Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (36)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Nakago, S.
Right arrow Articles by Kennedy, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nakago, S.
Right arrow Articles by Kennedy, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Human Reproduction, Vol. 7, No. 11, 1079-1083, November 2001
© 2001 European Society of Human Reproduction and Embryology


Uterine physiology

Association between endometriosis and N-acetyl transferase 2 polymorphisms in a UK population

Satoshi Nakago1,2, Ruth M. Hadfield1, Krina T. Zondervan1,3, Helen Mardon1, Sanjiv Manek4, Daniel E. Weeks5, David Barlow1 and Stephen Kennedy1,6

1 Nuffield Department of Obstetrics and Gynaecology, University of Oxford, John Radcliffe Hospital, Oxford, UK 2 Academic Department of Obstetrics and Gynaecology, University of Kobe, Japan 3 Department of Public Health and Primary Care, University of Oxford 4 Department of Cellular Pathology, John Radcliffe Hospital, Oxford, UK 5 Department of Human Genetics, University of Pittsburgh, Pittsburgh, USA

Abstract

The relationship between endometriosis and polymorphisms in the N-acetyl transferase 2 (NAT 2) gene was investigated in a UK population, as this gene has been previously implicated in the aetiology of the disease. Point mutations in the gene result in the variant alleles NAT 2 *5, *6 and *7 from the wild-type NAT 2 *4 allele. Homozygotes for the NAT 2 *4 wild type allele are fast NAT acetylators, while heterozygotes with one wild-type allele and a variant NAT 2 *5, *6 or *7 allele have reduced enzyme activity, and individuals with two variant alleles are slow acetylators. The NAT 2 *4/*6 genotype was significantly more common among affected women (35.2%) than population controls (8.1%; P = 0.0001) or unaffected women (4.2%; P = 0.02). Significantly more affected women (57.4%) were fast acetylators than were population controls (32.3%; P < 0.01) or unaffected women (33.3%; P < 0.05). These data suggest that altered NAT 2 enzyme activity may be a predisposition factor in endometriosis, or that NAT 2 alleles may be in linkage disequilibrium with a susceptibility allele in the same chromosomal region.

endometriosis/genetics/NAT 2

Introduction

There is increasing evidence that endometriosis is inherited as a complex genetic trait, implying that multiple gene loci interact with each other and with the environment to produce the disease phenotype (Kennedy, 1997Go). A number of candidate genes have been studied to date (Zondervan et al., 2001Go). For example, associations have been reported between endometriosis and polymorphisms in the oestrogen receptor (Georgiou et al., 1999Go) and galactose 1-phosphate uridyl transferase (GALT) genes (Cramer et al., 1996Go), although the GALT findings have not been replicated in two other studies (Morland et al., 1998Go; Hadfield et al., 1999Go).

Genes coding for enzymes involved in the detoxification of toxins have also been studied, based upon data suggesting that chronic exposure to dioxin is a risk factor for developing disease (Rier et al., 1993Go). A null mutation in glutathione S-transferase M1 (GSTM1) has been reported to occur more frequently in French (Baranova et al., 1997Go) and Slavic (Baranov et al., 1996Go) women with endometriosis than in controls, although these findings have not been replicated in two other studies (Baxter et al., 2001Go; Hadfield et al., 2001Go).

An association between endometriosis and polymorphisms in the N-acetyltransferase 2 (NAT 2) gene has been reported in American (Bischoff et al., 1998Go) and French women (Baranova et al., 1999Go). NAT 2 is involved in the initial biotransformation metabolism of aromatic amines and hydrazines and catalyses the transfer of an acetyl group from acetyl CoA to the nitrogen of the substrate. Polymorphisms at the NAT 2 gene locus, 8p22, result in impaired enzyme activity. Homozygotes for the NAT 2 *4 wild type allele are fast acetylators; heterozygotes with a mutant NAT 2 *5, *6 or *7 allele have reduced activity, and mutant type homozygotes are slow acetylators. Slow acetylation has been reported as a risk factor for bladder cancer (Risch et al., 1980Go; Cartwright et al., 1982Go), while fast acetylation has been implicated as a risk factor for colon cancer (Ilett et al., 1987Go). We have therefore investigated the relationship between endometriosis and NAT 2 polymorphisms in a UK population.

Materials and methods

Study participants
Blood or tissue was obtained from the following three groups and DNA was extracted for genotyping: (i) male blood donors (n = 99), (ii) pre-menopausal women aged 40–50 years with a normal pelvis at hysterectomy (n = 24) and (iii) women with surgically confirmed stage III–IV endometriosis (The American Fertility Society, 1985Go) and a family history of the disease (n = 54), but unrelated to each other. Fifty-two of the affected familial cases were Caucasian; the ethnicity of the remaining two was unknown. The ethnicity of the controls was also unknown because of the need to maintain anonymity. However, non-Caucasian, male blood donors in the Oxford region are very rare and the overwhelming majority of women undergoing surgery at the John Radcliffe are Caucasian. Ethical approval was obtained from the Oxford Research Ethics Committee for the use of samples from known individuals.

Population controls
Samples from males who had donated blood in the Oxford region were supplied anonymously by the National Blood Service.

Normal controls
Pre-menopausal women aged 40–50 years with a normal pelvis at hysterectomy, performed for benign menstrual disorders, were identified through the records of the John Radcliffe Hospital, Oxford. Women from this age group were chosen to maximize the probability that they were unaffected by endometriosis, instead of using younger, unaffected women who might develop the disease in later life. Women with adenomyosis were excluded from the study. Normal tissue, fixed in formalin and paraffin-embedded, from these patients was provided anonymously from the archives of the Cellular Pathology Department at the John Radcliffe Hospital.

Familial cases
Families with surgically confirmed endometriosis were recruited for the Oxford Endometriosis Gene (OXEGENE) study, which aims to identify susceptibility genes for the disease using a genome-wide search (Kennedy et al., 2001Go). Blood samples were obtained from members of the affected pedigrees recruited. DNA from only one individual with stage III–IV disease from each family was used in the association studies. Informed consent was obtained from these women.

Genotyping
DNA was extracted from 9 ml EDTA anti-coagulated blood samples using either the standard proteinase K phenol-chloroform method (familial cases), the QIAmp (Qiagen, Crawley, Sussex, UK) DNA extraction kit (population controls) or the QIAmp tissue kit (Qiagen) (normal controls).

A 547 bp fragment of the NAT 2 gene locus containing the polymorphic region of interest was amplified using polymerase chain reaction (PCR), as described previously (Smith et al., 1997Go). Primers were synthesized by Gibco Life Technologies (Rockville, USA) (P1 5'- GCTGGGTCTGGAAGCTCCTC; P2 5'- TTGGGTGATACATACACAAGGG). The 20 µl PCR reaction contained 0.1 µg DNA, 25 ng each primer, 1x PCR buffer, 2.5 mmol/l MgCl2, 0.2 mmol/l each dNTP and 0.5 units Taq DNA polymerase (all from Qiagen). Reactions were overlayed with mineral oil and amplified using the following thermal profile: initial denaturation at 95°C for 5 min, followed by 30 cycles of denaturation at 94°C for 1 min, annealing at 60°C for 1 min and elongation at 72°C for 1 min, and a final elongation of 72°C for 5 min. Following PCR amplification, separate digestions of each PCR product with the restriction enzymes Kpn I, Dde I, Taq I and Bam HI (Roche Diagnostics, Lewes, Sussex, UK) were carried out to detect the substitutions C481T, A803G, G590A and G587A respectively (Figure 1Go). Results were visualized under ultraviolet light following gel electrophoresis on a 2% agarose gel stained with ethidium bromide.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 1. Genotype determination by restriction enzyme digests of the NAT 2 gene fragment. Following PCR amplification, separate digestions of each PCR product were carried out with the restriction enzymes Kpn I, Dde I, Taq I and Bam HI to detect the substitutions C481T, A803G, G590A, and G587A respectively. The sizes of the digested products for each restriction enzyme which allow the individual's genotype to be determined are shown diagrammatically.

 
Statistical analysis
Statistical analysis was performed using Fisher's exact test to identify differences between genotype and phenotype distributions in the three groups. Hardy–Weinberg equilibrium was checked in the cases and the two control groups. This is a mathematical description of the expected distribution of genotypes at a locus in a population in the absence of factors such as non-random mating, and selection for or against any of the genotypes. If a gene has two alleles (allele b and dominant allele B) the distribution of genotypes as defined by the Hardy–Weinberg equilibrium is p2 + 2pq +q2 = 1, where p = frequency of allele B, q = frequency of allele b and 2pq = frequency of Bb heterozygotes.

Results

All 54 affected women had surgically confirmed Stage III–IV endometriosis. Histological confirmation of disease was available for 28 (52%) of the 54 women.

Significantly more affected women (57.4%) than population controls (32.3%; P < 0.01) or unaffected women (33.3%; P < 0.05) were fast acetylators. The frequencies of fast and slow acetylators in the affected women and controls are shown in Table IGo.


View this table:
[in this window]
[in a new window]
 
Table I. Frequencies of slow and fast acetylators in affected women and controls
 
The frequencies of NAT 2 alleles and the distribution of genotypes in the three groups are shown in Table IIGo. The NAT 2 *4/*6 genotype was significantly more common among affected women (35.2%) than among population controls (8.1%; P = 0.0001) or unaffected women (4.2%; P = 0.02). The genotype relative risks (Lathrop, 1983Go) were calculated for genotypes with the *4 or *6 allele compared with any other genotype. The relative risk for the *4/*6 genotype was 4.0 (P = 0.004; 95% CI: 1.5–10.3) for cases compared with population controls and 3.6 (P = 0.066; 95% CI: 0.9–14.3) for cases compared with unaffected women. The controls were in Hardy–Weinberg equilibrium, but the affected cases were not ({chi}2 = 15.5; P = 0.02). Statistical analysis of the association with NAT 2 was therefore limited to the comparison of genotypes, rather than allele frequencies. Sasieri has suggested that comparing genotype frequencies is more appropriate statistically, even if Hardy–Weinberg equilibrium exists (Sasieri, 1997Go), because comparison between allele frequencies assumes co-dominance between the alleles (i.e. the effect of two alleles is twice that of one allele), which in practice may not be true.


View this table:
[in this window]
[in a new window]
 
Table II. Allele frequency and genotype distribution of NAT 2 polymorphisms
 
Discussion

Our data confirm recently published findings (Bischoff et al., 1998Go; Baranova et al., 1999Go) implicating the NAT 2 locus in the aetiology of endometriosis, but there are important differences between the results.

Baranova et al. have reported that a higher proportion of women with Stage I–II endometriosis were slow acetylators compared with controls, who were women undergoing termination of pregnancy with no evidence of endometriosis on physical or ultrasound examination (69 versus 39%, P = 0.004) (Baranova et al., 1999Go). There was no statistically significant difference in acetylator status between women with Stage III–IV endometriosis and the controls. Bischoff et al. only investigated women with Stage III–IV endometriosis and reported that 16/29 (55%) had the slow-acetylator phenotype (Bischoff et al., 1998Go).

However, we showed that women with Stage III–IV endometriosis (57%) were more likely to be fast acetylators than were male controls (32%, P = 0.003) or unaffected women (33%, P = 0.05). We also showed that the *4/*6 genotype was significantly more common among affected women (35.2%) than among population controls (8.1%; P = 0.0001) or unaffected women (4.2%; P = 0.02). Statistical analysis of the association with the NAT 2 gene was limited to the comparison of genotypes and not alleles, because the cases were not in Hardy–Weinberg equilibrium. Cases were not related to each other, which is one possible reason for the deviation from Hardy–Weinberg equilibrium. However, since the NAT 2 gene itself may not be the disease locus, another explanation for the deviation (and for our results) is that the NAT 2 gene and the disease locus are in linkage disequilibrium. Linkage disequilibrium occurs when a marker allele is situated so close to a disease susceptibility allele that the two alleles are inherited together amongst affected individuals in the population.

The apparent discrepancy between our results and the findings of Baranova et al. could arise because of a relative under-representation of the fast NAT 2 allele in affected women compared with controls in their data (Baranova et al., 1999Go). Although the allele frequencies in women with Stage III–IV disease in the two studies are similar, the frequency of the fast allele in the controls of Baranova et al. is much higher than in previously published reports for European subjects (see Table IIIGo for the allele frequencies reported in these studies). This apparent discrepancy may arise because of regional variations in allele frequencies. The Bischoff et al. data have only appeared in abstract form, which similarly makes comparison difficult (Bischoff et al., 1998Go).


View this table:
[in this window]
[in a new window]
 
Table III. Comparison of NAT 2 allele frequencies in this study and previously published studies
 
While it is seldom discussed, it is important to realize that such discrepancies may also arise because of genotyping errors. As part of a follow-up study, we have re-genotyped 74 alleles from 37 individuals (12 cases and 25 male controls) using different allele-specific methodology. Only one discrepancy was found which, if the new genotype is correct, would actually increase our evidence of association slightly, reducing the overall P value for heterogeneity to < 0.001 (unpublished data). We have also calculated that four of the *4 alleles of the *4/*6 genotypes would have to be changed to *6 alleles in order to increase our P-value from 0.001 to > 0.05. However, with a random allele-calling error rate of ~2%, this is quite unlikely, as one would expect not more than two cases among 108 to be wrongly typed.

The clinical evidence that endometriosis has a genetic basis is: (i) there is familial clustering in humans (Kennedy et al., 1995Go) and rhesus macaques (Hadfield et al., 1997bGo); (ii) the age at symptom onset is similar in affected, non-twin sisters (Kennedy et al., 1996Go); (iii) there is concordance in monozygotic twins (Moen, 1994Go; Hadfield et al., 1997aGo; Treloar et al., 1999Go); (iv) the disease prevalence in the first-degree relatives of affected women is six to nine times greater than in the general population (Simpson et al., 1980Go; Coxhead and Thomas, 1993Go; Moen and Magnus, 1993Go), and (v) the prevalence, determined using magnetic resonance imaging, may be as high as 15% in the sisters of women with severe disease (Kennedy et al., 1998Go).

These clinical data are supported by results from an increasing number of studies suggesting that endometriosis is associated with polymorphisms in candidate genes, especially those involved in detoxification (Baranov et al. 1996Go; Baranova et al., 1997Go, 1999Go; Bischoff et al., 1998Go), although conflicting findings have also been reported (Baxter et al., 2001Go; Hadfield et al., 2001Go). The present data add more evidence and imply either that altered NAT 2 activity is involved in the aetiology of the disease, or that NAT 2 alleles are in linkage disequilibrium with a susceptibility allele in the same chromosomal region. We believe that the latter explanation is more likely given the discrepancies in acetylator status reported in cases to date.

Notes

6 To whom correspondence should be addressed. E-mail: skennedy{at}molbiol.ox.ac.uk Back

References

Baranov, V.S., Ivaschenko, T., Bakay, B. et al. (1996) Proportion of the GSTM1 0/0 genotype in some Slavic populations and its correlation with cystic fibrosis and some multifactorial diseases. Hum. Genet., 97, 516–520.[Web of Science][Medline]

Baranova, H., Bothorishvilli, R., Canis, M. et al. (1997) Glutathione S-transferase M1 gene polymorphism and susceptibility to endometriosis in a French population. Mol. Hum. Reprod., 3, 775–780.[Abstract/Free Full Text]

Baranova, H., Canis, M., Ivaschenko, T. et al. (1999) Possible involvement of arylamine N-acetyltransferase 2, glutathione S-transferase M1 and T1 genes in the development of endometriosis. Mol. Hum. Reprod., 5, 636–641.[Abstract/Free Full Text]

Baxter, S.W., Thomas, E.J. and Campbell, I.G. (2001) GSTM1 null polymorphism and susceptibility to endometriosis and ovarian cancer. Carcinogenesis, 22, 63–65.[Abstract/Free Full Text]

Bischoff, F.Z., Marquez-Do, D., Kosugi, Y. et al. (1998) Association of N-Acetyltransferase 2 (NAT 2) genetic polymorphism resulting in decreased capacity to detoxify aromatic amines in women with endometriosis. J. Soc. Gynecol. Invest., 5 (S), 111A.

Cartwright, R.A., Glashan, R.W., Rogers, H.J. et al. (1982) Role of N-acetyltransferase phenotypes in bladder carcinogenesis: a pharmacogenetic epidemiological approach to bladder cancer. Lancet, ii, 842–845.

Coxhead, D. and Thomas, E.J. (1993) Familial inheritance of endometriosis in a British population: a case control study. J. Obstet. Gynaecol., 13, 42–44.

Cramer, D.W., Hornstein, M.D., Ng, W.G. and Barbieri, R.L. (1996) Endometriosis associated with the N314D mutation of galactose-1-phosphate uridyl transferase (GALT). Mol. Hum. Reprod., 2, 149–152.[Abstract/Free Full Text]

Georgiou, I., Syrrou, M., Bouba, I. et al. (1999) Association of estrogen receptor gene polymorphisms with endometriosis. Fertil. Steril., 72, 164–166.[Web of Science][Medline]

Hadfield, R.M., Manek, S., Nakago, S. et al. (1999) Absence of a relationship between endometriosis and the N314D polymorphism of galactose-1-phosphate uridyl transferase (GALT) in a UK population. Mol. Hum. Reprod., 5, 990–993.[Abstract/Free Full Text]

Hadfield, R.M., Manek, S., Weeks, D.E. et al. and the OXEGENE Collaborative Group (2001) Linkage and association studies of the relationship between endometriosis and genes encoding the detoxification enzymes GSTM1, GSTT1 and CYP1A1. Mol. Hum. Reprod., 7, 1073–1078.[Abstract/Free Full Text]

Hadfield, R.M., Mardon, H.J., Barlow, D.H. and Kennedy, S.H. (1997a) Endometriosis in monozygotic twins. Fertil. Steril., 68, 941–942.[Web of Science][Medline]

Hadfield, R.M., Yudkin, P.L., Coe, C.L. et al. (1997b) Risk factors for endometriosis in the rhesus monkey (Macaca mulatta): a case-control study. Hum. Reprod. Update, 3, 109–115.[Abstract/Free Full Text]

Ilett, K.F., David, B.M., Detchon, P. et al. (1987) Acetylation phenotype in colorectal carcinoma. Cancer Res., 47, 1466–1469.[Abstract/Free Full Text]

Kennedy, S.H. (1997) Is there a genetic basis to endometriosis? Semin. Reprod. Endocrinology, 15, 309–318.[Medline]

Kennedy, S.H., Mardon, H.J. and Barlow, D.H. (1995) Familial endometriosis. J. Assist. Reprod. Genet., 12, 32–34.[Web of Science][Medline]

Kennedy, S.H., Bennett, S.T. and Weeks, D.E. (2001) Genetics and infertility II: Affected sib-pair analysis in endometriosis. Hum. Reprod., Update, 7, 411–418.

Kennedy, S.H., Hadfield, R., Mardon, H.J. and Barlow, D.H. (1996) Age of onset of pain symptoms in non-twin sisters concordant for endometriosis. Hum. Reprod., 11, 403–405.

Kennedy, S.H., Hadfield, R., Westbrook, C. et al. (1998) Magnetic resonance imaging to assess familial risk in relatives of women with endometriosis. Lancet, 352, 1440–1441.[Web of Science][Medline]

Lathrop, G.M. (1983) Estimating genotype relative risks. Tissue Antigens, 22, 160–166.[Web of Science][Medline]

Longuemaux, S., Delomenie, C., Gallou, C. et al. (1999) Candidate genetic modifiers of individual susceptibility to renal cell carcinoma: a study of polymorphic human xenobiotic-metabolizing enzymes. Cancer Res., 59, 2903–2908.[Abstract/Free Full Text]

Moen, M.H. (1994) Endometriosis in monozygotic twins. Acta Obstet. Gynecol. Scand., 73, 59–62.[Web of Science][Medline]

Moen, M.H. and Magnus, P. (1993) The familial risk of endometriosis. Acta Obstet. Gynecol. Scand., 72, 560–564.[Web of Science][Medline]

Morland, S.J., Jiang, X., Hitchcock, A. et al. (1998) Mutation of galactose-1-phosphate uridyl transferase and its association with ovarian cancer and endometriosis. Int. J. Cancer, 77, 825–827.[Web of Science][Medline]

The American Fertility Society (1985) Revised American Fertility Society classification of endometriosis: 1985. Fertil. Steril., 43, 351–352.[Medline]

Rier, S.E., Martin, D.C., Bowman, R.E. et al. (1993) Endometriosis in rhesus monkeys (Macaca mulatta) following chronic exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Fundam. Appl. Toxicol., 21, 433–441.[Web of Science][Medline]

Risch, A., Wallace, D.M., Bathers, S. and Sim, E. (1980) Slow N-acetylation genotype is a susceptibility factor in occupational and smoking related bladder cancer. Hum. Mol. Genet., 4, 231–236.[Abstract/Free Full Text]

Sasieri, P.D. (1997) From genotypes to genes: doubling the sample size. Biometrics, 53, 1253–1261[Web of Science][Medline]

Simpson, J.L., Elias, S., Malinak, L.R. and Buttram-VC, J. (1980) Heritable aspects of endometriosis. I. Genetic studies. Am. J. Obstet. Gynecol., 137, 327–331.

Smith, C.A., Wadelius, M., Gough, A.C. et al. (1997) A simplified assay for the arylamine N-acetyltransferase 2 polymorphism validated by phenotyping with isoniazid. J. Med. Genet., 34, 758–760.[Abstract/Free Full Text]

Treloar, S.A., O'Connor, D.T., O'Connor, V.M. and Martin, N.G. (1999) Genetic influences on endometriosis in an Australian twin sample. Fertil. Steril., 71, 701–710.[Web of Science][Medline]

Zondervan, K.T., Cardon, L.R. and Kennedy, S.H. (2001) The genetic basis of endometriosis. Curr. Opin. Obstet. Gynecol., 13, 309–314.[Web of Science][Medline]

Submitted on December 20, 2000; accepted on September 5, 2001.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
In VivoHome page
P. G. SIGNORILE, M. CAMPIONI, B. VINCENZI, A. D'AVINO, and A. BALDI
Rectovaginal Septum Endometriosis: An Immunohistochemical Analysis of 62 Cases
In Vivo, May 1, 2009; 23(3): 459 - 464.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
C.B. Tempfer, M. Simoni, B. Destenaves, and B.C.J.M. Fauser
Functional genetic polymorphisms and female reproductive disorders: Part II--endometriosis
Hum. Reprod. Update, January 1, 2009; 15(1): 97 - 118.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
K. J. A. F. van Kaam, A. Romano, G. A. J. Dunselman, and P. G. Groothuis
Transforming Growth Factor {beta}1 Gene Polymorphism 509C/T in Deep Infiltrating Endometriosis
Reproductive Sciences, May 1, 2007; 14(4): 367 - 373.
[Abstract] [PDF]


Home page
Hum ReprodHome page
K.J.A.F. van Kaam, A. Romano, J.P. Schouten, G.A.J. Dunselman, and P.G. Groothuis
Progesterone receptor polymorphism +331G/A is associated with a decreased risk of deep infiltrating endometriosis
Hum. Reprod., January 1, 2007; 22(1): 129 - 135.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
K. Shan, W. Ying, Z. Jian-Hui, G. Wei, W. Na, and L. Yan
The function of the SNP in the MMP1 and MMP3 promoter in susceptibility to endometriosis in China
Mol. Hum. Reprod., June 1, 2005; 11(6): 423 - 427.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
M. Deguchi, S. Yoshida, S. Kennedy, N. Ohara, S. Motoyama, and T. Maruo
Lack of Association Between Endometriosis and N-acetyl transferase 1 (NAT1) and 2 (NAT2) Polymorphisms in a Japanese Population
Reproductive Sciences, April 1, 2005; 12(3): 208 - 213.
[Abstract] [PDF]


Home page
ReproductionHome page
R. Varma, T. Rollason, J. K Gupta, and E. R Maher
Endometriosis and the neoplastic process
Reproduction, March 1, 2004; 127(3): 293 - 304.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
M. Morizane, S. Yoshida, S. Nakago, S. Hamana, T. Maruo, and S. Kennedy
No Association of Endometriosis With Glutathione S-Transferase M1 and T1 Null Mutations in a Japanese Population
Reproductive Sciences, February 1, 2004; 11(2): 118 - 121.
[Abstract] [PDF]


Home page
Hum ReprodHome page
K. T. Zondervan, L. R. Cardon, and S. H. Kennedy
What makes a good case-control study?: Design issues for complex traits such as endometriosis
Hum. Reprod., June 1, 2002; 17(6): 1415 - 1423.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (36)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Nakago, S.
Right arrow Articles by Kennedy, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nakago, S.
Right arrow Articles by Kennedy, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?