Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow An erratum has been published
Right arrow An erratum has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (11)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Huminiecki, L.
Right arrow Articles by Bicknell, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huminiecki, L.
Right arrow Articles by Bicknell, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Human Reproduction, Vol. 7, No. 3, 255-264, March 2001
© 2001 European Society of Human Reproduction and Embryology


Testis and spermatogenesis

Vascular endothelial growth factor transgenic mice exhibit reduced male fertility and placental rejection

L. Huminiecki1, H.Y. Chan1, S. Lui1, R. Poulsom2, G. Stamp3, A.L. Harris4 and R. Bicknell1,5

1 Molecular Angiogenesis Laboratory, Imperial Cancer Research Fund, Weatherall Institute of Molecular Medicine, University of Oxford, John Radcliffe Hospital, Oxford OX3 9DS, 2 In Situ Histopathology Unit, Imperial Cancer Research Fund, 44 Lincoln's Inn Fields, London WC2A 3PX, 3 Department of Histopathology, Division of Investigative Sciences, Imperial College School of Medicine, Hammersmith Hospital, Du Cane Road, London W12 0NN, and 4 Molecular Oncology Laboratory, Imperial Cancer Research Fund, Weatherall Institute of Molecular Medicine, University of Oxford, John Radcliffe Hospital, Oxford OX3 9DS, UK

Abstract

Recent evidence points to the involvement of vascular endothelial growth factor (VEGF) in mammalian reproductive physiology. Transgenic mice expressing VEGF (121 isoform) under the control of the polyepithelial mucin-1 (muc-1) promoter showed a reduction in male fertility due to impaired spermiogenesis, and aberrant placentation leading to preferential rejection of male embryos. A skew in the sex ratio of the litters was seen (three females to two males), independently of whether the transgene was carried by the male or female parent. In-situ hybridization permitted distinction of expression of the human VEGF transgene from endogenous mouse VEGF, and confirmed expression of the transgene in a wide range of epithelial tissues. Expression of the transgene in spermatocytes and in the embryonic portion of placenta is thought to be responsible for the reduced fertility and embryonic resorptions respectively. Males showed either complete sperm maturation arrest or various gradations of partial fertility. Abnormally high or low VEGF in human semen has been reported to be correlated with a lack of pregnancy success following IVF. The muc1-VEGF (121 isoform) transgenic mouse provides an animal model with which to further study this VEGF-induced pathology.

epithelial mucin/testis/transgenic mice/VEGF

Introduction

Vascular endothelial growth factor (VEGF) is one of the most characterized angiogenic factors [for review, see (Ferrara, 1999Go)]. It is an endothelial growth factor and stimulates both migration and proliferation of endothelial cells. VEGF has two tyrosine kinase receptors, Flk and Flt-1, and its expression is induced by hypoxia and glucose deprivation. A knockout of the VEGF gene in mice abolishes all development of the vasculature, showing that VEGF is a primary developmental vasculogenic factor and that no other factor may substitute (Carmeliet et al., 1996Go; Ferrara et al., 1996Go). Expression of VEGF appears to be universal when an appropriate stimulus, e.g. hypoxia, is present. In contrast, expression of the VEGF receptors Flk and Flt-1 has been thought to be highly restricted. Non-endothelial expression of Flk and Flt-1 is restricted to leukocytes and cells involved in reproductive physiology. Recent reports have described the presence of Flt-1 in trophoblast cells (Clark et al., 1996Go), and both receptors on Leydig and Sertoli cells (Ergun et al., 1997Go), spermatocytes (Marti and Risau, 1998Go) and mature spermatozoa (Obermair et al., 1999Go). For some time, VEGF has been known to be present at a surprisingly high concentration in semen, but its function there has not been known (Brown et al., 1995Go). More recently, it was shown that the level of VEGF in seminal plasma is a strong male predictive factor of pregnancy success in couples undergoing IVF treatment (Obermair et al., 1999Go).

There are at least four different human VEGF isoforms which result from differential splicing of the messenger RNA. These isoforms are proteins containing 121, 165, 189 and 206 amino acid residues. The 121 isoform lacks the heparin-binding activity present in the other isoforms and does not bind to the extracellular matrix. Thus, the VEGF (121 isoform) alone amongst the isoforms is freely diffusible from the cell that produces it. We have previously shown that human VEGF is active in mice (Zhang et al., 1995Go) and that the 121 isoform is the most tumourigenic isoform in MCF-7 xenograft models (Zhang et al., 2000Go).

The muc-1 gene product is a glycoprotein (known as polymorphic epithelial mucin-1 or PEM), which is expressed on the apical surface of a wide range of epithelial tissues (Braga et al., 1992Go). The expression pattern is similar across mammals, and muc-1 is also highly expressed during development (Braga et al., 1992Go). The muc-1 promoter can be activated by progesterone (Parry et al., 1992Go), and muc-1 expression in the uterus fluctuates during implantation (for review, see Carson et al., 1998) and placentation (Braga and Gendler, 1993Go; DeLoia et al., 1998Go).

In a separate study, MMTV-VEGF (165 isoform) transgenic mice have been prepared and the males shown to be infertile (Korpelainen et al., 1998Go). Here we report the preparation of human VEGF (121 isoform) transgenic mice in which expression of the VEGF transgene is under the control of the human polyepithelial mucin-1 promoter. Unlike the MMTV-VEGF (165 isoform) mice that were infertile, our males showed a less extreme phenotype with reduced fertility compared with normal mice. In addition, fetal rejection and a skew in sex ratio occurred. These mice are compared with the MMTV-VEGF (165 isoform) mice and the pathology is discussed in terms of what is currently known about expression of VEGF and its receptors in reproductive tissues. Possible mechanisms for an effect of VEGF on male fertility and in causing embryonic resorption are discussed.

Materials and methods

Construction of the muc-1 promoter-VEGF (121 isoform) plasmid
The muc1-VEGF (121 isoform) plasmid was constructed by insertion of a 518 bp human VEGF (121 isoform) cDNA into the plasmid PEM-pNASSß (a gift of Joyce Taylor-Papadimitrou, ICRF, London), containing a 1656 bp polymorphic epithelial mucin (muc-1) promoter fragment and the ß-galactosidase gene. ß-galactosidase was excised from PEM-pNASSß by NotI digestion. The overhanging ends of the promoter-vector backbone were filled in by treatment with Klenow DNA polymerase I fragment and dNTPs. The VEGF cDNA was released from the plasmid pBSVg (a gift of H.Weich, Braunschweig, Germany) by treatment with EcoRI and BamHI and the ends were also filled in with the Klenow polymerase. After blunt-end ligation a 4.5 kb vector containing both the muc-1 promoter and the 518 bp VEGF cDNA, muc1-VEGF (121 isoform) was formed and electroporated into Escherichia coli strain DH10ß. The plasmid was then prepared using standard techniques.

Transient transfection into human embryonic kidney cells
The muc1-VEGF (121 isoform) construct was shown to be functionally active by transient expression in 293T human embryonic kidney cells. Briefly, 25 µg of plasmid DNA was transfected into 5x106 293T cells using a standard calcium phosphate procedure. The supernatant was collected 48 h later and assayed for human VEGF by an enzyme-linked immunosorbent assay (ELISA) (Quantikine kit; R&D Systems, Abingdon, UK).

Embryonic injections
DNA was injected into the male pronucleus of fertilized F1xF1 hybrid (CBAxC57BL/6) mouse embryos which were then implanted into pseudopregnant foster mothers. Transgenic founders were identified by screening DNA samples taken from these litters. Founders were subsequently bred with CBAxC57BL/6 mice to establish `founder lines' and to produce offspring for further analysis.

Polymerase chain reaction (PCR)-based screening for the presence of the transgene
Genomic DNA was isolated from tail-snips using a standard proteinase K phenol–chloroform method (Gross-Bellard et al., 1973Go). The PCR reaction was performed routinely on a Perkin Elmer Thermal Cycler using `AmpliTaq Gold' polymerase (Perkin Elmer). Reaction conditions were as follows: 94°C for 12 min for initial denaturation; 27 cycles of: 94°C for 45 s, 62°C for 30 s, 72°C for 45 s, followed by a final elongation at 72°C for 7 min. Primers L-VEGF-LH (TTCAGGTTCAGGGGGAGGTGT) and U-VEGF-LH (TGCTTCCGGCTCGTATGTTGT) were used. The product of ~150 bp was visualized on the agarose gel with ethidium bromide. A representative gel is shown in Figure 1Go.



View larger version (97K):
[in this window]
[in a new window]
 
Figure 1. Polymerase chain reaction (PCR)-based screening for the presence of the transgene. The product of ~150 bp was visualized on the agarose gel with ethidium bromide. Lanes 1–15 = genomic DNA samples from different specimens, lane M = molecular weight marker. Mice 2, 3, 4, 13, and 14 were positive.

 
For 25 µl of PCR reaction ~0.4 µg of total genomic DNA, 0.2 µl of 5 IU/µl Perkin Elmer `Ampli-Taq Gold' polymerase, and 1 µl of the 25 mmol/l MgCl2 solution were used. Problems with sample cross-contamination and false-positives did not occur.

Histopathology
The testicular samples were weighed, dissected and then fixed, one half in 10% neutral buffered formalin and the other half in Bouin's solution (for optimal morphological preservation). Standard processing and embedding in paraffin followed. Sections (4 µm) were taken for histological examination, and stained with either haematoxylin and eosin (Sigma) or Feulgen's method for DNA staining (highlighting spermatozoa).

Testes were assessed according to guidelines for the evaluation of human infertility (Pesce, 1987Go). In order to more objectively assess spermatogenesis and spermiogenesis, a minimum of 50 tubular cross sections were examined using a modification of the Johnsen scoring index (Johnsen, 1970Go).

In-situ hybridization
Tissues were fixed in neutral-buffered formalin and embedded in paraffin. An antisense human VEGF (121 isoform) riboprobe was synthesized by T7 RNA polymerase using [35S]-UTP (800 Ci/mmol, Amersham, UK) and was used without hydrolysis. The probe was tested on VEGF transfected MCF-7 xenograft sections and human breast carcinoma controls. Wild-type CBAxC57BL/6 mice (genetic background of the transgenics) were used as a negative control. The protocols for pre-treatment, hybridization, washing and dipping of slides in Ilford K5 for autoradiography were basically as described for formalin-fixed paraffin-embedded tissues (Senior et al., 1988Go), with modifications (Poulsom et al., 1998Go). The presence of hybridizable mRNA in all compartments of the tissues studied was established in parallel sections using an antisense rat ß-actin probe. Autoradiography was performed at 4°C (two exposures per section, after 10 and 18 days for the VEGF probe, and after 10 days for the ß-actin probe), before developing in Kodak D19 and counterstaining with Giemsa. Sections were examined under conventional or reflected light dark-field conditions (Olympus BH2 with epi-illumination) that allowed individual autoradiographic silver grains to be seen as bright objects on a dark background. The intensity of staining was scored by two independent pathologists as: +++ = intense, ++ = strong, + = weak staining.

There have been several studies using in-situ hybridization on testis that have been misinterpreted by non-specific binding to `residual bodies'. This has not been seen in this study either with the VEGF probe, or the positive and negative controls.

Preparation of tissue extracts and determination of VEGF protein
Tissues were dissected from transgenic and control CBAxC57BL6 mice of both sexes and snap-frozen in liquid nitrogen. The tissues were finely minced with a scalpel, then pulverized under liquid nitrogen using a chilled pestle and mortar. The powered tissue was weighed and suspended in ice-cold homogenization buffer at a concentration of 1 g of tissue in 10 ml buffer (20 mmol/l HEPES pH 7.4, 1.5 mmol/l EDTA, 0.5 mmol/l phenylmethylsulphonylfluoride, 0.5 mmol/l benzamidine, 10 µg/ml ovomucoid trypsin inhibitor). The tissue powder was homogenized for 30 s with an IKA ultraturrax homogenizer (Janke & Kunkel, Staufen, Germany) and then centrifuged for 10 min at 3000 rpm at 4°C. The supernatant was carefully removed and centrifuged for 40 min at 37 5000 rpm at 4°C. After centrifugation, the protein content of the supernatant was determined by the bicinchonic acid protein assay (Pierce & Warriner, Chester, Cheshire, UK). Human VEGF levels were determined in the supernatants by an enzyme-linked immunosorbent assay (ELISA) (R&D Systems).

Examination of day 12 embryos
Two transgenic females were mated with the same genetic background (CBAxC57BL/6) males, three CBAxC57BL/6 females were mated with transgenic males and, as a negative control, three CBAx C57BL/6 females were mated with CBAxC57BL/6 males. On day 12, pregnant females were killed and dissected. The overall appearance of the uterus and embryos and the degree of vascularization were examined. Uterine fragments, embryos and ovaries were fixed overnight in neutral-buffered formalin and paraffin-embedded for further examination.

Detection of apoptosis (TUNEL assay)
A TdT-FragEL DNA Fragmentation Detection Kit (Calbiochem) was used for TUNEL assay. The protocol provided with the kit was followed. Briefly, paraffin-embedded formalin-fixed sections were deparaffinized, rehydrated and then proteinase K treated. Fragmented DNA was labelled with terminal deoxynucleotidyl transferase and biotin-dNTPs. The streptavidin-HRP/DAB system was used to visualize the signal.

Statistical analysis
Data were analysed by the SPSS for Windows package (Release 9.0). The t-test for equality of means was used to calculate the statistical significance of mean litter size and sex ratio changes.

Results

Confirmation of VEGF (121 isoform) expression from the mucin promoter–VEGF121 construct in human embryonic kidney cells
Expression of VEGF from the construct in pNASSß was confirmed by transient transfection into human embryonic kidney 293T cells. VEGF expression was measured by ELISA of media supernatants (human VEGF ELISA kit, R&D). The concentration of VEGF in the 2 day conditioned medium was 7.5 ng/ml, whereas controls had <10 pg/ml (lower limit of detection).

Embryonic injections and establishment of heterozygous lines
Three rounds of embryonic injections were performed yielding 10 transgenic founders: five males and five females. Two of the five male founders were fertile. Each of the other three males failed to fertilize several (four) different females. On examination, the epididymis held no mature spermatozoa. The other founders, including two fertile males, transmitted the transgene in Mendelian fashion and were used to establish distinct heterozygous breeding lines.

Litters show a female preponderance
There was an altered sex ratio of approximately three females to two males in litters of the heterozygous VEGF (121 isoform) transgenic lines. The skew was statistically significant (P = 0.015 (Table IGo). Fluorescence in-situ hybridization (FISH) analysis of chromosome spreads was carried out on mice from the two 1152 lines. The human probe gave a low background signal suggesting little if any hybridization to homologous murine VEGF sequences. However, the probe hybridized strongly to a unique site in each founder line, chromosome X C1-D in line 1152A and chromosome 9 A1–A3 in line 1152B. This confirmed that the altered sex ratio was not a consequence of the chromosomal site of insertion of the transgene. The alteration in the sex ratio of the litters was present independently of whether the transgene was carried by the male (P = 0.026) or female (P = 0.013) parent. 50 mice were sex-typed using SRY gene specific PCR primers to confirm that no false-females were present (genetic males with a female phenotype).


View this table:
[in this window]
[in a new window]
 
Table I. Sex ratio skew in litters of muc1-VEGF transgenic mice lines. 31 litters were bred from lines founded by mice 1152A and 1152B. There was a highly significant (P = 0.015) female bias in litters from both lines: 59% females in 1152A and 59.7% females in 1152B. The bias was integration independent since transgene integration sites in both of these lines were different (chromosome X for 1152A and chromosome 9 for 1152B). Line 1152B showed a marked reduction in mean litter size (4.7 versus 9.3 in line 1152A, P < 0.001).
 
Detection of the human VEGF transgene by in-situ hybridization and ELISA assay
Muc-1 expression is normally restricted to the apical surface of secretory epithelium in several organs. In the muc1-VEGF (121 isoform) mice, expression of the transgene followed a similar, but not identical, pattern to that of the endogenous mouse polyepithelial mucin gene (Table IIGo, Figure 2Go). The human VEGF probe did not detect the endogenous mouse VEGF gene in control mice when used under identical conditions. For example, VEGF mRNA expression was seen in the salivary gland acinar cells and the islets of Langerhans. Endogenous muc-1 is absent in these cells. Differences probably arise from the use of a truncated promoter. Strong expression was detected in spermatocytes but not spermatogonia, Leydig or Sertoli cells (Figure 3Go). ELISA of human VEGF in tissue extracts showed expression in a range of tissues, with a wide variation in level of expression (Figure 4Go). Expression in the testis was highest.


View this table:
[in this window]
[in a new window]
 
Table II. Human VEGF (121 isoform) transgene expression was detected throughout epithelial tissues of muc1-VEGF (121 isoform) transgenics
 


View larger version (167K):
[in this window]
[in a new window]
 
Figure 2. In-situ hybridization of human VEGF demonstrates transgene expression in a range of epithelial tissues. Paired conventional and dark-field micrographs. (A, D) Salivary gland: expression was seen in mucous cells and ductal epithelium (D) but not in large vessel endothelium (V). (B, E) Duodenum; expression was detected in the epithelium of Brunner's glands (B) and in some epithelial cells on the surface of villi. (C, F) Pancreas; expression was detected within the islets of Langerhans and a few duct epithelial cells (arrow). (G, J) Lung: expression appeared restricted to Clara cells. (H, K) Uterus; expression was detected in the epithelium. (L) Testis; expression was detected in developing spermatocytes/spermatids within the tubules, and not in the Leydig cells (L).

 


View larger version (98K):
[in this window]
[in a new window]
 
Figure 3. In-situ hybridization of human VEGF in testes showing expression in spermatocytes but not spermatogonia or Leydig cells.

 


View larger version (13K):
[in this window]
[in a new window]
 
Figure 4. Expression of human VEGF protein in tissues of muc1-VEGF transgenic mice. Expression of VEGF protein showed a similar pattern to RNA expression. The highest level of VEGF protein was detected in the testis. Human VEGF protein was not detected in control mice.

 
Examination of day 12 transgenic embryos
Resorbed embryos (21% of the total) were present in the muc1-VEGF (121 isoform) femalexbackground male, and background femalexmuc1-VEGF (121 isoform) male crosses. Growth of several surviving embryos appeared retarded when compared with other embryos in the same uterus, as well as to the embryos in the control group (2–4 versus 5–6 mm). These results are summarized in Table IIIGo. Histopathological examination revealed extensive areas of necrosis in the resorbed embryos. Areas of infarction bounded by apoptosis were present within the spongiotrophoblast, and the trophoblast–decidual interface frequently contained clusters of apoptotic cells.


View this table:
[in this window]
[in a new window]
 
Table III. Examination of embryos after normal and transgenic crosses
 
Detection of Flk and Flt-1 VEGF receptors in placenta (day 12)
Placentas on embryonic day 12 were examined by in-situ hybridization for the expression of the Flt-1 and Flk receptors. In accord with previous reports (Breier et al., 1995Go; Marti and Risau, 1998Go), Flt-1 was exceptionally strongly expressed in the giant cell/spongiotrophoblast layer (Figure 5Go). Marginal giant cells did not express Flt-1, i.e. it was restricted to the central cells. Also in agreement with the previously published data, Flk was expressed weakly and only in the labyrinthine placenta (Figure 5Go).



View larger version (208K):
[in this window]
[in a new window]
 
Figure 5. In-situ hybridization analysis of placentae on embryonic day 12. Paired conventional and dark field micrographs. (A, B) Weak Flk expression in the labyrinthine placenta. (C, D) Very strong Flt-1 expression in the giant cell/spongiotrophoblast layer. Expression appears to be restricted to the central cells i.e. marginal giant cells do not express Flt-1. (E, F) ß-actin positive control for the presence of mRNA.

 
Examination of testes by histopathology, electron microscopy and TUNEL apoptosis assay
Testes of muc1-VEGF (121 isoform) transgenic mice showed partial or complete sperm maturation arrest, disorganization of the germ cells within the seminiferous tubules (Figure 6Go) and an increase in apoptosis of spermatocytes (Figure 7Go). The disorganization of the testis showed a gradation in severity across male founders and different lines derived from founders. The most severe phenotype was shown by the three infertile male founders. Testes were visibly atrophic, with an estimated reduction in volume of ~50%. This was attributable to reduced tubular cross-sectional area as seen in human infertile atrophic testes, giving rise to a relative but not disproportionate increase in the interstitial cross-sectional area. Mature spermatozoa were absent from testicular sections and the epididymis. In-situ hybridization studies showed strong expression of the transgene in differentiating spermatocytes but the expression was not detected in spermatogonia or Sertoli cells. Electron microscopic studies were consistent with a loss of adhesion between differentiating spermatocytes and the Sertoli cell architecture (Figure 8Go). Male mice from other lines, such as the 1152A and 1152B lines described here, showed a less severe phenotype. In this case, mature spermatozoa were present but at a greatly reduced level. Male mice fathered litters but sporadically and litters were invariably small (between 1 and 4 mice). While epididymal histology appeared normal, sperm cells in the epididymis were mixed with large quantities of immature precursors, dead cells and cellular debris (Figure 6Go). No apoptotic cells were detected by TUNEL assay in the epididymis. Testosterone concentrations and meiosis were normal.



View larger version (128K):
[in this window]
[in a new window]
 
Figure 6. Spermiogenic arrest and seminiferous tubule disorganization in muc1-VEGF (121 isoform) transgenic mice. (Top) Haematoxylin and eosin stain of wild type seminiferous tubule showing good organization with large peripheral spermatogonia, a dense palisaded layer of spermatocytes and spermatids and mature spermatozoa in the lumen of the tubule (left). Feulgen stain (centre) highlights the spermatozoa and renders them easier to identify. The epididymal tubules (right) contain only mature spermatozoa. (Middle) Transgenic seminiferous tubule showing a disorganized structure with few spermatocytes or spermatogonia: Johnsen score 4 (left). The absence of spermatozoa was confirmed by Feulgen staining (centre). The epididymal tubules contained few spermatozoa and large amounts of cellular debris (right). (Lower) Seminiferous tubules with decreasing levels of maturation and increasing disorganization (Johnsen scores of 8, 7 and 6 from left to right).

 


View larger version (69K):
[in this window]
[in a new window]
 
Figure 7. Detection of apoptosis in the testis of muc1-VEGF (121 isoform) and control mice (CBAxC57BL/6). Apoptotic cells show black. (A) Control male showing normal testicular morphology. (B) Subfertile transgenic male with a moderate degree of disorganization. (C) An infertile transgenic male.

 


View larger version (108K):
[in this window]
[in a new window]
 
Figure 8. Representative electron micrographs illustrating loss of adhesion between spermatogenic cells in the testis of the muc1-VEGF (121 isoform) transgenic mice. (A) Control mouse (original magnification x2500): the structure was tight showing contact between membranes of cells. (B) Muc1-VEGF (121 isoform) transgenic mice: the structure was disorganized with less contact between cell membranes (original magnification x2500).

 
Discussion

Transgenic muc-1 promoter-VEGF (121 isoform) mice have been engineered and shown by in-situ hybridization to express the transgene in a wide range of epithelial tissues. Despite widespread expression of the transgene, physiological changes were apparent only within the reproductive system. Two major phenotypic changes were observed: (i) aberrant placentation, embryonic resorptions, and small litters showing a skewed sex ratio of three females to two males; and (ii) perturbed spermiogenesis leading to either reduced or complete infertility.

The small litter size and a skew in the sex ratio (Table IGo) prompted an examination of embryos in transgenic crosses at embryonic day 12, i.e. when the structure of the mouse placenta is most informative (Kaufman, 1999Go). Of the embryos, ~21% were resorbed and some others pale and retarded in growth (Table IIIGo). No such embryos were seen in control mice. Intravenous administration of exogenous VEGF to normal pregnant mice has been shown to produce a similar result (He et al., 1999Go) supporting the causative role of VEGF.

Since VEGF has vascular permeability activity, its over-expression could induce a breakdown of the maternal–placental barrier with a subsequent immune reaction against the embryos, particularly male embryos since they will appear more foreign to the maternal immune system. Nevertheless, gross leukocyte infiltration of embryos was not detected. Alternatively, toxic metabolites, or maternal hormones penetrating the embryonic tissue could exert a deleterious influence on embryonic development, possibly specific to male embryos in the case of maternal steroid hormones.

Trophoblast cells have been shown before to express Flt-1 (Dumont et al., 1995Go; Clark et al., 1996Go) and Flk-1 has been shown to be present in the labyrinthine layer (Breier et al., 1995Go). Flt-1 is particularly abundant on the giant cells (Figure 5Go). Trophoblast invasion into decidua is crucial for successful placentation and trophoblast growth and migration could be affected by VEGF transgene expression in an autocrine fashion. Spongiotrophoblast cells also secrete soluble Flt-1 in a specific time frame during placentation (He et al., 1999Go). Soluble Flt-1 sequesters VEGF, which suggests that the VEGF concentration is under tight spatial and temporal control during development of the placenta. Transgene expression in the maternal decidua is not the cause of aberrant placentation since the altered sex ratio and embryonic resorptions were seen independently of whether the transgene was carried by the male or female parent. Thus, VEGF transgene expression in the embryonic component of the placenta must be the underlying cause of the losses. Further studies are needed.

Expression of VEGF in normal testes, prostate and seminal vesicles, and its high concentration in semen (200–500 pmol/l) first suggested that VEGF could play a role in male reproductive physiology. VEGF levels in seminal plasma measured by ELISA assay were even greater than those in malignant effusions (Brown et al., 1995Go). VEGF is known to be present in the seminiferous tubule in normal mice where it is secreted by the Sertoli cells (Ergun et al., 1997Go). More recently, the VEGF concentration in semen has been shown to be a strong male factor predictive of pregnancy success following IVF (Obermair et al., 1999Go). High and low VEGF in human semen, i.e. >100 and <2 ng/ml respectively, is correlated with lack of pregnancy success.

Muc1-VEGF (121 isoform) mice show a disruption in sperm maturation (Figure 6Go). The extent of testicular disruption varied between different transgenic lines. Mice were either infertile or showed markedly reduced fertility. Subfertile males showed a minor to medium degree of tubular disorganization and maturation arrest, while in the epididymis spermatozoa were mixed with large quantities of immature precursors, cellular debris and dead cells.

Other work has shown that VEGF (165 isoform) transgenic mice with transgene expression under control of the MMTV promoter show male infertility (Korpelainen et al., 1998Go). Our studies not only strongly support this work but shed further light on the biology of the infertility. It is useful to compare the pathology shown by the two transgenic lines. No placental rejection was reported for the MMTV-VEGF (165 isoform) mice. muc1-VEGF (121 isoform) male mice were either infertile or sub-fertile, in contrast the MMTV-VEGF (165 isoform) mice were all infertile. This former observation is presumably because the MMTV promoter is not active in the placenta whereas the muc-1 promoter is.

The degree of fertility loss may reflect the level of expression of the transgene in the testes. The strong MMTV viral promoter will give rise to high expression and infertility. Other pathology was reported in the MMTV-VEGF (165 isoform) mice and has not been seen in muc1-VEGF mice. In particular, the ductus epididymis of MMTV-VEGF (165 isoform) mice was dilated and hyperplastic and the tissue was leaky as evidenced by extravasation of fibrinogen. The reabsorption of fluid in the epididymis concentrates the sperm cells and is essential for their survival and maturation. Thus, male oestrogen receptor-{alpha} knockout mice are infertile due to defective epididymal fluid reabsorption both leading to accumulation of fluid and damage to spermiogenesis (Eddy et al., 1996Go; Hess et al., 1997Go). It was proposed that the same effect could account (in part) for the infertility in the VEGF transgenic mice. However, the fact that the epididymis is normal in muc1-VEGF (121 isoform) mice rules out this possibility. Rather, the effects on spermatozoa are direct; this is supported by the recent finding that the Flk and Flt-1 receptors are present on spermatocytes (Marti and Risau, 1998Go) and mature spermatozoa (Obermair et al., 1999Go).

VEGF is normally present in the healthy testis where it is likely to play a role in sperm maturation. Thus, VEGF is not normally expressed by germ cells but is present in the seminiferous tubule due to expression by Sertoli cells (Ergun et al., 1997Go). We propose that the aberrant spermiogenesis in the muc1-VEGF mice is due to the high level of expression of the human transgene in the testis (Figure 4Go). Histological and electron microscopic studies suggest that the aberrant spermiogenesis could be due to a loss of adhesion between differentiating spermatocytes and the Sertoli cell architecture (Figures 4 and 6GoGo). Subsequent spermatocyte shedding leads to the appearance of immature sperm precursors in the epididymides.

A marked increase in apoptosis was seen in the spermatogenic cells of the transgenic mice (Figure 7Go). Apoptosis was correlated with the extent of disruption of cellular adhesion within the tubule and the degree of infertility. It is difficult to judge whether apoptosis was a primary cause of spermiogenesis arrest or merely a secondary effect of tubular disorganization. It has been reported that germ cell apoptosis can be induced by oestradiol treatment of male rats (Blanco-Rodriguez and Martinez-Garcia, 1996Go) and that apoptosis precedes germ cell detachment from the seminiferous epithelium in that model (Blanco-Rodriguez and Martinez-Garcia, 1998Go). However, apoptotic cells were not found in the epididymides of our mice, suggesting that the loss of adhesion is independent of apoptosis.

Morphology and ultrastructure of endothelial cells within the testicular blood vessels of the transgenics were examined by electron microscopy. No convincing increase in the vessel density, quantity of transcytotic vesicles or in endothelial fenestrations were detected (data not shown). Thus, infertility caused by VEGF over-expression in the testis is likely to be a direct result of the action of VEGF on spermiogenesis, rather than to be secondary to an effect on endothelial cells.

It is interesting that effects on reproductive biology should be the only consequence of VEGF over-expression in a broad spectrum of epithelial tissues. We propose that angiogenesis in somatic tissues is strongly suppressed and an additional angiogenic stimulus is easily attenuated by endogenous inhibitors (Oehler and Bicknell, 2000Go). Only in reproductive tissues, where VEGF is constantly produced and necessary for normal physiology, can its over-expression shift the balance and induce a pathological phenotype.

Acknowledgments

We are grateful to Tracy Crafton, ICRF Clare Hall, London for the breeding and daily care of the transgenic mice; Ian Rosewell, ICRF Clare Hall, London for conducting embryo injections and embryo transfers; Ian Longcroft and Rosemary Jeffery, ICRF Lincoln's Inn Fields, for assistance with the in-situ hybridization studies; Gillian Hutchinson ICRF Lincoln's Inn Fields, London for assistance with work involving mouse embryos, Dr Veronica Buckle, Institute of Molecular Medicine, Oxford for performing the FISH analysis, Dr Hugo Marti, Bad Neuheim, Germany for the Flt-1 and Flk in-situ probes, Dr Carol Upton ICRF Lincoln's Inn Fields, London for electron microscopy studies, and Dr Mark O'Sullivan, Imperial College, London for assistance in the interpretation of the in-situ analysis of placental gene expression. This work was supported by the Imperial Cancer Research Fund.

Notes

5 To whom correspondence should be addressed. E-mail: r.bicknell{at}icrf.icnet.uk Back

References

Blanco-Rodriguez, J. and Martinez-Garcia, C. (1996) Induction of apoptotic cell death in the seminiferous tubule of the adult rat testis: assessment of the germ cell types that exhibit the ability to enter apoptosis after hormone suppression by oestradiol treatment. Int. J. Androl., 19, 237–247.[Web of Science][Medline]

Blanco-Rodriguez, J. and Martinez-Garcia, C. (1998) Apoptosis precedes detachment of germ cells from the seminiferous epithelium after hormone suppression by short-term oestradiol treatment of rats. Int. J. Androl., 21, 109–115.[Web of Science][Medline]

Braga, V.M. and Gendler, S.J. (1993) Modulation of Muc-1 mucin expression in the mouse uterus during the estrus cycle, early pregnancy and placentation. J. Cell Sci., 105, 397–405.[Abstract]

Braga, V.M., Pemberton, L.F., Duhig, T. et al. (1992) Spatial and temporal expression of an epithelial mucin, Muc-1, during mouse development. Development, 115, 427–437.[Abstract]

Breier, G., Clauss, M. and Risau, W. (1995) Coordinate expression of vascular endothelial growth factor receptor-1 (flt-1) and its ligand suggests a paracrine regulation of murine vascular development. Dev. Dyn., 204, 228–239.[Web of Science][Medline]

Brown, L.F., Yeo, K.T., Berse, B. et al. (1995) Vascular permeability factor (vascular endothelial growth factor) is strongly expressed in the normal male genital tract and is present in substantial quantities in semen. J. Urol., 154, 576–579.[Web of Science][Medline]

Carmeliet, P., Ferreira, V., Breier, G. et al. (1996) Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele. Nature, 380, 435–439.[Medline]

Carson, D.D., DeSouza, M.M. and Regisford, E.G. (1998) Mucin and proteoglycan functions in embryo implantation. Bioessays, 20, 577–583.[Web of Science][Medline]

Clark, D.E., Smith, S.K., Sharkey, A.M. et al. (1996) Localization of VEGF and expression of its receptors flt and KDR in human placenta throughout pregnancy. Hum. Reprod., 11, 1090–1098.[Abstract/Free Full Text]

DeLoia, J.A., Krasnow, J.S., Brekosky, J. et al. (1998) Regional specialization of the cell membrane-associated, polymorphic mucin (MUC1) in human uterine epithelia. Hum. Reprod., 13, 2902–2909.[Abstract/Free Full Text]

Dumont, D.J., Fong, G.H., Puri, M.C. et al. (1995) Vascularization of the mouse embryo: a study of flk-1, tek, tie, and vascular endothelial growth factor expression during development. Dev. Dyn., 203, 80–92.[Web of Science][Medline]

Eddy, E.M., Washburn, T.F., Bunch, D.O. et al. (1996) Targeted disruption of the estrogen receptor gene in male mice causes alteration of spermatogenesis and infertility. Endocrinology, 137, 4796–4805.[Abstract]

Ergun, S., Kilic, N., Fiedler, W. et al. (1997) Vascular endothelial growth factor and its receptors in normal human testicular tissue. Mol. Cell. Endocrinol., 131, 9–20.[Web of Science][Medline]

Ferrara, N. (1999) Molecular and biological properties of vascular endothelial growth factor. J. Mol. Med., 77, 527–543.[Web of Science][Medline]

Ferrara, N., Carver-Moore, K., Chen, H. et al. (1996) Heterozygous embryonic lethality induced by targeted inactivation of the VEGF gene. Nature, 380, 439–442.[Medline]

Gross-Bellard, M., Oudet, P. and Chambon, P. (1973) Isolation of high-molecular-weight DNA from mammalian cells. Eur. J. Biochem., 36, 32–38.[Web of Science][Medline]

He, Y., Smith, S.K., Day, K.A. et al. (1999) Alternative splicing of vascular endothelial growth factor (VEGF)-R1 (FLT-1) pre-mRNA is important for the regulation of VEGF activity. Mol. Endocrinol., 13, 537–545.[Abstract/Free Full Text]

Hess, R.A., Bunick, D., Lee, K.H. et al. (1997) A role for oestrogens in the male reproductive system [see comments]. Nature, 390, 509–512.[Medline]

Johnsen, S.G. (1970) Testicular biopsy score count–a method for registration of spermatogenesis in human testes: normal values and results in 335 hypogonadal males. Hormones, 1, 2–25.[Medline]

Kaufman, M.H. (1999) The Atlas of Mouse Development. 3rd revised edn. Academic Press, San Diego, CA, USA.

Korpelainen, E.I., Karkkainen, M.J., Tenhunen, A. et al. (1998) Over-expression of VEGF in testis and epididymis causes infertility in transgenic mice: evidence for non-endothelial targets for VEGF. J. Cell. Biol., 143, 1705–1712.[Abstract/Free Full Text]

Marti, H.H. and Risau, W. (1998) Systemic hypoxia changes the organ-specific distribution of vascular endothelial growth factor and its receptors. Proc. Natl Acad. Sci. USA, 95, 15809–15814.[Abstract/Free Full Text]

Obermair, A., Obruca, A., Pohl, M. et al. (1999) Vascular endothelial growth factor and its receptors in male fertility. Fertil. Steril., 72, 269–275.[Web of Science][Medline]

Oehler, M.K. and Bicknell, R. (2000) The promise of anti-angiogenic cancer therapy. Br. J. Cancer, 82, 749–752.[Web of Science][Medline]

Parry, G., Li, J., Stubbs, J., Bissell, M.J. et al. (1992) Studies of Muc-1 mucin expression and polarity in the mouse mammary gland demonstrate developmental regulation of Muc-1 glycosylation and establish the hormonal basis for mRNA expression. J. Cell Sci., 101, 191–199.[Abstract/Free Full Text]

Pesce, C.M. (1987) The testicular biopsy in the evaluation of male infertility. Semin. Diagn. Pathol., 4, 264–274.[Web of Science][Medline]

Poulsom, R., Longcroft, J.M., Jeffery, R.E. et al. (1998) A robust method for isotopic riboprobe in situ hybridisation to localise mRNAs in routine pathology specimens. Eur. J. Histochem., 42, 121–132.[Web of Science][Medline]

Senior, P.V., Critchley, D.R., Beck, F. et al. (1988) The localization of laminin mRNA and protein in the postimplantation embryo and placenta of the mouse: an in situ hybridization and immunocytochemical study. Development, 104, 431–446.[Abstract/Free Full Text]

Zhang, H.T., Craft, P., Scott, P.A. et al. (1995) Enhancement of tumor growth and vascular density by transfection of vascular endothelial cell growth factor into MCF-7 human breast carcinoma cells. J. Natl Cancer Inst., 87, 213–219.[Abstract/Free Full Text]

Zhang, H.T., Scott, P.A., Morbidelli, L. et al. (2000) The 121 amino acid isoform of vascular endothelial growth factor is more strongly tumorigenic than other splice variants in vivo. Br. J. Cancer, 83, 63–68.[Web of Science][Medline]

Submitted on July 6, 2000; accepted on December 19, 2000.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Biol. Reprod.Home page
R. C. Bott, R. M. McFee, D. T. Clopton, C. Toombs, and A. S. Cupp
Vascular Endothelial Growth Factor and Kinase Domain Region Receptor Are Involved in Both Seminiferous Cord Formation and Vascular Development During Testis Morphogenesis in the Rat
Biol Reprod, July 1, 2006; 75(1): 56 - 67.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. H. Rudolfsson, P. Wikstrom, A. Jonsson, O. Collin, and A. Bergh
Hormonal Regulation and Functional Role of Vascular Endothelial Growth Factor A in the Rat Testis
Biol Reprod, February 1, 2004; 70(2): 340 - 347.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. H. Rudolfsson, A. Johansson, I. Franck Lissbrant, P. Wikstrom, and A. Bergh
Localized Expression of Angiopoietin 1 and 2 May Explain Unique Characteristics of the Rat Testicular Microvasculature
Biol Reprod, October 1, 2003; 69(4): 1231 - 1237.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow An erratum has been published
Right arrow An erratum has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (11)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Huminiecki, L.
Right arrow Articles by Bicknell, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huminiecki, L.
Right arrow Articles by Bicknell, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?