Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (46)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Adham, I. M.
Right arrow Articles by Engel, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Adham, I. M.
Right arrow Articles by Engel, W.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Human Reproduction, Vol. 7, No. 6, 513-520, June 2001
© 2001 European Society of Human Reproduction and Embryology


Testis and spermatogenesis

Teratozoospermia in mice lacking the transition protein 2 (Tnp2)

Ibrahim M. Adham1, Karim Nayernia1, Elke Burkhardt-Göttges1, Özlem Topaloglu1, Christa Dixkens1, Adolf F. Holstein2 and Wolfgang Engel1,3

1 Institute of Human Genetics, University of Göttingen, D-37073 Göttingen and 2 Department of Anatomy, Eppendorf University Hospital, D-20251 Hamburg, Germany

Abstract

It is believed that the transition proteins (Tnp1 and Tnp2) participate in the removal of the nucleohistones and in the initial condensation of the spermatid nucleus. Later in spermatogenesis, Tnp1 and Tnp2 are replaced by the protamines 1 and 2. In an effort to elucidate the physiological role of Tnp2, we have disrupted its locus by homologous recombination. Breeding of the Tnp2–/– males on different genetic backgrounds revealed normal fertility on the mixed background C57BL/6Jx129/Sv, but total infertility on the inbred 129/Sv background. Light and electron microscopy showed that the germ cells were capable of undergoing chromatin condensation, although many spermatozoa exhibited head abnormalities with acrosomes not attached to the nuclear envelope. Furthermore, migration of Tnp2–/– spermatozoa from the uterus into the oviduct was reduced. These results suggest that male infertility of the Tnp2–/– mice is a result of sperm head abnormalities and reduced sperm motility. The increased level of the Tnp1 transcript in testes of the Tnp2-deficient mice raises the possibility that a deficiency created through the disruption of the Tnp2 gene can be compensated for by recruitment of the Tnp1.

acrosome/chromatin condensation/genetic background/teratozoospermia/Tnp2

Introduction

After the meiotic division, the germ cells enter spermiogenesis, the haploid phase of spermatogenesis, where round spermatids differentiate into elongated spermatids and ultimately spermatozoa. One of the morphological changes that accompany spermatid differentiation is the nuclear organization of the male germ cell (Fawcett et al., 1971Go; Dooher and Bennett, 1973Go). During this process, various modifications occur in the nature of proteins associated with the DNA and the result is the progressive condensation of the chromatin. This morphological transformation induces the gradual displacement of testis-specific and remaining somatic histones by transition proteins 1 and 2 (Tnp1 and Tnp2) which are thought to participate in the initial condensation of the spermatid nucleus. Shortly thereafter, the transition proteins are replaced by the protamines Prm1 and Prm2, which are characteristic for the mature sperm nucleus (Balhorn et al., 1984Go). Immunostaining of rat testis with Tnp1, Tnp2 and Prm1 antisera has shown that the appearance of the Tnp2 in the spermatid nucleus precedes that of Tnp1 and Prm1. Tnp2 is found diffusely distributed over the anterior tip of the nuclei in step 10 spermatids and remains localized over the more anterior portion of the nucleus even in step 13 spermatids where it is at its maximum concentration. Ultrastructural studies have shown that chromatin condensation occurs between steps 12 and 14, starting at the anterior portion of the nucleus and then spreading gradually towards the posterior region (Dooher and Bennett, 1973Go). Thus, the first reactivity of Tnp2 appears at that time when the chromatin still has a fibrillar and lightly stained structure at steps 10–11 (Kistler et al., 1996Go).

The nucleoprotein genes Tnp2, Prm1 and Prm2 are closely linked in a stretch of DNA, 13-15 kb long, on human chromosome 16p13.3 and on mouse chromosome 16 (Schlüter et al., 1992Go; Nelson and Krawetz, 1994Go). In this cluster, a new member of the protamine family (Prm3) has been identified and characterized (Schlüter and Engel, 1995Go; Schlüter et al., 1996Go). Tnp1 is the only gene encoding germ cell-specific nucleoproteins which is localized on a separate chromosome.

The Tnp2 protein, a 117 amino acid long molecule, contains a basic domain and two proposed zinc finger motifs at the amino and carboxyl regions, respectively (Baskaran and Rao, 1991Go). These two domains may be responsible for the interaction of the Tnp2 with the DNA. The considerable sequence variation in the primary structure of Tnp2 between species leads one to believe that Tnp2 is involved in the establishment of species-specific sperm nucleus morphology (Fawcett et al., 1971Go; Kleene and Flynn, 1987Go; Luerssen et al., 1989Go; Reinhardt et al, 1991Go; Keime et al., 1992Go; Alfons and Kistler, 1993). However, the first appearance of Tnp2 in nuclei of elongated spermatids which have essentially completed the morphological changes of the nuclear shaping and which are undergoing chromosomal condensation rules out the role of Tnp2 in determination of the nuclear morphology (Fawcett et al., 1971Go; Dooher and Bennett, 1973Go; Alfons and Kistler, 1993; Oko et al., 1996Go).

To investigate the role of Tnp2 in the differentiation and function of the male germ cell, we have generated mice containing a targeted disruption of the Tnp2 gene. Male infertility was associated with the homozygous mutation on an inbred (129/Sv) genetic background, but fertility was not affected in Tnp2-deficient mice on a mixed (C57 BL/6Jx129/Sv) genetic background. To determine the underlying cause for male infertility, we have examined several parameters of sperm function. The cumulative results presented here showed that the deficiency of Tnp2 leads to sperm head abnormalities which are most probably due to malformations in the attachment of the acrosome to the nuclear involvement. The acrosomal defects appeared to influence the acrosome reaction and the ability of the spermatozoa to penetrate the zona pellucida of the oocyte. In addition, the migration of the spermatozoa through the female genital tract was found to be impaired.

Materials and methods

Generation of the Tnp2-mutant mice
A P2 clone carrying the mouse Tnp2 gene was isolated from the C129/ES cell library (Genome Systems, Cambridge, UK) by polymerase chain reaction (PCR) screening (Schlüter et al., 1996Go). A 6.3 kb EcoRI fragment and a 3.6 kb EcoRI/XbaI fragment, together containing the closely linked Prm2, Prm3 and Tnp2 genes, were subcloned into pBluescript vector (Stratagene, La Jolla, USA) and mapped with restriction enzymes (Figure 1AGo). A targeting vector was designed for insertion of a neomycin-resistance gene driven by a PGK promoter (pgk-neo) into the SstII site of exon1. A herpes simplex virus thymidine kinase gene (tk) cassette was attached to the 3' end for negative selection (Figure 1AGo). Linearized plasmid DNA (30 µg) was electroporated into R ES cells (Joyner, 1993Go). Colonies resistant to G418 (400 µg/ml) and gancyclovir (GANC) (2 µmol/l) were selected.



View larger version (41K):
[in this window]
[in a new window]
 
Figure 1. Targeted disruption of the Tnp2 gene. (A) Restriction map of the genomic fragment containing the closely linked Prm2, Prm3, Tnp2 and Socs-1 genes, the targeted vector and the predicted restriction map after the homologous recombination. The probe used and the predicted length of restriction fragments in the Southern blot analysis are shown. Primers 1, 2 and 3 used to amplify the wild-type and mutant alleles by polymerase chain reaction are indicated. A pgk-neo cassette was inserted in exon 1 of the Tnp2 gene. TK, Thymidine kinase cassette, E, EcoRI; S, SstII; S*, disturbed SstII; X, XbaI. (B) Southern blot analysis of the transfected ES clones. Genomic DNA extracted from ES clones was digested with EcoRI and probed with the 3' probe indicated in (A). The wild-type Tnp2 allele generates a 5.4 kb EcoRI fragment, whereas the targeted allele yields a 7 kb EcoRI fragment, as indicated in (A) and (B). (C) Testicular RNA of the three genotypes was analysed using the Tnp2 cDNA and the neomycin gene as probes. (D) Western blot analysis of basic nuclear proteins from wild-type (+/+), heterozygous (+/-) and knockout (–/–) mice were incubated with an anti-Tnp2 and anti-histone H1.1 antiserum. The immunoreactive Tnp2 protein was detectable in wild-type and heterozygous, but not in knockout, mouse samples.

 
Genomic DNA was extracted from ES cells, digested with EcoRI, electrophoresed and blotted onto Hybond N membranes (Amersham, Braunshweig, Germany). The blots were hybridized with a 32P-labelled 1.8 kb XbaI/EcoRI fragment (Figure 1BGo) at 65°C overnight and washed twice at 65°C to final stringency at 0.2xstandard saline citrate/0.1% sodium dodecyl sulphate (SDS). To confirm a correct homologous recombination event of the targeted Tnp2 gene and the absence of additional random integration of the targeting construct, a neomycin fragment was used to rehybridize the Southern blots. Among the G418 and GANC resistance colonies, four independent ES clones were selected and then injected into C57BL/6J blastocysts to produce chimeric animals (Joyner, 1993Go). One line yielded germ-line transmitting chimeras. The chimeric male was mated to C57BL/6J and 129/Sv females, respectively, and F1 offspring were genotyped by PCR analyses. Heterozygous animals were crossed to obtain homozygous mice, which were genotyped by PCR. PCR was performed according to standard protocols to discriminate wild-type and mutant alleles in the DNA from mouse tails. Primer sequences were as follows: 1 (Tpn2 sense), 5'- AACCAGTGCAATCAGTGCACC; 2 (Tpn2 antisense), 5'- ATGGACACAGGAACATCCTGG; 3 (Pgk antisense), 5'- TCTGAGCCCAGAAAGCGAAGG.

Thermal cycling was carried out for 35 cycles, denaturation at 94°C for 30 s, annealing at 58°C for 30 min, and extension at 72°C for 1 min. One-fifth of each reaction mixture was electrophoresed on 2% agarose gels and stained with ethidium bromide. Primer pair 1/2 amplified a 353 bp fragment in the heterozygous and wild-type samples, whereas the primer pair 1/3 amplified a 616 bp fragment with the DNA of both heterozygous and homozygous animals.

RNA blot hybridization
Total RNA was extracted from tissues using the RNA Now Kit (ITC Biotechnologies, Heidelberg, Germany) according to the manufacturer's recommendation. The RNA was size fractionated by electrophoresis on a 1% agarose gel containing formaldehyde, transferred to a nylon membrane, and hybridized with a 32P-labelled cDNA fragment, under the same conditions as those used for Southern blot hybridization.

Extraction of basic nuclear proteins and Western blot
Basic nuclear extracts were prepared from mouse testis as described (Alfonso and Kistler, 1993Go). Aliquots (10 µg of protein) of nuclear extract fractions were subjected to 20% polyacrylamide gels containing 0.9 mol/l acidic acid and 6 mol/l urea (Panyim and Chalkley, 1969Go) and the gels were blotted onto nitrocellulose filters. Membranes were then incubated with rabbit Tnp2 antiserum or rabbit H.1.1 antiserum as described (Alfonso and Kistler, 1993Go; Franke et al., 1998Go).

Electron microscopy
Testes and epididymides were fixed with 5% glutaraldehyde in 0.2 mol/l phosphate buffer, postfixed with 2% osmium tetroxide, and embedded in epoxy (Epon) resin. Sections at 70 nm were stained with 1% Toluidine Blue/pyronine.

Analysis of fertility
To assay the fertility of Tnp2/– males on a mixed (C57BL/6Jx126/Sv) and on an inbred (129/Sv) genetic background, sets of 10 Tnp2/– and Tnp2+/+ males of each genetic background from the F2 littermates were mated, each with two CD1 females for 3 months. Females were checked for the presence of vaginal plug and/or pregnancy. Pregnant females were removed to holding cages to allow them to give birth. We counted the number of litters sired from each group of males in the 3-month mating period and the size of the litters was determined.

Furthermore, 8 week old CD1 females were superovulated by i.p. injections of 5 IU pregnant mare serum gonadotrophin (PMSG) (Intergonan 5 IU; Intervet, Tönisvorst, Germany) followed by 5 IU human chorionic gonadotrophin (HCG) (Predalon; 5 IU, Organon, Oberschleißheim, Germany) 46–48 h later, and mated with Tnp2+/+ or Tnp2/– males of 129/Sv genetic background. Oocytes from females with a vaginal plug were isolated. The oviducts were dissected out and flushed in M2 medium (Sigma). The oocytes were treated with M2 containing hyaluronidase (300 ng/ml) to remove the cumulus, washed in M2 and then maintained in M16 (Sigma, Taufkirchen, Germany) for 2–8 h for assessment of the presence of male and female pronuclei. The oocytes were then cultured for a further 48 h in M16 covered with mineral oil to check for progressive development.

Sperm analysis
Epididymides were collected from 3 month old Tnp2+/+ and Tnp2/– males of 129/Sv genetic background and dissected in Tyrode's medium. Sperm number and motility were determined by light microscopy. To examine sperm transport in the female reproductive tract, males were mated with mature CD1 females. Six hours after mating, uteri and oviducts from females with a vaginal plug were flushed with M2 medium, and sperm numbers were counted. To determine the replacement of the somatic histones by protamines in the sperm nucleus, spermatozoa were recovered from cauda epididymidis, centrifuged at 250 g for 5 min, fixed in 3:1 (vol:vol) methanol:acetic acid and stained with Aniline Blue (Dadoune et al., 1988Go). At least 200 spermatozoa from each male were assayed for staining. To examine the acrosome reaction, epididymal spermatozoa were capacitated for 15 h in Tyrode's medium and then incubated for 5 min at 37°C in 5% CO2 in Tyrode's medium plus the calcium ionophore A23187 (20 µmol/l; Sigma). To determine the percentage of spermatozoa that had undergone acrosome reaction, spermatozoa were fixed and stained with Coomassie Brilliant Blue R250 as previously described (Thaler and Cardullo, 1995Go). At least 200 spermatozoa from each male were examined for the presence or absence of the characteristic dark blue acrosomal crescent.

IVF assays
Sexually mature Tnp2+/+ and Tnp2/– males of 129/Sv genetic background were used for the experiments. Female CD1 mice were superovulated. Oocytes were collected 10–12 h after HCG administration and cumulus cells were removed by treatment with hyaluronidase. To remove the zona pellucida, oocytes were treated with acidic Tyrode and washed three times with phosphate-buffered saline as described (Hogan et al., 1986Go). Spermatozoa were isolated from the vas deferens and the cauda epididymis of each male group and capacitated in Tyrode's medium at 37°C for 1.5 h. Spermatozoa (105–106) were added to the oocytes in 400 µl drops of fertilization medium and incubated for 6 h at 37°C in 5% CO2. Using a large bore micropipette, oocytes were washed in M16 and the oocytes were then cultured in M16 as described.

Results

Targeted disruption of the Tnp2 gene in mice
Two genomic fragments, 6.3 and 3.5 kb, containing the closely linked Prm2, Prm3 and Tnp2 genes, were used to construct the Tnp2 targeting vector. A replacement-targeting vector was designed for insertion of the Pgk-neo cassette into exon 1 upstream of the sequence coding for the arginine- and lysine-rich domain of the Tnp2. The Herpes simplex virus thymidine kinase (tk) gene, at the 3'-end of the construct, enabled us to use positive and negative selection (Figure 1AGo) (Mansour et al., 1988Go). R1 ES cells (Joyner, 1993Go) were transfected with the targeting vector and selected for homologous recombination events. Drug resistance clones were selected and DNA was isolated and screened by Southern blot analysis using an external probe. A probe upstream of the targeting construct detected a 5.4 kb EcoRI wild-type fragment and a 7 kb EcoRI recombinant fragment (Figure 1AGo, B). One of four Tnp2+/– ES clones injected into C57BL/6J blastocystes gave rise to chimeric mice that transmitted the Tnp2 mutation into germ-line. Chimeric mice were intercrossed to C57BL/6J and 129/Sv females, respectively, to establish the Tnp2-disrupted allele on a C57BL/6Jx129/Sv hybrid and on a 129/Sv inbred genetic background. In both backgrounds, male and female mice heterozygous for the Tnp2 mutation appeared normal and fertile. Heterozygous animals were mated, and ~25% (56 of 218) of the offspring were homozygous for the mutant allele.

Increased level of Tnp1 expression in Tnp2–/– testis
To confirm that the engineered disruption of Tnp2 by insertion of the Pgk-neo cassette had generated a null mutation, we examined the expression of Tnp2 at the mRNA and the protein level by Northern blot and immunoblot analysis, respectively. Northern blot analysis of RNA derived from testes of different genotypes revealed that the Tnp2–/– mice failed to produce a detectable 0.6 kb Tnp2 mRNA transcript (Figure 1CGo). We then determined whether Tnp2 protein is synthesized in mutant mice. Basic nuclear proteins were prepared from testes and subjected to SDS/polyacrylamide gel electrophoresis and blotted onto nitrocellulose filter. Western blot analysis revealed that polyclonal anti-Tnp2 antibodies detected the protein in wild-type and heterozygous mice. In contrast, no band corresponding to Tnp2 was found in testes of homozygous Tnp2/– mice. Probing the Western blot with the polyclonal H1.1 antiserum revealed equal amounts of the loaded proteins (Figure 1DGo).

The Prm3 and Socs-1 genes are located 1.8 kb upstream and 2.4 kb downstream of the Tnp2 locus respectively. To investigate whether the insertion of the Pgk-neo cassette influenced the expression of these two genes, Northern blot hybridization was performed using Prm3 and Socs-1 cDNA probes. The results showed that the insertion of the Pgk-neo cassette in the Tnp2 locus had no influence on the expression of the closely linked Prm3 and Socs-1 genes (Figure 2AGo, B).



View larger version (54K):
[in this window]
[in a new window]
 
Figure 2. Expression of the Prm3, Socs-1 and Tnp1 gene in testis of the Tnp2/– mice. (A, B) Northern blots with testicular RNA isolated from the three genotypes were hybridized with the Prm3 and Socs-1 cDNA probes respectively (C). Total testicular RNA isolated from 23, 24, 27 and 30 day old Tnp2/– and Tnp2+/+ mice was hybridized with a Tnp1 cDNA fragment. Rehybridization was performed with the human EF-2 cDNA.

 
To verify the Tnp1 expression in testis of Tnp2/– mice, a Northern blot with RNA isolated from testes of different postnatal stages was hybridized with Tnp1 cDNA probes. The Tnp1 mRNA was first detectable in testis of wild-type and Tnp2/– day mice at day 23 of postnatal life. At subsequent developmental stages, the level of Tnp1 mRNA was significantly increased in testis of Tnp2 –/– mice compared to wild-type littermates (Figure 2CGo).

Infertility of the Tnp2–/– males on the 129/Sv background
To investigate the consequences of the Tnp2 gene disruption on male fertility, we intercrossed 10 Tnp2/– males on the C57BL/6Jx129/Sv mixed and 129/Sv inbred background each with two wild-type females for 3 months. All matings of Tnp2–/– males on the hybrid background were productive and the average litter size was not significantly altered as compared to the breeding of wild-type littermates with wild-type females (Table IGo). In contrast, all Tnp2/– males on 129/Sv background were infertile despite normal sexual behaviour towards female mice and production of copulation plugs. To further evaluate male fertility, wild-type females were mated with wild-type and Tnp2/– males, and oocytes were collected 12 h after mating and scored for fertilization. Eighty-one per cent of oocytes harvested from females inseminated by wild-type males had male pronuclei, and 78% developed to the 4-cell stage after 48 h culture. In contrast, all 225 oocytes from the Tnp2/– matings lacked male pronuclei and failed to develop further.


View this table:
[in this window]
[in a new window]
 
Table I. Fertility of Tnp2+/+, Tnp2+/– and Tnp/– mice on the genetic background C57BL/6Jx129/Sv and 129/Sv
 
To address the question of whether the infertility of the Tnp2-deficient mice on the 129/Sv background is caused by failure of spermatozoa to penetrate the zona pellucida and fertilize the oocyte, we have performed IVF assays. Spermatozoa were recovered from Tnp2/– and wild-type animals and tested for their ability to fertilize in-vitro zona-intact and zona-free oocytes. Figure 3Go summarizes the data of these experiments. In in-vitro assays with zona-intact oocytes, only 18.5% of oocytes were fertilized with the spermatozoa of Tnp2/– mice and 17% then developed to the 4-cell stage, whereas 79.5% of oocytes were fertilized with spermatozoa of wild-type mice. In contrast, insemination of zona-free oocytes by spermatozoa from Tnp2/– and wild-type mice did not result in significant differences in the fertilization rates. Thus, the lack of Tnp2 prevents the spermatozoon from penetrating the zona pellucida, but does not affect fertilization once the oocyte is reached.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 3. Analysis of IVF experiments. (A, B). IVF and early development of zona-intact (A) and zona-free (B) oocytes incubated with spermatozoa of Tnp2+/+ and Tnp2/– mice on the 129/Sv background. The percentage of oocytes (no) incubated with spermatozoa is given as 100%. The percentage reaching the pronucleus stage (pn) or 4-cell embryo stage (4c) is shown. The numbers in each category appear above the columns. The results of IVF assay reveal that spermatozoa from Tnp2/– are generally unable to penetrate the zona pellucida.

 
Spermatozoa from Tnp2–/– show abnormal acrosomes and defects in transport
To study further the basis of the infertility of the Tnp2/– mice on the 129/Sv background, we investigated the sperm morphology and the sperm transport through the female genital tract. Although there were no significant differences in the mean number of spermatozoa collected either from the cauda epididymis of Tnp2/– and wild-type males or from the uterus of wild-type females inseminated by spermatozoa of both genotypes, the mean number of Tnp2/– spermatozoa counted in oviducts of inseminated females was found to be much lower than the mean number of spermatozoa from wild-type males in the oviducts (Table IIGo).


View this table:
[in this window]
[in a new window]
 
Table II. Sperm analysis in Tnp2+/+ and Tnp2/– mice (background 129/Sv)
 
Examination of spermatozoa by light microscopy revealed that 24% of the Tnp2/– cauda epididymis spermatozoa exhibited abnormal sperm head morphology, an abnormality that was only seen in 6% of wild-type spermatozoa (Figure 4AGo).



View larger version (95K):
[in this window]
[in a new window]
 
Figure 4. Morphological analysis of germ cells from Tnp2+/+ and Tnp2/– males. (A) Light microscopy of spermatozoa from Tnp2–/– cauda epididymis showed normal spermatozoa (w) and spermatozoa with abnormal heads (b). (BE) Thin section illustrating the ultrastructure of mature spermatids in testis of wild-type (B) and Tnp2/– (C), and spermatozoa in cauda epididymis of wild-type (D) and Tnp2/– mice (E). The chromatin condensation proceeds as the germ cells mature, but the acrosome has become detached from the nucleus of the Tnp2/– spermatids (C) and spermatozoa (E) and is underlain by a large subacrosomal space. a = acrosome; m = mitochondrial sheath; n = nucleus. Original magnification: (BD) x13 000; (E) x22 000.

 
To determine whether the gross abnormality associated with the sperm head was due to aberrant disposition of somatic lysine-rich histones by cystein- and arginin-rich protamines during nuclear condensation, we stained spermatozoa collected from the cauda epididymis by Aniline Blue, which is known to specifically stain lysine residues of histones in nuclei of early spermatid stages but not in nuclei of normal mature spermatozoa where the protamines are the prominent proteins in the condensed chromatin (Dadoune and Alfonsi, 1986Go). The percentage of stained heads was much higher in epididymal spermatozoa of Tnp2/– than in that of wild-type mice (Table IIGo).

The sperm head abnormalities were also observed by electron-microscopical examination of Tnp2/– epididymal spermatozoa. However, the abnormal sperm head was not caused by the disruption of the chromatin condensation in the sperm nucleus but due to malformations of the acrosomes. Many acrosomes (30%) appeared indented and/or partially detached from the nuclear envelope (Figure 4EGo). Indented acrosomes were also found in 4% of wild-type spermatozoa (Figure 4DGo). This abnormal acrosome was also seen in spermatids within the testis (Figure 4CGo). Thus, the high frequency of the indented acrosomes strongly suggests that the attachment of the acrosomal membrane to the nucleus is impaired in spermatozoa of Tnp2 null. In addition to the acrosomal defect, local presence of the sperm tail adjacent to the sperm head was found in epididymal spermatozoa of mutant mice. However, the axon of the spermatozoa were found to possess the normal 9+2 arrangement of microtubule pairs.

To determine whether the acrosomal defect of the spermatozoa of Tnp2/– mice has an influence on the acrosomal exocytosis, we examined the response of spermatozoa from Tnp2/– and wild-type mice to the calcium ionophore A23187. As shown in Table IIGo, spermatozoa of the Tnp2/– mice differ significantly in numbers undergoing acrosome reaction as compared to wild-type spermatozoa.

These data indicate that teratozoospermia is responsible for the infertility of the Tnp2/– males of the 129/Sv background.

Discussion

In this study, we have generated mice carrying a null mutation in the Tnp2 locus and determined the effect of the Tnp2 mutation on male fertility. Breeding of the Tnp2/– animals revealed that the loss of the Tnp2 gene in mice causes male infertility depending on the genetic background. Similar results have been obtained in mice carrying targeted null mutations for the Pou-homeodomain gene (Sprm-1), the transition protein-1 gene (Tnp-1) and the desert hedgehog gene (Dhh). For these genes, highly variable penetrance of male infertility on different genetic backgrounds have been described (Bitgood et al., 1996Go; Pearse et al., 1997Go; Yu et al., 2000Go). The full penetrance of the Tnp/– phenotype on the isogenic 129 background and the observation of normal fertility of the Tnp2/– mice on the mixed background could indicate that the interaction of the Tnp2 mutation with the 129 genetic background involves modifier genes. Preliminary observations of a normal number of spermatozoa produced and of normal fertility in most Tnp/– male mice were cited in one study (Yu et al., 2000Go), but the genetic background of the studied Tnp/– mice has not been mentioned.

In Tnp2-deficient mice, the sperm heads become severely deformed coincident with malformation of the acrosome. The misplacement of the acrosome in spermatozoa may likewise reflect disruption of the acrosomal reaction, as observed in spermatozoa from the Tnp2 null mice. In addition, the inability of the spermatozoa from the Tnp2/– mice to penetrate the zona pellucida in in-vitro assays is also a possible explanation for their infertility. Furthermore, Tnp2/– spermatozoa in the oviducts were found to be reduced in number, indicative of poor motility. Taken together, our results suggest that the infertility of the Tnp2-deficient males is most likely a result of abnormal sperm head morphology and poor motility.

It is interesting that the reduced fertility of the Tnp1-deficient males is also due to abnormalities of the sperm head and defects in sperm motility (Yu et al., 2000Go). The similarity of the phenotypes of spermatozoa from Tnp1 and Tnp2-deficient mice, and the elevated level of Tnp1 and Tnp2 in testis of Tnp2- and Tnp1-deficient mice, respectively (these results and Yu et al., 2000) raises the possibility that a deficiency created through the disruption of the Tnp2 can be compensated for by recruitment of Tnp1 and vice versa.

Our data concerning the pathology of the acrosomes of the Tnp2/– mice are, for the moment, essentially descriptive. It has long been suggested that DNA binding properties of Tnp2 serve specific loci for initiation of chromatin condensation during the later stages of spermatogenesis (Kundu and Rao, 1996Go). Immunocytochemical distribution of the Tnp2 has shown that the first immunoreaction is detected at the tip of the nucleus of step 11 spermatids and this reaction remains localized over the anterior tip of the nucleus even in step 13 spermatids, in which chromatin condensation begins (Kistler et al., 1996Go). The morphological changes of the acrosomal vesicle during spermatogenesis are concomitant with chromatin condensation. During spermatid steps 11–13, the acrosomal cap is flattened, shifted caudally to the anterior tip of the nucleus and attached finally to the nuclear involvement (Oakberg, 1956Go). Therefore, it could be suggested that the failure of the initial chromatin condensation during spermatogenesis in Tnp2-deficient mice leads to impairment of acrosome attachment to the nucleus involvement or to dehiscence of acrosome from the nucleus.

Alterations in the fine structure of the acrosome have been noted in spermatozoa of casein kinase II (Ck2)-deficient mice, in which males are infertile and possess `round-head' spermatozoa with detached acrosome (Xu et al., 1999Go). Similar alterations have also been noted in retinoid X receptor ß (RXRß)-deficient mice and in mice carrying a T/t haplotype (Dooher and Bennett, 1977Go; Kastner et al., 1996Go). It was found that the acrosome is not firmly attached to the nuclear envelope and that the spermatozoa of these genotypes also have reduced motility.

There have been a number of gene disruption experiments that have generated animals with more subtle abnormalities than might have been expected. The normal expression of the closely linked Prm3 and Socs-1 genes in the testis of the Tnp2 –/– mice can rule out the possibility that the disrupted Tnp2 locus in some way influences these neighbouring genes. The phenotype of the Tnp2/– mouse is clearly due to the Tnp2 gene deletion.

Acknowledgements

We would like to thank M.Schindler and H.Riedesel for assistance with the generation of knock-out mice; C.Müller and S.Wolf for help with particular experiments; A.Winkler for secretarial help; and W.S.Kistler and B.Drabent for providing anti-Tnp2 and anti-H1.1 antiserum, respectively. This work was supported by a grant from the Deutsche Forschungsgemeinschaft (through SFB 271) to W.E.

Notes

3 To whom correspondence should be addressed at: Institute of Human Genetics, University of Göttingen D-37073 Göttingen, Germany. E-mail: wengel{at}gwdg.de Back

References

Alfonso, P.T. and Kistler, W.S. (1993) Immunohistochemical localization of spermatid nuclear transition protein 2 in the testis of rats and mice. Biol. Reprod., 48, 522–529.[Abstract]

Balhorn, R., Weston, S., Thomas, C. et al. (1984) DNA packaging in mouse spermatids. Synthesis of protamine variant and four transition proteins. Exp. Cell. Res., 150, 298–308.[ISI][Medline]

Baskaran, R. and Rao, M.R.S. (1991) Mammalian spermatid specific protein, TP2, is a zinc metalloprotein with two finger motifs. Biochem. Biophys. Res. Commun., 179, 1491–1499.[ISI][Medline]

Bitgood, M.L., Shen, L. and McMahon, A.P. (1996) Sertoli cell signaling by Desert hedgehog regulates the male germline. Curr. Biol., 6, 298–304.[ISI][Medline]

Dadoune, J.P. and Alfonsi, M.F. (1986) Ultrastructural and cytochemical changes of the head components of human spermatids and spermatozoa. Gamete Res., 14, 33–46.

Dadoune, J.P., Mayaux, M.J. and Guihard-Moscato, M.L. (1988) Correlation between defects in chromatin condensation of human spermatozoa stained by aniline blue and semen characteristics. Andrologia, 20, 211–217.[ISI][Medline]

Dooher, G.B. and Bennett, D. (1973) Fine structural observations on the development of the sperm head in the mouse. Am. J. Anat., 136, 339–261.[ISI][Medline]

Dooher, G.B. and Bennett, D. (1977) Spermiogenesis and spermatozoa in sterile mice carrying different lethal T/t locus haplotypes: A transmission and scanning electron microscopic study. Biol. Reprod., 17, 269–288.[Abstract]

Fawcett, D.W., Anderson, W.A. and Phillips, D.M. (1971) Morphogenetic factors influencing the shape of the sperm head. Dev. Biol., 26, 220–251.[ISI][Medline]

Franke, K., Drabent, B. and Doenecke, D. (1998) Testicular expression of the mouse histone H1. 1 gene. Histochem. Cell Biol., 109, 383–390.[ISI][Medline]

Hogan, B., Costantini, F. and Lacy, E. (eds) (1986) Manipulating the Mouse Embryo. Cold Spring Harbor Laboratory Press, New York, 332 pp.

Joyner A.L. (ed.) (1993) Gene Targeting: A Practical Approach. IRL Press, Oxford, 230 pp.

Kastner, P., Mark, M., Leid, M. et al. (1996) Abnormal spermatogenesis in RXRß mutant mice. Genes Dev., 10, 80–92.[Abstract/Free Full Text]

Keime, S., Heitland, K., Kumm, S. et al. (1992) Characterization of four genes encoding basic proteins of the porcine spermatid nucleus and close linkage of three of them. Biol. Chem. Hoppe-Seyler, 373, 261–270.[ISI][Medline]

Kistler, W.S., Henriksen, K., Mali, P. et al. (1996) Sequential expression of nucleoproteins during rat spermatogenesis. Exp. Cell. Res., 225, 374–381.[ISI][Medline]

Kleene, K.C. and Flynn, J.F. (1987) Characterization of a cDNA clone encoding a basic protein, TP2, involved in chromatin condensation during spermatogenesis in the mouse. J. Biol. Chem., 262, 17272–17277.[Abstract/Free Full Text]

Kundu, T.K. and Rao, M.R. (1996) Zinc dependent recognition of a human CpG island sequence by the mammalian spermatidal protein TP2. Biochemistry, 35, 15626–15632.[Medline]

Luerssen, H., Maier, W.M., Hoyer-Fender, S. et al. (1989) The nucleotide sequence of rat transition protein 2 (TP2) cDNA. Nucleic Acids Res., 17, 3585.[Free Full Text]

Mansour, S.L., Thomas, K.R. and Capecchi, M.R. (1988) Disruption of the proto-oncogene int-2 in mouse embryo-derived stem cells: a general strategy for targeting mutation to non-selectable gene. Nature, 336, 348–352.[Medline]

Nelson, J.E. and Krawetz, S.A. (1994) Characterization of a human locus in transition. J. Biol. Chem., 369, 31067–31073.

Oakberg, E.F. (1956) Duration of spermatogenesis in the mouse and timing of stages of the cycle of the seminiferous epithelium. Am. J. Anat., 99, 507–516.[ISI][Medline]

Oko, R.J., Jando, V., Wagner, C.L. et al. (1996) Chromatin reorganization in rat spermatids during the disappearance of testis-specific histone, H1t, and the appearance of transition proteins TP1 and TP2. Biol. Reprod., 54, 1141–1157.[Abstract]

Panyim, S. and Chalkley, R. (1969) High resolution acrylamide gel electrophoresis of histones. Arch. Biochem. Biophys., 130, 337–346.[ISI][Medline]

Pearse, R.V., Drolet, D.W., Kalla, K.A. et al. (1997) Reduced fertility in mice deficient for the POU protein sperm-1. Proc. Natl. Acad. Sci. USA, 94, 7555–7560.[Abstract/Free Full Text]

Reinhardt, N., Kremling, H., Luerssen, H. et al. (1991) Characterization of a gene encoding a basic protein of the spermatid nucleus, TNP2, and its close linkage to the protamine gene in the bull. Biol. Chem. Hoppe-Seyler, 372, 431–436.[ISI][Medline]

Schlüter, G. and Engel, W. (1995) The rat Prm3 gene is an intronless member of the protamine gene cluster and is expressed in haploid male germ cells. Cytogenet. Cell Genet., 71, 352–355.[ISI][Medline]

Schlüter, G., Kremling, H. and Engel, W. (1992) The gene for human transition protein 2: Nucleotide sequence, assignment to the protamine gene cluster, an evidence for its low expression. Genomics, 14, 377–383.[ISI][Medline]

Schlüter, G., Celik, A., Obata, R. et al. (1996) Sequence analysis of concerved protamine gene cluster shows that it contains a fourth expressed gene. Mol. Reprod. Dev., 43, 1–6.[ISI][Medline]

Thaler, C.D. and Cardullo, R.A. (1995) Biochemical characterization of a glycosyl-phosphatidylinositol-linked hyaluronidase on mouse sperm. Biochemistry, 34, 7788–7795.[Medline]

Xu, X., Toselli, P.A., Russel, L.D. et al. (1999) Globozoospermia in mice lacking the casein kinase II{alpha} catalytic subunit. Nature Genet., 23, 118-121.[ISI][Medline]

Yu, Y.E., Zhang, Y., Unni, E., et al. (2000) Abnormal spermatogenesis and reduced fertility in transition nuclear protein 1-deficient mice. Proc. Natl. Acad. Sci. USA, 79, 4683–4688.

Submitted on December 20, 2000; accepted on March 28, 2001.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol Hum ReprodHome page
K.-F. Lee, Y.-T. Tam, Y. Zuo, A. W.Y. Cheong, R. T.K. Pang, N. P.Y. Lee, C. K.Y. Shum, P.-C. Tam, A. N.Y. Cheung, Z.-M. Yang, et al.
Characterization of an acrosome protein VAD1.2/AEP2 which is differentially expressed in spermatogenesis
Mol. Hum. Reprod., August 1, 2008; 14(8): 465 - 474.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
P. Grzmil, D. Boinska, K. C. Kleene, I. Adham, G. Schluter, M. Kamper, B. Buyandelger, A. Meinhardt, S. Wolf, and W. Engel
Prm3, the Fourth Gene in the Mouse Protamine Gene Cluster, Encodes a Conserved Acidic Protein That Affects Sperm Motility
Biol Reprod, June 1, 2008; 78(6): 958 - 967.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
M. van Lith, A.-R. Karala, D. Bown, J. A. Gatehouse, L. W. Ruddock, P. T.K. Saunders, and A. M. Benham
A Developmentally Regulated Chaperone Complex for the Endoplasmic Reticulum of Male Haploid Germ Cells
Mol. Biol. Cell, August 1, 2007; 18(8): 2795 - 2804.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
D. T. Carrell, B. R. Emery, and S. Hammoud
Altered protamine expression and diminished spermatogenesis: what is the link?
Hum. Reprod. Update, May 1, 2007; 13(3): 313 - 327.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
A. Roy, Y.-N. Lin, J. E. Agno, F. J. DeMayo, and M. M. Matzuk
Absence of tektin 4 causes asthenozoospermia and subfertility in male mice
FASEB J, April 1, 2007; 21(4): 1013 - 1025.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
L. Jaroszynski, A. Dev, M. Li, A. Meinhardt, D.G. de Rooij, C. Mueller, D. Bohm, S. Wolf, I.M. Adham, G. Wulf, et al.
Asthenoteratozoospermia in mice lacking testis expressed gene 18 (Tex18)
Mol. Hum. Reprod., March 1, 2007; 13(3): 155 - 163*.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
D. Miller and G.C. Ostermeier
Towards a better understanding of RNA carriage by ejaculate spermatozoa
Hum. Reprod. Update, November 1, 2006; 12(6): 757 - 767.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
N. Torregrosa, D. Dominguez-Fandos, M. I. Camejo, C. R. Shirley, M. L. Meistrich, J. L. Ballesca, and R. Oliva
Protamine 2 precursors, protamine 1/protamine 2 ratio, DNA integrity and other sperm parameters in infertile patients
Hum. Reprod., August 1, 2006; 21(8): 2084 - 2089.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
R. Oliva
Protamines and male infertility
Hum. Reprod. Update, July 1, 2006; 12(4): 417 - 435.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. Kotaja, D. De Cesare, B. Macho, L. Monaco, S. Brancorsini, E. Goossens, H. Tournaye, A. Gansmuller, and P. Sassone-Corsi
Abnormal sperm in mice with targeted deletion of the act (activator of cAMP-responsive element modulator in testis) gene
PNAS, July 20, 2004; 101(29): 10620 - 10625.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
D. Paisley, S. Banks, J. Selfridge, N. F. McLennan, A.-M. Ritchie, C. McEwan, D. S. Irvine, P. T. K. Saunders, J. C. Manson, and D. W. Melton
Male Infertility and DNA Damage in Doppel Knockout and Prion Protein/Doppel Double-Knockout Mice
Am. J. Pathol., June 1, 2004; 164(6): 2279 - 2288.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C.-H. Tsai-Morris, Y. Sheng, E. Lee, K.-J. Lei, and M. L. Dufau
Gonadotropin-regulated testicular RNA helicase (GRTH/Ddx25) is essential for spermatid development and completion of spermatogenesis
PNAS, April 27, 2004; 101(17): 6373 - 6378.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
U. Schlecht, P. Demougin, R. Koch, L. Hermida, C. Wiederkehr, P. Descombes, C. Pineau, B. Jegou, and M. Primig
Expression Profiling of Mammalian Male Meiosis and Gametogenesis Identifies Novel Candidate Genes for Roles in the Regulation of Fertility
Mol. Biol. Cell, March 1, 2004; 15(3): 1031 - 1043.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
K. Nayernia, B. Drabent, I. M. Adham, M. Moschner, S. Wolf, A. Meinhardt, and W. Engel
Male Mice Lacking Three Germ Cell Expressed Genes Are Fertile
Biol Reprod, December 1, 2003; 69(6): 1973 - 1978.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Nayernia, F. Vauti, A. Meinhardt, C. Cadenas, S. Schweyer, B. I. Meyer, I. Schwandt, K. Chowdhury, W. Engel, and H.-H. Arnold
Inactivation of a Testis-specific Lis1 Transcript in Mice Prevents Spermatid Differentiation and Causes Male Infertility
J. Biol. Chem., November 28, 2003; 278(48): 48377 - 48385.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. Schultz, F. K. Hamra, and D. L. Garbers
A multitude of genes expressed solely in meiotic or postmeiotic spermatogenic cells offers a myriad of contraceptive targets
PNAS, October 14, 2003; 100(21): 12201 - 12206.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
A. U. Mannan, K. Nayernia, C. Mueller, P. Burfeind, I. M. Adham, and W. Engel
Male Mice Lacking the Theg (Testicular Haploid Expressed Gene) Protein Undergo Normal Spermatogenesis and Are Fertile
Biol Reprod, September 1, 2003; 69(3): 788 - 796.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
T. Kimura, C. Ito, S. Watanabe, T. Takahashi, M. Ikawa, K. Yomogida, Y. Fujita, M. Ikeuchi, N. Asada, K. Matsumiya, et al.
Mouse Germ Cell-Less as an Essential Component for Nuclear Integrity
Mol. Cell. Biol., February 15, 2003; 23(4): 1304 - 1315.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. Nayernia, I. M. Adham, E. Burkhardt-Gottges, J. Neesen, M. Rieche, S. Wolf, U. Sancken, K. Kleene, and W. Engel
Asthenozoospermia in Mice with Targeted Deletion of the Sperm Mitochondrion-Associated Cysteine-Rich Protein (Smcp) Gene
Mol. Cell. Biol., May 1, 2002; 22(9): 3046 - 3052.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
K. Nayernia, I. M. Adham, R. Shamsadin, C. Muller, U. Sancken, and W. Engel
Proacrosin-deficient mice and zona pellucida modifications in an experimental model of multifactorial infertility
Mol. Hum. Reprod., May 1, 2002; 8(5): 434 - 440.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive