin, Y. (1989) Successive waves of fixation of B1 variants in rodent lineage history. J. Mol. Evol. 28, 299305.[Web of Science][Medline]
Rubin, C.M., Vandevoort, C.A., Teplitz, R.L. and Schmid, C.W. (1994) Alu repeated DNAs are differentially methylated in primate germ cells. Nucl. Acids Res., 22, 51215127.
Schmid, C.W. (1991) Human Alu subfamilies and their methylation revealed by blot hybridization. Nucl. Acids Res., 19, 56135617.
Singh, G.B., Kramer, J.A. and Krawetz, S.A. (1997) Mathematical model to predict regions of chromatin attachment to the nuclear matrix. Nucl. Acid Res., 25, 14191425.
Stewart, K., Kramer, J.A., Evans, M.I. and Krawetz, S.A. (1999) Temporal expression of the transgenic human protamine gene cluster. Fertil. Steril., 71, 739745.[Web of Science][Medline]
Trasler, J.M., Hake, L.E., Johnson, P.A. et al. (1990) DNA methylation and demethylation events during meiotic prophase in the mouse testis. Mol. Cell. Biol., 10, 18281834.
Ward, W.S. and Coffey, D.S. (1991) DNA packaging and organization in mammalian spermatozoa: comparison with somatic cells. Biol. Reprod., 44, 569574.[Abstract]
Yaron, Y., Kramer, J.A., Gyi, K. et al. (1998) Centromere sequences localize to the human sperm nuclear halo. Int. J. Androl., 21, 1318.[Web of Science][Medline]
Submitted on April 4, 2001; accepted on August 8, 2001.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
T. Guastafierro, B. Cecchinelli, M. Zampieri, A. Reale, G. Riggio, O. Sthandier, G. Zupi, L. Calabrese, and P. Caiafa CCCTC-binding Factor Activates PARP-1 Affecting DNA Methylation Machinery J. Biol. Chem., August 8, 2008; 283(32): 21873 - 21880. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H. Q. Heng, S. Goetze, C. J. Ye, G. Liu, J. B. Stevens, S. W. Bremer, S. M. Wykes, J. Bode, and S. A. Krawetz Chromatin loops are selectively anchored using scaffold/matrix-attachment regions J. Cell Sci., March 1, 2004; 117(7): 999 - 1008. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C. Ostermeier, Z. Liu, R. P. Martins, R. R. Bharadwaj, J. Ellis, S. Draghici, and S. A. Krawetz Nuclear matrix association of the human {beta}-globin locus utilizing a novel approach to quantitative real-time PCR Nucleic Acids Res., June 15, 2003; 31(12): 3257 - 3266. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Repping, J. W.A. de Vries, S. K.M. van Daalen, C. M. Korver, N. J. Leschot, and F. van der Veen The use of spermHALO-FISH to determine DAZ gene copy number Mol. Hum. Reprod., April 1, 2003; 9(4): 183 - 188. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||












