Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (22)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Hansis, C.
Right arrow Articles by Krey, L. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hansis, C.
Right arrow Articles by Krey, L. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Human Reproduction, Vol. 7, No. 2, 155-161, February 2001
© 2001 European Society of Human Reproduction and Embryology


Embryology

Analysis of Oct-4 expression and ploidy in individual human blastomeres

Christoph Hansis,1, YaXu Tang, James A. Grifo and Lewis C. Krey

Program for In Vitro Fertilization, Reproductive Surgery and Infertility, New York University Medical Center, 660 First Ave, 5th floor, New York, NY 10016, USA

Abstract

Oct-4, a decisive factor that maintains totipotency in murine embryonic and germ cells, is exclusively expressed in such cells. In mice, different levels of oct-4 expression in blastomeres predict development towards inner cell mass (ICM) (high oct-4) or trophectoderm (TE) (low oct-4). To address whether the mouse model also applies to human embryos, the cytoplasm of individual human blastomeres from normally and abnormally fertilized embryos was tested for Oct-4 expression by reverse transcription–polymerase chain reaction (RT–PCR). The nuclei of the same blastomeres were subjected to fluorescence in-situ hybridization (FISH) to determine ploidy. A significant difference in Oct-4 mRNA levels was revealed between blastomeres. The distribution of blastomeres with high Oct-4 levels varied according to the cleavage stage of the embryo: the more blastomeres, the lower the percentage with high Oct-4 levels. Aneuploid blastomeres did not exhibit lower Oct-4 mRNA levels than diploid ones. Thus, differential Oct-4 expression in individual human blastomeres appears to direct cells towards the ICM or TE lineages without regard to chromosomal status. Oct-4 might be used as a marker in preimplantation genetic diagnosis to identify embryogenic blastomeres.

human blastomeres/Oct-4/Oct-3/preimplantation genetic diagnosis/totipotency

Introduction

In mammalian embryogenesis the first morphological indication of differentiation is the formation of the trophectoderm (TE) at the early blastocyst stage. While inner cell mass (ICM) cells remain totipotent, TE cells are restricted to extra-embryonic cell lineages. Data from various animal models suggests that, on a molecular level, this differentiation step could start in humans perhaps as early as the 2–4-cell stage and might involve the activation of maternally inherited determinants and/or embryo-specific genes, as well as environmental factors like cell allocation (Edwards and Beard, 1997Go). In humans, an understanding of the molecular mechanisms underlying this differentiation step may provide diagnostic benefits. Currently, blastomere biopsies of human embryos are performed for preimplantation genetic diagnosis (PGD) around the 8-cell stage and no prediction can be made regarding the future fate of these cells. However, in some instances, combined knowledge about ploidy and destination towards ICM or TE may be crucial in selecting the best embryos for transfer.

In mice, a key factor for the first differentiation step in embryogenesis is the POU domain transcription factor oct-4, also named oct-3 (Okamoto et al., 1990Go; Rosner et al., 1990Go; Scholer et al., 1990Go); oct-4 belongs to the sub-group of octamer-binding proteins that bind by the POU domain to promoter and enhancer regions of various genes with octamer sites. As with almost all POU domain transcription factors, oct-4 is developmentally regulated (for review, see Ovitt and Scholer, 1998).

In mice, oct-4 is exclusively found in totipotent embryonic cells and germ cells (Palmieri et al., 1994Go). A high level of oct-4 expression is thought to keep cells in a totipotent stage, whereas down-regulation is associated with differentiation (Palmieri et al., 1994Go); oct-4 transcription occurs prior to any changes in known transcription factor levels (Brehm et al., 1997Go). In 8-cell stage murine embryos, five cells stain immunohistochemically positive for oct-4 protein and three negative (Palmieri et al., 1994Go). After day 8 of murine embryonic development, oct-4 is restricted to primordial germ cells. It is also expressed in murine embryonic stem (ES) cells (Rosner et al., 1990Go) and embryonal carcinoma (EC) cells (Okamoto et al., 1990Go).

In murine embryogenesis, oct-4 has been shown to be essential for the development of totipotent ICM cells (Nichols et al., 1998Go). So far, approximately nine known and several unknown genes have been found to contain oct-4 binding sites; with some being positively, and others negatively, regulated by oct-4 (Ovitt and Scholer, 1998Go). This includes repression of {alpha} and ß subunits of human chorionic gonadotrophin (HCG) and activation of platelet-derived growth factor (PDGF) {alpha} receptor by oct-4.

In humans, Oct-4 is the product of the OTF3 gene, which encodes two splicing variants designated oct3A and oct3B (Takeda et al., 1992Go). Human Oct-4 (Oct3a) shares 87% sequence identity with mouse oct-4 (Takeda et al., 1992Go). In human embryos, Oct-4 is expressed throughout all stages from the unfertilized oocyte to the blastocyst stages, as detected by reverse transcription–polymerase chain reaction (RT–PCR) (Abdel-Rahman et al., 1995Go) and by PCR of cDNA libraries (Verlinsky et al., 1998Go). Oct-4 is also expressed in human EC (Pera and Herszfeld, 1998Go) and ES cells (Reubinoff et al., 2000Go). We recently reported that Oct-4 is up-regulated by ~31-fold in the ICM of human blastocysts compared with TE cells, making it a potential tool to produce and maintain human ES cells (Hansis et al., 2000Go).

In this study, we describe for the first time the distribution pattern of Oct-4 mRNA in individual blastomeres of cleavage stage human embryos as well as its relationship to ploidy. To achieve this latter goal, we separated the cytoplasm and the nuclei of individual blastomeres of normally and abnormally fertilized human cleavage stage embryos. The cytoplasm was tested for Oct-4 expression by RT–PCR and the nucleus was subjected to fluorescence in-situ hybridization (FISH).

Materials and methods

Embryo selection, grading and culture
Immature oocytes and embryos were donated to research with patient consent. A total of six immature (germinal vesicle stage) oocytes and 19 embryos at the 2–10-cell stage were discarded by nine patients. A total of 16 embryos developed from a two pronuclear (2PN) zygote, one from a 3PN zygote, one from a 1PN zygote and one displayed multinucleated blastomeres. Embryos were cultured in human tubal fluid (HTF) media (IVF Science Scandinavia, Santa Ana, CA, USA) from retrieval to fertilization check at 16–24 h (day 1), and then transferred to G1.2 (IVF Science Scandinavia) or HTF from days 1 to 3. Embryos were rinsed four times between each media change. Selected 2PN embryos displayed an anomalous morphology indicating a poor prognosis for pregnancy outcome. As such they were discarded from IVF cycles and were, therefore, appropriate for use in an Institutional Review Board (IRB) approved study (H-6902) to develop genetic diagnostic procedures.

In our IVF programme, embryos are routinely graded on a scale of 1–4 (1 = best grade) on the basis of fragmentation, cell size/shape and morphology. The 2–4-cell stage embryos had a mean grade of 3.3, the 5–7-cell stage embryos 2.7 and the 8–10-cell stage embryos 2.1. The 1PN embryo and the embryo with multinucleated blastomeres graded at 2.0 and 2.5 respectively; the 3PN embryo was not graded since these embryos are routinely discarded at fertilization check.

Separation of nucleus and cytoplasm
Embryos were placed in acid Tyrode's solution for 30–45 s until the zona pellucida appeared to dissolve. Embryos were then washed four times in G2.2 media and the blastomeres were separated by repeatedly pipetting. The blastomeres were then transferred to 5 µl 1x PCR Reaction Buffer (containing 0.1% Triton® X-100, no MgCl2) as a cellular membrane lysis buffer (Promega, Madison, WI, USA). The nuclei of individual blastomeres were identified under phase contrast microscopy (Nikon Narishige, Tokyo, Japan) and transferred to a slide by micropipette. The cytosol was collected by a separate micropipette, transferred to a tube and directly submitted to a reverse transcription (RT) reaction. Some media samples were saved as negative controls for the PCR.

cDNA synthesis
Random oligo primer (0.2 µg) and reaction buffer (1 µl of 10x, SuperScript Preamplification System; Life Technologies, Rockville, MD, USA) were added to the cytosolic fraction of the blastomeres and heated to 70°C for 5 min. Samples were then placed on ice, centrifuged and 2.6 µl of a mix of 2.5 mmol/l MgCl2, 10 mmol/l dithiothreitol, 0.5 mmol/l NTP and 5 IU RNAse inhibitor (Promega) was added. After incubation for 10 min at room temperature, Superscript II Reverse Transcriptase (100 IU) was pipetted into the sample; cDNA synthesis was carried out at room temperature for 5 min and 42°C for 50 min. The reaction was stopped at 95°C for 5 min.

PCR for Oct-4
The first PCR was carried out with 1 µl cDNA template, 500 nmol/l modified outer primer (Abdel-Rahman et al., 1995Go), 3' primer GGAAAGGCTTCCCCCTCAGGGAAAGG, 5' primer AAGAAC ATGTGTAAGCTGCGGCCC), 20 µmol/l NTP (Life Technologies) and 2 mmol/l MgCl2. The second nested PCR used 2 µl of the first PCR, 50 nmol/l modified inner Primer (3' primer TTCTGGCGCCGGTTACAGAAC CA, 5'primer GACAACAATGAGAACCTTCAGGAGA), 10 µmol/l NTP and 2 mmol/l MgCl2. Both PCRs used a `hot start' with 1 IU Taq DNA polymerase (Roche Diagnostics) at 94°C for 4 min followed by 40 cycles (first PCR) or 30 cycles (second PCR) of 94°C for 15 s, 62°C for 30 s, and 72°C for 30 s in a GeneAmp 9600 (Perkin Elmer, Norwalk, CT, USA). Final extension was 72°C for 10 min. Positive control reactions for ß-actin were routinely carried out as described for the first PCR for Oct-4, except with 0.2 µl template and 50 cycles instead of 40 (3' primer CGTGGGGCGCCCCAGGCACCA, 5' primer TTGGCCTTGGGGTTCAGGGGGG). Water and media samples served as negative controls. PCR products were analysed on a 2% agarose gel with 0.5x Tris/borate/EDTA buffer (TBE). The usual precautions to avoid contamination were followed. A 50 bp ladder marker (100 ng, marker XIII, Roche Diagnostics) was routinely used as reference to estimate PCR product size.

A titration study was conducted with dilutions (1:2.5 to 1:25) of cDNA samples subjected to the above-described PCR conditions to examine the sensitivity of the PCR and the relative expression levels of Oct-4 in blastomeres and oocytes. The sensitivity limit (up to a 1:10 dilution) for each blastomere was determined as the approximate mean between the last positive and the first negative value. For example, if a 1:2.5 dilution is positive for Oct-4 expression and a 1:5 dilution is negative, the mean would be a 1:3.3 dilution indicating an expression of 3.3-fold higher than the sensitivity limit. The factor by which Oct-4 is higher from the sensitivity limit of the applied PCR was calculated for each blastomere (range: 1.4–12.0-fold).

To determine whether Oct-4 cDNA levels in Oct-4-negative blastomeres were above or below the detection limit, a second, highly sensitive PCR was also performed using the same PCR conditions as in the titration PCR except that 50 cycles instead of 30 were applied for the second round of PCR and 20 µmol/l NTP were used instead of 10 µmol/l.

In the titration experiments for the oocytes, the same PCR conditions were applied as in the blastomere titration studies. Since the nucleus was not mechanically removed from these oocytes, the RNA was prepared using caesium chloride centrifugation (Rappolee et al., 1989Go). Using this method, more RNA might be lost than with the blastomeres, so the results of the titration in oocytes should be considered as minimum values.

FISH
Blastomere nuclei were fixed on slides with methanol:acetic acid (3:1) and subjected to FISH using X,Y and 18 CEP direct-labelled probes (Vysis, Downers Grove, IL, USA) for 30 min in HYBrite (Vysis) according to the manufacturer's instructions. The nucleus was counter-stained with 4'6-diamidino-2-phenylindole (DAPI; Vysis). FISH signals were visualized using a fluorescent microscope (Olympus AX 70, Tokyo, Japan). Digital images were saved for analysis.

Results

A total of 19 embryos were examined for Oct-4 expression and three were abnormal: one developed from a 3PN zygote, one from a 1PN zygote and a final one from a 2PN zygote, but with multiple multinucleated blastomeres beginning at the 2-cell stage. The embryo that developed from a 3PN zygote (Figure 1BGo) had one blastomere positive for Oct-4 mRNA. In contrast, in the embryo that developed from a 1PN zygote, all blastomeres were negative for Oct-4 and none had visible nuclei. Finally, the embryo with multinucleated blastomeres had no blastomeres with a detectable level of Oct-4 mRNA. Of the 16 embryos that developed from 2PN zygotes (Figure 1AGo), one had no visible nuclei in all three blastomeres and another was negative for the expression of the control-gene ß-actin in all four blastomeres. These two embryos, as well as the abnormal embryos described above, were excluded from further calculations.



View larger version (123K):
[in this window]
[in a new window]
 
Figure 1. Separation of individual blastomeres from human cleavage stage embryos. (A) Two pronuclear (2PN) zygote from a 40 year old woman developed into this 10-cell embryo (embryo I) at day 4. Sperm cells are still visible bound to the zona pellucida. (B) Embryo II at day 3 which had developed from a 32 year old woman. (C) Individual blastomeres (nos. 1–10) from embryo I. (D) Individual blastomeres (nos. 1–7) from embryo II. Arrows point to nuclei.

 
Of the 14 remaining embryos, 12 displayed blastomeres with detectable Oct-4 expression. The mean grade for Oct-4-expressing embryos was 2.6 (range 1–3.5), the mean grade for Oct-4-negative 2PN embryos was 2.3 (range 2–3). Oct-4-positive and -negative 2PN embryos were obtained from oocytes of women with a mean age of 36.3 years (range 30–43) and 38.0 years (range 31–41) respectively.

A total of 95 blastomeres were harvested from the 14 embryos. Five blastomeres lysed during separation and nine were considered to be fragments on the basis of size and the absence of a visible nucleus. Two blastomeres had neither ß-actin mRNA expression nor a visible nucleus, whereas ß-actin mRNA expression was not detected in three blastomeres and no nucleus was seen in 11 regular sized blastomeres. A final blastomere had a visible nucleus, but FISH did not reveal any signals. Each of these 31 blastomeres was excluded from further consideration.

Each of the remaining 64 blastomeres chosen to calculate the frequency of Oct-4-positive blastomeres were positive for ß-actin mRNA (Figure 2BGo), had a clearly visible nucleus and showed a FISH signal. Of these blastomeres, 27 (42%) were positive for Oct-4 mRNA expression (Figure 2AGo). Experiments for Oct-4 expression were repeated for the blastomeres of five embryos and results were 100% in confirmation.



View larger version (61K):
[in this window]
[in a new window]
 
Figure 2. Analysis of Oct-4 expression in two embryos that developed from two pronuclear (2PN) zygotes. (A) Oct-4 expression in individual blastomeres. Lane 1–8 = blastomeres nos. 1–8 from embryo III (see Figure 4AGo); lane 9–16 = blastomeres nos. 1–8 from a day 3 embryo (embryo IV) from a 31 year old woman; lane 17 = water control, lane 18 = media control. All reactions with 1 µl template each were subjected to the same polymerase chain reaction (PCR) conditions in the same experiment. Oct-4 nested PCR product = 218 bp. (B) ß-actin control reactions for the blastomeres 1–8 of embryos III and IV; lanes correspond to those depicted in (A); 0.2 µl template for each reaction. ß-actin product = 243 bp. (C) Determination of PCR sensitivity and relative levels of Oct-4 expression in blastomeres nos. 2, 3, 5 and 7 of embryo III which correspond to lanes 2, 3, 5 and 7 of (A). Lanes 1–2 = blastomere no. 2 with 1:1 and 1:2.5 dilutions; lanes 3–5 = blastomere no. 3 with 1:1, 1:2.5 and 1:5 dilutions; lanes 6–7 = blastomere no. 5 with 1:1 and 1:2.5 dilutions and lanes 8–10 = blastomere no. 7 with 1:1, 1:5 and 1:7.5 dilutions; water control and media controls are in lanes 11 and 12 respectively. PCR conditions were identical to those applied in (A). Sensitivity limits translate into an ~3.0-fold induction for all four blastomeres. (D) Determination of PCR sensitivity and relative Oct-4 expression levels of blastomeres nos. 1, 3, 4 and 7 of embryo IV which correspond to lanes 9, 11, 12 and 15 of (A). Lanes 1–3 = blastomere no. 1 with 1:1, 1:2.5 and 1:5 dilutions; lanes 4–6 = blastomere no. 3 with 1:1, 1:5 and 1:7.5 dilutions; lanes 7–9 = blastomere no. 4 with 1:1, 1:5 and 1:7.5 dilutions and lanes 10–12 = blastomere no. 7 with 1:1, 1:2.5 and 1:5 dilutions; water and media controls are in lane 14 and 15 respectively. PCR conditions were identical to those applied in (A). Expression levels were ~4.7 higher than the sensitivity limit. All gels: 2% agarose gel, 0.5x Tris/borate/EDTA buffer (TBE), 10 µl PCR product loaded, 50 bp ladder marker (100 ng, marker XIII, Roche Diagnostics).

 
The blastomeres were obtained from 2PN embryos at different cleavage stages (2-cell, n = 1; 4-cell, n = 1; 5-cell, n = 3; 7-cell, n = 2; 8-cell, n = 4; 9-cell, n = 2; 10-cell, n = 1). The percentage of Oct-4 mRNA positive cells varied according to cleavage stage: the higher the cell number, the lower the percentage of Oct-4 expressing blastomeres. When organized in three main groups (Figure 3Go), the percentage dropped from 100% in 2–4-cell embryos (n = 5 analysed blastomeres from two embryos) to 44% in 5–7-cell embryos (n = 16 analysed blastomeres from five embryos) and to 35% in 8–10-cell embryos (n = 43 analysed blastomeres from seven embryos). Even in the advanced cleavage stages no more than four blastomeres per embryo were positive for Oct-4.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 3. Percentage of blastomeres with a high level of Oct-4 expression in embryos at three different cleavage stages. Mean value for all blastomeres at each stage: 100, 43.8 and 34.8%. Only blastomeres with a visible nucleus and a positive signal for ß-actin were counted.

 
Taking all Oct-4-expressing blastomeres derived from 2PN zygotes together, Oct-4 expression was, on average, 3.8-fold higher than the sensitivity limit of the PCR (Figure 2C and DGo). Relative expression levels in Oct-4-positive blastomeres dropped from 4.7-fold in 2–4-cell embryos to 3.0-fold in 5–7-cell embryos, but increased again to 3.7-fold in 8–10-cell embryos. The Oct-4-positive blastomere of the 3PN embryo only showed a relative expression of 1.4-fold.

When the highly sensitive second PCR was applied, five out of six Oct-4-negative blastomeres of Figure 2AGo with a visible nucleus remained negative (data not shown). Thus, although Oct-4-negative blastomeres might harbour some Oct-4-mRNA, the levels are, nonetheless, frequently below the detection limit of a PCR. Moreover, the calculated relative expression level of Oct-4 in positive blastomeres is reasonably adequate and the difference between Oct-4-positive and negative blastomeres is more or less the difference between the Oct-4 relative expression level and zero.

We also measured Oct-4 expression in six discarded immature (germinal vesicle stage) oocytes. Each displayed a high level of Oct-4 expression, averaging 11.5-fold higher than Oct-4 negative blastomeres (data not shown).

The results for the chromosomal analysis of all 14 embryos derived from 2PN zygotes and the relationship between ploidy and Oct-4 expression are shown in Tables I and IIGoGo. Using FISH, three out of 14 embryos included in the study were euploid, while mosaic aneuploidies were found in eight, and three were totally aneuploid (Figure 4Go). Normal numbers of sex chromosomes and chromosome 18 were seen in the nuclei from 49 of the 64 blastomeres (77%). Five nuclei (8%) showed a loss of one or more chromosome(s), and three (5%) had a gain of one or more chromosome(s). Four blastomeres (6%) showed two nuclei with a normal set of chromosomes, whereas three blastomeres (5%) had two nuclei with an abnormal chromosomal set. Aneuploidy was observed in 23% of all blastomeres and in 22% of all low Oct-4 mRNA level blastomeres. The only Oct-4-positive cell in the embryo that developed from a 3PN zygote was also the only cell of that embryo with normal numbers of X, Y and 18.


View this table:
[in this window]
[in a new window]
 
Table I. Chromosomal analysis for embryos derived from two pronuclear (2PN) zygotes (n = 14)
 

View this table:
[in this window]
[in a new window]
 
Table II. Relationship between ploidy of chromosomes X, Y, 18 and Oct-4 expression for all 64 blastomeres
 


View larger version (43K):
[in this window]
[in a new window]
 
Figure 4. Fluorescence in-situ hybridization (FISH) for chromosomes X (red), Y (green) and 18 (blue); nuclei are counterstained with 4'6-diamidino-2-phenylindole (DAPI). (A) Blastomeres nos. 2, 4 and 8 from a 2PN zygote of a 40 year old woman that developed into an 8-cell stage embryo (III); blastomeres nos. 1, 3, 5, 6, and 7 had a normal karyotype (data not shown). (B) Blastomeres nos. 3 and 5 of 7-cell embryo II (see Figure 1B,DGo). Blastomere no. 5 displayed two nuclei. Blastomere no. 3 is shown in picture 3 of Figure 1DGo, blastomere no. 5 in picture 5. Chromosome 18 is also shown with the aqua band filter (no. 3 b, no. 5 n1 b, no. 5 n2 b). Blastomeres nos. 1 and 2 did not show a nucleus; blastomere no. 4: two nuclei, X X 18 18 and X Y 18 18; blastomere no. 6: X 18 18 18; blastomere no. 7: X Y 18 18 18 18 (data not shown).

 
The mean grade of the chromosomally normal 2PN embryos (no abnormal cells detected, single nuclei) was 2.5 (range 2–3), the grade for the 2PN embryos with at least one abnormal cell, including binucleated blastomeres, was 2.5 (range 1–3.5). The mean age of the mothers of the chromosomally normal 2PN embryos was 34.5 years (range 31–38 years) and for the abnormal 2PN embryos, it was 36.5 years (range 30–43).

Discussion

In previous experiments we described procedures to monitor Oct-4 expression in human blastocysts. Verifying Oct-4 amplification and titration by PCR and comparing ICM and TE fractions, we found that Oct-4 is expressed a mean of 31-fold higher in ICM than in TE (Hansis et al., 2000Go). Using similar protocols for Oct-4 amplification and titration, we describe here the temporal and spatial variations of Oct-4 mRNA levels in human oocytes and between individual blastomeres of cleavage stage embryos.

The amount of Oct-4 RNA was 3.8-fold higher in Oct-4-positive blastomeres than in Oct-4-negative blastomeres. This seems to be a rather high value for a transcription factor that initiates a signal cascade. In fact, recent results describe a much closer regulation of Oct-4 expression in murine embryonic stem cells: relative expression levels of 0.5, 1.0 and 1.5 direct the cells to trophectoderm, inner cell mass and primitive endoderm and mesoderm, respectively (Niwa et al., 2000Go). It appears that, in humans, variations of Oct-4 induction may take place at relatively higher levels than in mice, because physiological Oct-4 activity requires a higher level of expression. Thus, the relationship between Oct-4 activity and the three cell destinations in mice could still take place in humans, but at higher levels of expression. Future quantification of Oct-4 levels in individual cells of cleavage stage embryos, morulae and blastocysts are necessary to understand these processes. On the other hand, blastomeres with very high levels of Oct-4 expression may be aberrant and destined to undergo apoptosis.

Taken together with our previous results, the present observations describe the temporal pattern of Oct-4 expression during early embryonic life, from oocyte to blastocyst. The high levels of Oct-4 mRNA in a mammalian oocyte suggests that this factor contributes to the restitution and maintenance of totipotency necessary for successful animal cloning experiments. Oct-4 mRNA levels were detectable in every blastomere tested from 2–4-cell embryos. Moreover, the drop from an 11.5-fold relative expression level in oocytes to a 4.7-fold expression level per blastomere in 2–4-cell embryos could signify that maternal mRNA transcripts of Oct-4 are equally distributed during the first two cell divisions. Clearly, such a pattern is at odds with a concept of a polarized distribution of Oct-4 mRNA in human oocytes and early embryos (Edwards and Beard, 1997Go). The present findings of a mostly equal distribution of Oct-4 mRNA from oocyte to 2–4-cell embryo also suggests that degradation of maternal transcripts of Oct-4 does not occur prior to the 4–8-cell stage; in later stages this is difficult to assess since both de-novo transcription and degradation would probably occur simultaneously.

General genomic activation occurs during the 4–8-cell stage in human embryos (Tesarik et al., 1986Go; Braude et al., 1988Go). Thus, after a further drop to a 3.0-fold relative expression level in 5–7-cell embryos, genomic activation provides new Oct-4 mRNA copies and the expression level rises to 3.7-fold in the 8–10-cell embryos. By the time the embryo reaches the blastocyst stage, Oct-4 is expressed ~31 times higher in the ICM than in TE (Hansis et al., 2000Go). The calculated relative expression level for an individual ICM cell is ~2.4 (31/13) and is based on a report that there are ~13 cells in the ICM of a day 6 human blastocyst with poor morphology derived from a 2PN zygote (Evsikov and Verlinsky, 1998Go). The decline from a 3.7-fold Oct-4 expression level in the 8–10-cell embryo to a 2.4- expression level in the blastocyst ICM is possibly due to the appearance of apoptotic cells in the ICM which lowers the calculated level of expression per cell (Hardy, 1999Go).

The physiological processes that trigger Oct-4 down-regulation in some blastomeres are still unknown; location of cells in the embryo and formation of specific cell–cell contacts, e.g. a signal cascade from E-cadherin to ß-catenin to lymphoid enhancer factor (LEF-1) (Pesce et al., 1998Go), might be one mechanism. Other possible mechanisms of repression, eventually connected with the E-cadherin signal cascade, involve retinoic acid responsive elements (Pikarsky et al., 1994Go), changes in chromatin structure (Minucci et al., 1996Go) and de-novo methylation (Ben-Shushan et al., 1993Go).

The temporal expression of Oct-4 follows spatial expression; the higher the number of cells in an embryo, the lower the percentage of Oct-4-positive blastomeres. The presence of blastomeres with high Oct-4 levels depends neither on the age of the mother nor the morphology or ploidy of the embryo. For each of the three groups of different cleavage stage embryos derived from 2PN zygotes, there was no apparent pattern for the age or chromosomal status of Oct-4-positive blastomeres. However, grading comparison revealed that the higher the cell number, the better the mean grade of the embryo. This probably reflects the prolonged survival of higher-grade embryos, but could also mean that poor grade embryos have a greater chance of harbouring blastomeres with a high level of Oct-4. Clinical observation supports the hypothesis that a poor embryo grade does not necessarily reflect developmental potential although a high percentage of poor grade embryos are aneuploid (Munné et al., 1995Go). All of the studied embryos were discarded. Nevertheless, six embryos that developed from 2PN zygotes were graded 2.0 or better and each fit very well into the pattern of Oct-4 expression. Thus, the foregoing description of Oct-4 expression during early cleavage stages seems to reflect a physiological situation rather than an artificial one caused by the selection of poor quality embryos for study.

In 11 of 16 embryos one or more cell(s) were lost due to lysis during separation or had to be excluded due to negative ß-actin mRNA expression, fragmentation or the absence of a nucleus. These lost and excluded blastomeres may have been undergoing apoptosis, and it is quite possible that they would not have contributed to the further development of the embryo. In arrested cleavage stage embryos, blastomeres undergo apoptosis and are characterized by cytosolic fragmentation, nuclear breakdown and RNA degradation (Hardy, 1999Go). From the above mentioned 11 embryos with lost cells, 10 were delayed or arrested in their development and all of them had fragmentation of 10–40%.

In human embryos, mosaic aneuploidies are a common finding. Between 30% (Delhanty et al., 1997Go; Harper et al., 1995Go) and 50% (Munne et al., 1995Go) of normally developing cleavage stage human embryos are thought to contain one or more aneuploid blastomeres. In our experiments mosaic aneuploidies were detected in 57% of all embryos that developed from 2PN zygotes, while 21% were totally aneuploid. One might speculate that aneuploid blastomeres are actively directed towards trophectoderm; however, they do not appear to be directed towards extraembryonic cell lineages by Oct-4 since we found that aneuploid blastomeres are not more likely to exhibit a low Oct-4 mRNA level.

Interestingly, high levels of Oct-4 occurred in 70% of the blastomeres with additional chromosomes X, Y and 18 but in none of the blastomeres with a loss of one or more of these chromosomes, including binucleate blastomeres. Various homeobox genes are also differently expressed in triploid human preimplantation embryos compared with diploid (Kuliev et al., 1996Go). At the present time, there is no indication that chromosomes X, Y and 18 play critical roles in the regulation of Oct-4 expression. However, aneuploidies in chromosomes other than X, Y and 18 may be linked to variations in Oct-4 expression. If trisomic blastomeres are more likely to have a high level of Oct-4 and are thus supposedly more likely to contribute to the embryo proper, this might explain in part the much higher incidence of live births with trisomies than monosomies. Clearly, further studies are needed to define the relationship between ploidy of particular chromosomes and Oct-4 expression.

The present study demonstrates the feasibility of combining RT–PCR and FISH analyses in individual blastomeres. Similar procedures might promise new opportunities in PGD to characterize mosaic aneuploidies and to provide the means for a more complete understanding of key steps in differentiation during early embryonic development. A large variety of housekeeping genes, transcription factors, growth factors, gender determining genes and tissue specific genes are known to be expressed at the 4–8-cell stage (Pergament and Fiddler, 1998Go); correlating their expression with that of oct-4 in biopsied blastomeres might prove valuable in the future to select embryos with the highest potential for development. Combined with genomic PCR, one might be able to use RT–PCR and FISH appliances to monitor single gene defects, gene expression and chromosomal abnormalities in individual blastomeres biopsied for PGD.

The foregoing description of Oct-4 expression in early human embryogenesis presents a picture comparable to that described in the mouse model in which primary function of Oct-4 is to retain totipotency in particular embryonic cells and germ cells (Pesce et al., 1998Go). Our experiments are consistent with the hypothesis that Oct-4 may have a similar function in human embryos. Future experiments focussing on Oct-4 protein expression and repression are necessary to establish that biological functions of Oct-4 are the same in both species.

Acknowledgments

We would like to thank Drs Ling Chi and Caroline McCaffrey for their valuable help in collecting and assessing the embryos used in this study.

Notes

1 To whom correspondence should be addressed at Department of Gynecological, Endocrinology and Reproductive Medicine, University of Bonn, Sigmund-Freud-Strasse 25, 53127 Bonn, Germany. E-mail: ChrHansis{at}aol.com Back

References

Abdel-Rahman, B., Fiddler, M., Rappolee, D. et al. (1995) Expression of transcription regulating genes in human preimplantation embryos. Mol. Hum. Reprod., 10, 2787–2792.

Ben-Shushan, E., Pikarsky, E., Klar, A. et al. (1993) Extinction of Oct3/4 gene expression in embryonal carcinomaxfibroblast somatic cell hybrids is accompanied by changes in the methylation status, chromatin structure and transcriptional activity of the Oct3/4 upstream region. Mol. Cell. Biol., 13, 891–901.[Abstract/Free Full Text]

Braude, P.R., Bolton, V. and Moore, S. (1988) Human gene expression first occurs between the four- and eight–cell stages of preimplantation development. Nature, 332, 459–461.[Medline]

Brehm, A., Ohbo, K., Scholer, H.R. et al. (1997) The carboxy-terminal transactivation domain of Oct-4 acquires cell specificity through the POU domain. Mol. Cell,. Biol., 17, 154–162.[Abstract]

Delhanty, J.D., Harper, J.C., Ao, A. et al. (1997) Multicolour FISH detects frequent chromosomal mosaicism and chaotic division in normal preimplantation embryos from fertile patients. Hum. Genet., 99, 755–760.[Web of Science][Medline]

Edwards, R.G. and Beard, H.K. (1997) Oocyte polarity and cell determination in early mammalian embryos. Mol. Hum. Reprod., 3, 863–905.[Abstract/Free Full Text]

Evsikov, S. and Verlinsky, Y. (1998) Mosaicism in the inner cell mass of human blastocysts. Hum. Reprod., 13, 3151–3155.[Abstract/Free Full Text]

Hansis, C., Grifo, J.A. and Krey, L.C. (2000) Oct-4 expression in inner cell mass and trophectoderm of human blastocysts. Mol. Hum. Reprod., 6, 999–1004.[Abstract/Free Full Text]

Hardy, K. (1999) Apoptosis in the human embryo. Rev. Reprod., 4, 125–134.[Abstract]

Harper, J.C., Coonen, E., Handyside, A.H. et al. (1995) Mosaicism of autosomes and sex chromosomes in morphologically normal, monospermic preimplantation human embryos. Prenat. Diagn., 15, 41–49.[Web of Science][Medline]

Kuliev, A., Kukharenko, V., Morozov, G. et al. (1996) Expression of Homeobox-containing genes in human preimplantation development and in embryos with chromosomal aneuploidies. J. Assist. Reprod. Genet., 13, 177–181.[Web of Science][Medline]

Minucci, S., Botquin, V., Yeom, Y.I. et al. (1996) Retinoic acid-mediated down-regulation of Oct3/4 coincides with the loss of promoter occupancy in vivo. EMBO J., 15, 888–899.[Web of Science][Medline]

Munné, S., Alikani, M., Tomkin, G. et al. (1995) Embryo morphology, developmental rates, and maternal age are correlated with chromosome abnormalities. Fertil. Steril., 64, 382–391.[Web of Science][Medline]

Nichols, J., Zevnik, B., Anastassiadis, K. et al. (1998) Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell, 95, 379–391.[Web of Science][Medline]

Niwa, H., Miyazaki, J. and Smith, A.G. (2000) Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nature Genet., 24, 372–376.[Web of Science][Medline]

Okamoto, K., Okazawa, H., Okuda, A. et al. (1990) A novel octamer binding transcription factor is differentially expressed in mouse embryonic cells. Cell, 60, 461–472.[Web of Science][Medline]

Ovitt, C.E. and Scholer, H.R. (1998) The molecular biology of Oct-4 in the early mouse embryo. Mol. Hum. Reprod., 4, 1021–1031.[Abstract/Free Full Text]

Palmieri, S., Peter, W., Hess, H. et al. (1994) Oct-4 transcription factor is differentially expressed in the mouse embryo during establishment of the first two extraembryonic cell lineages involved in implantation. Dev. Biol., 166, 259–267.[Web of Science][Medline]

Pera, M.F. and Herszfeld, D. (1998) Differentiation of human pluripotent teratocarcinoma stem cells induced by bone morphogenetic protein-2. Reprod. Fertil. Dev., 10, 551–555.[Medline]

Pergament, E. and Fiddler, M. (1998): The expression of genes in human preimplantation embryos. Prenat. Diagn., 18, 1366–1373.[Web of Science][Medline]

Pesce, M., Gross, M.K. and Scholer, H.R. (1998) In line with our ancestors: Oct-4 and the mammalian germ. Bioessays, 20, 722–732.[Web of Science][Medline]

Pikarsky, E., Sharir, H., Ben-Shushan, E. et al. (1994) Retinoic acid represses Oct-3/4 gene expression through several retinoic-acid responsive elements located in the promoter-enhancer region. Mol. Cell. Biol., 14, 1026–1038.[Abstract/Free Full Text]

Rappolee, D.A., Wang, A., Mark, D. et al. (1989) Novel method for studying mRNA phenotypes in single or small numbers of cells. J. Cell. Biochem., 39, 1–11.[Web of Science][Medline]

Reubinoff, B.E., Pera, M.F., Fong, C.Y. et al. (2000) Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nat. Biotechnol., 18, 399–404.[Web of Science][Medline]

Rosner, M.H., Vigano, M.A., Ozato, K. et al. (1990) A POU-domain transcription factor in early stem cells and germ cells of the mammalian embryo. Nature, 345, 686–692.[Medline]

Scholer, H.R., Dressler, G.R., Balling, R. et al. (1990) Oct-4: a germline-specific transcription factor mapping to the mouse t-complex. EMBO J., 9, 2185–2195.[Web of Science][Medline]

Takeda, J., Seino, S. and Bell, G.I. (1992) Human Oct3 gene family: cDNA sequences, alternative splicing, gene organization, chromosomal location, and expression at low levels in adult tissues. Nucleic Acids Res., 20, 4613–4620.[Abstract/Free Full Text]

Tesarik, J., Kopecny, V., Plachot, M. et al. (1986) Activation of nucleolar and extra-nucleolar RNA synthesis and changes in ribosomal content of human embryos developing in vitro. J. Reprod. Fertil., 78, 463–470.[Abstract/Free Full Text]

Verlinsky, Y., Morozov, G., Verlinsky, O. et al. (1998) Isolation of cDNA libraries from individual human preimplantation embryos. Mol. Hum. Reprod., 4, 571–575.[Abstract/Free Full Text]

Submitted on September 25, 2000; accepted on November 28, 2000.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
ReproductionHome page
S J Kimber, S F Sneddon, D J Bloor, A M El-Bareg, J A Hawkhead, A D Metcalfe, F D Houghton, H J Leese, A Rutherford, B A Lieberman, et al.
Expression of genes involved in early cell fate decisions in human embryos and their regulation by growth factors
Reproduction, May 1, 2008; 135(5): 635 - 647.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
I. Cervello, J.A. Martinez-Conejero, J.A. Horcajadas, A. Pellicer, and C. Simon
Identification, characterization and co-localization of label-retaining cell population in mouse endometrium with typical undifferentiated markers
Hum. Reprod., January 1, 2007; 22(1): 45 - 51.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
G. Cauffman, I. Liebaers, A. Van Steirteghem, and H. Van de Velde
POU5F1 Isoforms Show Different Expression Patterns in Human Embryonic Stem Cells and Preimplantation Embryos
Stem Cells, December 1, 2006; 24(12): 2685 - 2691.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
X. Zhang, P. Stojkovic, S. Przyborski, M. Cooke, L. Armstrong, M. Lako, and M. Stojkovic
Derivation of Human Embryonic Stem Cells from Developing and Arrested Embryos
Stem Cells, December 1, 2006; 24(12): 2669 - 2676.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
H. C. Chang, H. Liu, J. Zhang, J. Grifo, and L. C. Krey
Developmental incompetency of denuded mouse oocytes undergoing maturation in vitro is ooplasmic in nature and is associated with aberrant Oct-4 expression
Hum. Reprod., July 1, 2005; 20(7): 1958 - 1968.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
D. Wells, M.G. Bermudez, N. Steuerwald, A.R. Thornhill, D.L. Walker, H. Malter, J.D.A. Delhanty, and J. Cohen
Expression of genes regulating chromosome segregation, the cell cycle and apoptosis during human preimplantation development
Hum. Reprod., May 1, 2005; 20(5): 1339 - 1348.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
G. Cauffman, H. Van de Velde, I. Liebaers, and A. Van Steirteghem
Oct-4 mRNA and protein expression during human preimplantation development
Mol. Hum. Reprod., March 1, 2005; 11(3): 173 - 181.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (22)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Hansis, C.
Right arrow Articles by Krey, L. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hansis, C.
Right arrow Articles by Krey, L. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?