Molecular Human Reproduction, Vol. 7, No. 7, 649-654,
July 2001
© 2001 European Society of Human Reproduction and Embryology
Uterine physiology |
Evidence for the expression of interleukin (IL)-18, IL-18 receptor and IL-18 binding protein in the human endometrium
1 Department of Obstetrics and Gynecology, University of Tokyo, Tokyo 113-8655 and 2 CREST, Japan Science and Technology, Kawaguchi 332-0012, Japan
Abstract
To see whether the interleukin (IL)-18 system is operative in the endometrium, we examined the expression of IL-18, IL-18 receptor (IL-18R) and IL-18 binding protein (IL-18BP), the substance known to neutralize IL-18 activity, in this tissue. Reverse transcriptionpolymerase chain reaction analyses showed that IL-18, IL-18R and IL-18BP mRNA were constitutively expressed without significant fluctuation throughout the menstrual cycle. When epithelial cells and stromal cells were cultured separately, the expression levels of IL-18 mRNA in epithelial cells were about 18-fold higher compared to those in stromal cells. Furthermore, the IL-18 precursor protein was detected by Western blot analysis in cultured epithelial cells but not in stromal cells. Recombinant human IL-18 stimulated the secretion of interferon (IFN)-
by resident bone marrow-derived cells in the endometrium. On the other hand, IFN-
up-regulated the IL-18BP expression both in cultured epithelial cells and stromal cells. Thus, we have presented evidence for the presence of the IL-18 system in the human endometrium. In light of its immunomodulatory roles in a variety of tissues, this system may afford protection against pathogenic micro-organisms and provide a regulatory mechanism for controlled trophoblast invasion by modulating a local cytokine network.
endometrium/interleukin-18/interleukin-18 binding protein/interleukin-18 receptor
Introduction
The endometrium's mucosal immune system is a crucial first line of defence against pathogenic organisms including sexually transmitted bacteria or viruses. In addition, the immunological interplay between the endometrium and the embryo is central to the establishment and maintenance of pregnancy. The immune system working in the endometrium could be modulated by various locally produced cytokines, such as tumour necrosis factor, interleukin (IL)-1 (Tabibzadeh and Sun, 1992
; Simon et al., 1993
), IL-6 (Tabibzadeh et al., 1995
), IL-8 (Milne et al., 1999
) and IL-15 (Okada et al., 2000
).
IL-18 was originally identified as a circulating molecule in endotoxin-challenged mice following bacterial priming, and was cloned from activated macrophages as interferon (IFN)-
-inducing factor (Okamura et al., 1995
). IL-18 has structural similarities with the IL-1 family of proteins (Ushio et al., 1996
). IL-18 is synthesized as a 24 kDa molecule that requires cleavage by the IL-1 converting enzyme (ICE, also termed caspase-1) to generate a biologically active 18 kDa monomer (Ghayur et al., 1997
; Gu et al., 1997
). Gene expression and/or protein secretion of IL-18 have been observed in a wide range of cells including macrophages (Munder et al., 1998
), dendritic cells (Stoll et al., 1998
), mononuclear cells (Puren et al., 1998
), keratinocytes (Stoll et al., 1997
), and osteoblast cells (Olee et al., 1999
). IL-18 functions primarily to promote a T-helper (Th) 1 response through induction of IFN-
. It also exerts pro-inflammatory properties by inducing the production of IL-1ß, TNF-
, chemokines, nitric oxide and prostaglandins (Lebel-Binay et al., 2000
). These functions are mediated through the IL-18 receptor (IL-18R) which is identical in sequence to a member of the IL-1 receptor family previously designated IL-1 receptor-related protein (Torigoe et al., 1997
). A secreted soluble binding protein for IL-18 has been recently characterized from human urine as IL-18 binding protein (IL-18 BP), and does not represent a cleaved variant of the cell surface receptor (Novick et al., 1999
). IL-18BP has been shown to neutralize IL-18 effector functions (Novick et al., 1999
), suggesting that the IL-18 system operates via elaboration of its receptor and binding protein.
Interestingly, a recent study has shown that chlamydial infection of some epithelial cells induces the release of mature IL-18 through the activation of ICE (Lu et al., 2000
). Chlamydia trachomatis is one of the most common causes of sexually transmitted diseases worldwide and its infection can cause salpingitis, ectopic pregnancy, or infertility. With this background, we sought to determine whether the human endometrium expresses IL-18, IL-18R and IL-18BP on the hypothesis that the IL-18 system could play a role in the human endometrium.
Materials and methods
Patients and samples
Endometrial tissues were collected from 30 patients undergoing hysterectomy for benign gynaecological conditions. All patients had regular menstrual cycles, and none had received hormonal treatment before surgery. The specimens were dated according to published criteria (Noyes et al., 1950
). Endometrial tissues were collected under sterile conditions and processed for primary cell culture or snap-frozen in liquid nitrogen and stored at 80°C. Written informed consent was obtained from each patient and protocols were approved by the local committee of our university.
Isolation and culture of human endometrial epithelial and stromal cells
The fresh endometrial biopsy collected in sterile medium was rinsed to remove blood cells. The tissues were minced into small pieces and digested by incubation in Dulbecco's modified Eagle's medium (DMEM)/Ham's F-12 containing type I collagenase (0.25%; Sigma, St Louis, MO, USA) and DNase I (15 IU/ml; Takara Shuzo, Tokyo, Japan) for 60 min at 37°C with agitation.
The dispersed endometrial cells were separated by filtration through a 40 µm nylon cell strainer (Becton Dickinson Labware, Franklin Lakes, NJ, USA). The endometrial epithelial glands, which remained intact, were retained by the strainer, whereas the dispersed stromal cells passed through the strainer into the filtrate.
Stromal cells in the filtrate were collected by centrifugation and resuspended in Phenol Red-free DMEM/Ham's F-12 containing 10% charcoal-stripped fetal bovine serum (FBS), 100 IU/ml penicillin, 0.1 mg/ml streptomycin and 0.25 µg/ml amphotericin B. The cells were plated in a 100 mm culture plate and kept at 37°C in a humidified 5% CO2/95% air environment. After the cells reached confluence, they were passaged by a standard method of trypsinization and 15x105 cells were plated in 60 mm culture plates with 3 ml medium. The cells which reached confluence in 2 or 3 days were used for the experiments.
The epithelial cells were collected by backwashing the strainer with DMEM/Ham's F-12, plated in a 100 mm plate and incubated at 37°C for 30 min to allow contaminated stromal cells to attach to the plate wall. Unattached epithelial cells were recovered, and resuspended in the culture medium as described above, then plated into a 60 mm culture plate (Primalia; Becton Dickinson Labware). The cells which reached subconfluence in 2 or 3 days were used for the experiments.
The purity of the prepared stromal and epithelial cells was confirmed by positive cellular staining for vimentin or cytokeratin respectively.
In the experiment to study the effect of IFN-
on expression of IL-18, IL-18R and IL-18BP, both cultured epithelial cells and stromal cells were incubated with or without 100 IU/ml recombinant human INF-
(Sigma) for 24 h.
Isolation and culture of bone marrow-derived cells in the human endometrium
Biopsied endometrial specimens were minced into pieces and digested by incubation in DMEM/Ham's F-12 containing type I collagenase and DNase I for 60 min at 37°C with agitation as described above. The dispersed cells were layered onto Ficoll-Paque (Pharmacia, Uppsala, Sweden) and centrifuged at 400 g for 15 min (King et al., 1989
). Bone marrow-derived cells were recovered from the interface and washed with phosphate-buffered saline (PBS). After centrifugation, cells were resuspended and plated in a 24-well plate at 1x106 per ml in Roswell Park Memorial Institute medium 1640 containing 2% FBS, 100 IU/ml penicillin, 0.1 mg/ml streptomycin, and 0.25 µg/ml amphotericin B. The cells were then cultured with or without recombinant human IL-18 (10 nmol/l) and kept at 37°C in humidified 5% CO2/95% air environment for 48 h. At the end of incubation, cell supernatants were collected and stored at 80°C.
RTPCR
Total RNA was extracted from endometrial tissues, cultured endometrial epithelial cells and cultured stromal cells, using RNeasy Mini Kit (Qiagen, Hilden, Germany). One µg of total RNA was reverse-transcribed in a 20 µl volume using TaKaRa RNA PCR Kit (Takara Shuzo). Standard PCR was performed using TaKaRa RNA PCR Kit (Takara Shuzo) according to the manufacturer's instructions. The following PCR primers were used for glyceraldehyde-3-phosphate dehydrogenase (GAPDH), IL-18, IL-18R and IL-18 BP respectively. GAPDH sense primer, 5'-ACATCGCTCAGACACCATGG-3', antisense primer, 5'-GTAGTTGAGGTCAATGAAGGG-3'; IL-18 sense primer, 5'-GCTTGAATCTAAATTATCAGTC-3', antisense primer, 5'-GAAGATTCAAATTGCATCTTAT-3'; IL-18R sense primer, 5'-GGACTCCATGAAGCATTGGT-3', antisense primer, 5'-AGACTCGGAAAGAACAGGCA-3'; IL-18BP sense primer, 5'-CAACTGGACACCAGACCTCA-3', antisense primer, 5'-AGCTCAGCGTTCCATTCAGT-3'.
PCR amplification protocols were as follows. GAPDH (denaturing 95°C for 30 s, annealing 65°C for 30 s, extension 72°C for 60 s) x23 cycles, IL-18 (denaturing 94°C for 30 s, annealing 55°C for 30 s, extension 72°C for 60 s) x25 cycles, IL-18R (denaturing 94°C for 30 s, annealing 68°C for 30 s, extension 72°C for 60 s) x30 cycles, IL-18 BP (denaturing 94°C for 30 s, annealing 66°C 30 s, extension 72°C for 60 s) x30 cycles.
Real-time quantitative PCR and data analysis were carried out using a LightCycler (Roche Diagnostic, Mannheim, Germany) according to the manufacturer's instructions. The primers for GAPDH, IL-18 and IL-18R were the same as those used for standard PCR. As for IL-18BP, the following primers were used because the primers used for standard PCR were not suitable for this method.
For sense primer, 5'- TAAGCAGTGTCCAGCATTGG-3', antisense primer, 5'- ACAACCTGTTCAGGGTCCAC 3', amplification was performed in a total volume of 20 µl including LightCyclerFastStart Reaction Mix SYBR Green 1 (Roche Diagnostic). Amplification protocols were as follows. GAPDH: MgCl2 3 mmol/l (denaturing 95°C for 15 s, annealing 60°C for 10 s, extension 72°C for 14 s) x45 cycles; IL-18: MgCl2 4 mmol/l (denaturing 95°C for 15 s, annealing 55°C for 10 s, extension 72°C for 14 s) x45 cycles; IL-18R: MgCl2 4 mmol/l (denaturing 95°C for 15 s, annealing 64°C for 10 s, extension 72°C for 12 s) x45 cycles; IL-18BP: MgCl2 3 mmol/l (denaturing 95°C for 15 s, annealing 64°C for 10 s, extension 72°C for 14 s) x50 cycles.
Western blotting
Separately cultured epithelial and stromal cells were homogenized in lysis buffer containing 50 mmol/l TrisHCl (pH7.4), 0.1% sodium dodecyl sulphate (SDS), 1 mmol/l EDTA, 0.5% Igepal, and 50 mmol/l dithiothreitol and diluted to 2 mg total protein/ml. Samples were resolved by 10% SDSpolyacrylamide gel electrophoresis (PAGE) with recombinant human IL-18 (MBL, Nagoya, Japan) in a parallel lane. Proteins were blotted onto a nitrocellulose membrane and incubated with antihuman IL-18 goat antibody (1:400; Genzyme/Techne, MN, USA) as a primary antibody and antigoat horseradish peroxidase-conjugated antibody (1:1000; Santa Cruz Biotechnology, CA, USA) as a secondary antibody. Immune complexes were visualized by ECL Western blotting system (Amersham, Buckinghamshire, UK).
Measurement of IFN-
IFN-
concentrations in conditioned media were assayed by enzyme-linked immunosorbent assay (ELISA), according to the manufacturer's instructions (Quantikine Human IFN-
Immunoassay; Genzyme/Techne). The limit of sensitivity of this ELISA was 8 pg/ml. The intra- and inter-assay coefficients of variation were 2.8 and 3.7% respectively.
Statistical analysis
Analysis of variance was used for the comparisons of mRNA expression levels of IL-18, IL-18R and IL-18BP throughout the menstrual cycle. Student's t-test was used for the comparison of concentrations of IFN-
in the culture media. P < 0.05 was accepted as statistically significant.
Results
Expression of IL-18, IL-18R and IL-18BP mRNA in the endometium
IL-18, IL18R and IL-18BP mRNA were detected in human endometrial tissues, each exhibiting a predicted band size of 342, 249 and 236 bp respectively, based on a standard RTPCR analysis (Figure 1
).
|
Real-time quantitative RTPCR showed that IL-18, IL-18R and IL-18BP mRNA were expressed throughout the menstrual cycle (Figure 2
|
Both cultured endometrial epithelial cells and stromal cells were shown to express IL-18, IL18-R and IL-18BP mRNA by use of a standard RTPCR assay (Figure 3
|
The expression of IL-18 protein in cultured endometrial cells
Western blot analysis revealed IL-18 protein expression in epithelial cells (Figure 4A,B), whereas its expression was not detected in stromal cells (data not shown). IL-18 protein was mainly detected as a 24 kDa band, the known size of the biologically inactive precursor molecule (Figure 4A
|
Effect of recombinant IL-18 on the secretion of IFN-
by resident bone marrow-derived cells in the endometriumAs shown in Figure 5
secretion from resident bone marrow-derived cells in the endometrium from five women examined (proliferative phase = 2, secretory phase = 3). On average, an ~8-fold increase of IFN-
secretion was observed in the recombinant IL-18-stimulated group compared with the control group.
|
Effect of IFN-
on IL-18, IL-18R and IL-18 BP mRNA levels of cultured endometrial cellsAs shown in Figure 6
for 24 h. The magnitudes of increase (mean ± SEM) as measured by real-time quantitative RTPCR analysis were 155.4 ± 15.1-fold for epithelial cells and 69.8 ± 20.7-fold for stromal cells. In contrast, levels of both IL-18 mRNA and IL-18R mRNA were essentially the same in both epithelial cells and stromal cells with or without the addition of IFN-
.
|
Discussion
In the present study, the expression of IL-18, IL-18R and IL-18BP was demonstrated in the human endometrium. This finding implicates the involvement of the IL-18 system as a local immune regulator within this tissue.
The expression of IL-18, IL-18R and IL-18BP did not show any characteristic variations during the menstrual cycle. This is unique in the sense that various pro-inflammatory cytokines present in the endometrium, such as TNF, IL-1 (Simon et al., 1993
), IL-6 (Tabibzadeh and Sun, 1992
), IL-8 (Milne et al., 1999
) and IL-15 (Okada et al., 2000
), show cycle-dependent expression. The present finding, therefore, seems to suggest that pro-inflammatory cytokines and ovarian steroid hormones are not in a position to regulate the expression of IL-18, IL-18R and IL-18BP. Consistent with the present findings, pro-inflammatory cytokines such as IL-1ß, TNF-
and IFN-
are without effect in modulating the constitutive production of IL-18 by human keratinocytes (Mee et al., 2000
).
The IL-18 protein expressed in endometrial epithelial cells was almost completely in the form of the 24 kDa precursor protein, which is biologically inactive unless it undergoes cleavage. A recent study demonstrated that several human epithelial cell lines constitutively express the IL-18 precursor and that C.trachomatis infection causes cells to secrete mature IL-18 (Lu et al., 2000
). Interestingly, the study showed that the infection does not alter the expression of IL-18 mRNA or IL-18 precursor protein, indicating that Chlamydia-induced IL-18 secretion occurs at the post-transcriptional level. Furthermore, the secretion of IL-18 is mediated by caspase-1 activation which entails protein synthesis by Chlamydia. In view of these findings, endometrial epithelial cells might secrete mature IL-18 protein following exposure to a range of pathogenic organisms including chlamydia and, thereby, play a protective role against them. Whether mature IL-18 is present in infected endometrial tissues needs to be addressed by further studies.
We demonstrated that recombinant IL-18, the mature IL-18 protein, stimulates the secretion of IFN-
by bone marrow-derived cells separated from the endometrium. Similar findings were previously reported regarding circulating T cells and NK cells. IFN-
exerts pleiotropic immunomodulatory functions such that it induces the Th1 response and stimulates the production of IL-6, monocyte chemoattractant protein-1 and macrophage colony-stimulating factor by endometrial stromal cells (Nasu et al., 1998
). Furthermore, IFN-
has been shown to have anti-chlamydial activity both in vitro (Byrne et al., 1989
) and in vivo (Rank et al., 1992
; Ito and Lyons, 1999
). Thus, it is conceivable that the IL-18 system could have a role in preventing chlamydial infection in concert with IFN-
in the human endometrium. In this regard, IL-18 being expressed predominantly in epithelial cells relative to stromal cells seems to make functional sense, considering that uterine luminal epithelia are directly exposed to pathogens and are, therefore, the major defender against them.
The endometrium is the interface where the intricate feto-maternal interaction takes place. Recent emerging evidence suggests cytokines as key players in regulating the invasion of trophoblasts into decidual tissues. More specifically, the balance between Th1 and Th2 is thought to be crucial for coordinated trophoblast invasion. Given this notion, there exists the possibility for IL-18 to regulate trophoblast invasion by modulating the release of IFN-
, a Th1 type cytokine.
The expression of IL-18BP was demonstrated both in epithelial cells and stromal cells. Treatment with IFN-
up-regulated the expression in both cell types. In light of the neutralizing effect of IL-18BP against IL-18 bioactivity (Novick et al., 1999
), this finding may suggest that a potential homeostatic mechanism to fine-tune the IL-18 system is at play in the endometrium.
In summary, we showed the expression of IL-18, IL-18R and IL-18BP in the human endometrium, suggesting that the IL-18 system might perform a defensive role against pathogenic organisms in the uterine cavity. Further study may elucidate the roles of this system.
Acknowledgements
We thank Yuko Kai for her technical assistance.
Notes
3 To whom correspondence should be addressed ![]()
References
Byrne, G.I., Carlin, J.M., Merkert, T.P. et al. (1989) Long-term effects of gamma interferon on chlamydia-infected host cells: microbicidal activity follows microbistasis. Infect. Immun., 57, 13181320.
Ghayur, T., Banerjee, S., Hugunin, M. et al. (1997) Caspase-1 processes IFN-gamma-inducing factor and regulates LPS-induced IFN-gamma production. Nature, 386, 619623.[Medline]
Gu, Y., Kuida, K., Tsutsui, H. et al. (1997) Activation of interferon-gamma inducing factor mediated by interleukin-1beta converting enzyme. Science, 275, 206209.
Ito, J.I. and Lyons, J.M. (1999) Role of gamma interferon in controlling murine chlamydial genital tract infection. Infect. Immun., 67, 55185521.
King, A., Birkby, C. and Loke, Y.W. (1989) Early human decidual cells exhibit NK activity against the K562 cell line but not against first trimester trophoblast. Cell Immunol., 118, 337344.[Web of Science][Medline]
Lebel-Binay, S., Berger, A., Zinzindohoue, F. et al. (2000) Interleukin-18: biological properties and clinical implications. Eur. Cytokine Netw., 11, 1526.[Web of Science][Medline]
Lu, H., Shen, C. and Brunham, R.C. (2000) Chlamydia trachomatis infection of epithelial cells induces the activation of caspase-1 and release of mature IL-18. J. Immunol., 165, 14631469.
Mee, J.B., Alam, Y. and Groves, R.W. (2000) Human keratinocytes constitutively produce but do not process interleukin-18. Br. J. Dermatol., 143, 330336.[Web of Science][Medline]
Milne, S.A., Critchley, H.O., Drudy, T.A. et al. (1999) Perivascular interleukin-8 messenger ribonucleic acid expression in human endometrium varies across the menstrual cycle and in early pregnancy decidua. J. Clin. Endocrinol. Metab., 84, 25632567.
Munder, M., Mallo, M., Eichmann, K. et al. (1998) Murine macrophages secrete interferon gamma upon combined stimulation with interleukin (IL)-12 and IL-18: A novel pathway of autocrine macrophage activation. J. Exp. Med., 187, 21032108.
Nasu, K., Matsui, N., Narahara, H. et al. (1998) Effects of interferon-gamma on cytokine production by endometrial stromal cells. Hum. Reprod., 13, 25982601.
Novick, D., Kim, S.H., Fantuzzi, G. et al. (1999) Interleukin-18 binding protein: a novel modulator of the Th1 cytokine response. Immunity, 10, 127136.[Web of Science][Medline]
Noyes, R.W., Hertig, A.T. and Rock, J. (1950) Dating the endometrial biopsy. Fertil. Steril., 1, 325.
Okada, S., Okada, H., Sanezumi, M. et al. (2000) Expression of interleukin-15 in human endometrium and decidua. Mol. Hum. Reprod., 6, 7580.
Okamura, H., Tsutsi, H., Komatsu, T. et al. (1995) Cloning of a new cytokine that induces IFN-gamma production by T cells. Nature, 378, 8891.[Medline]
Olee, T., Hashimoto, S., Quach, J. et al. (1999) IL-18 is produced by articular chondrocytes and induces proinflammatory and catabolic responses. J. Immunol., 162, 10961100.
Puren, A.J., Fantuzzi, G., Gu, Y. et al. (1998) Interleukin-18 (IFNgamma-inducing factor) induces IL-8 and IL-1beta via TNFalpha production from non-CD14+ human blood mononuclear cells. J. Clin. Invest., 101, 711721.[Web of Science][Medline]
Rank, R.G., Ramsey, K.H., Pack, E.A. et al. (1992) Effect of gamma interferon on resolution of murine chlamydial genital infection. Infect. Immun., 60, 44274429.
Simon, C., Piquette, G.N., Frances, A. et al. (1993) Localization of interleukin-1 type I receptor and interleukin-1 beta in human endometrium throughout the menstrual cycle. J. Clin. Endocrinol. Metab., 77, 549555.[Abstract]
Stoll, S., Muller, G., Kurimoto, M. et al. (1997) Production of IL-18 (IFN-gamma-inducing factor) messenger RNA and functional protein by murine keratinocytes. J. Immunol., 159, 298302.[Abstract]
Stoll, S., Jonuleit, H., Schmitt, E. et al. (1998) Production of functional IL-18 by different subtypes of murine and human dendritic cells (DC): DC-derived IL-18 enhances IL-12-dependent Th1 development. Eur. J. Immunol., 28, 32313239.[Web of Science][Medline]
Tabibzadeh, S. and Sun, X.Z. (1992) Cytokine expression in human endometrium throughout the menstrual cycle. Hum. Reprod., 7, 12141221.
Tabibzadeh, S., Kong, Q.F., Babaknia, A. et al. (1995) Progressive rise in the expression of interleukin-6 in human endometrium during menstrual cycle is initiated during the implantation window. Hum. Reprod., 10, 27932799.
Torigoe, K., Ushio, S., Okura, T. et al. (1997) Purification and characterization of the human interleukin-18 receptor. J. Biol. Chem., 272, 2573725742.
Ushio, S., Namba, M., Okura, T. et al. (1996) Cloning of the cDNA for human IFN-gamma-inducing factor, expression in Escherichia coli, and studies on the biologic activities of the protein. J. Immunol., 156, 42744279.[Abstract]
Submitted on January 22, 2001; accepted on April 23, 2001.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
Y. Hirota, Y. Osuga, K. Koga, O. Yoshino, T. Hirata, C. Morimoto, M. Harada, Y. Takemura, E. Nose, T. Yano, et al. The Expression and Possible Roles of Chemokine CXCL11 and Its Receptor CXCR3 in the Human Endometrium J. Immunol., December 15, 2006; 177(12): 8813 - 8821. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Morimoto, Y. Osuga, T. Yano, Y. Takemura, M. Harada, T. Hirata, Y. Hirota, O. Yoshino, K. Koga, K. Kugu, et al. GnRH II as a possible cytostatic regulator in the development of endometriosis Hum. Reprod., November 1, 2005; 20(11): 3212 - 3218. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhou, E. Yamaguchi, Y. Fukui, S. Konno, Y. Maeda, K. Kimata, and M. Nishimura Enhanced Expression of Interleukin-18 Receptor α Chain by CD4+ T Cells in Sarcoidosis Chest, October 1, 2005; 128(4): 2497 - 2503. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Hirota, Y. Osuga, T. Hirata, K. Koga, O. Yoshino, M. Harada, C. Morimoto, E. Nose, T. Yano, O. Tsutsumi, et al. Evidence for the Presence of Protease-Activated Receptor 2 and Its Possible Implication in Remodeling of Human Endometrium J. Clin. Endocrinol. Metab., March 1, 2005; 90(3): 1662 - 1669. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hirata, Y. Osuga, Y. Hirota, K. Koga, O. Yoshino, M. Harada, C. Morimoto, T. Yano, O. Nishii, O. Tsutsumi, et al. Evidence for the Presence of Toll-Like Receptor 4 System in the Human Endometrium J. Clin. Endocrinol. Metab., January 1, 2005; 90(1): 548 - 556. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Eriksson, S. K. Meadows, C. R. Wira, and C. L. Sentman Unique phenotype of human uterine NK cells and their regulation by endogenous TGF-{beta} J. Leukoc. Biol., September 1, 2004; 76(3): 667 - 675. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ledee-Bataille, F. Olivennes, J. Kadoch, S. Dubanchet, N. Frydman, G. Chaouat, and R. Frydman Detectable levels of interleukin-18 in uterine luminal secretions at oocyte retrieval predict failure of the embryo transfer Hum. Reprod., September 1, 2004; 19(9): 1968 - 1973. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





,
: proliferative phase;
, ,
: secretory phase).



