Molecular Human Reproduction, Vol. 7, No. 9, 853-857,
September 2001
© 2001 European Society of Human Reproduction and Embryology
Uterine physiology |
Alternatively spliced variant deleting exons 7 and 8 of the human telomerase reverse transcriptase gene is dominantly expressed in the uterus
Department of Obstetrics and Gynecology, Gifu University School of Medicine, 40 Tsukasa-machi, Gifu, 500-8705, Japan
Abstract
The expression level of the human telomerase reverse transcriptase (hTERT) is a rate-limiting determinant of telomerase activity. Several alternatively spliced variants of hTERT transcript are currently known. We have studied the expression of the splicing variants arising in the transcript encoding the reverse transcriptase domain, and have compared this to the telomerase activity in 27 endometria, 14 myometria and 18 endometrial carcinomas. Telomerase activity and the full-length hTERT transcript were observed in endometrial samples from the proliferative and early secretory phases, but not in those from the late secretory phase. Steady-state expression of the hTERT splicing variant entirely lacking exon 7 and exon 8 was observed in the endometria throughout the menstrual cycle. In the analysed myometria, this type of splicing variant was the most commonly detected, and telomerase activity occurred in only three samples. In both endometria and myometria, the expression of the full-length transcript correlated well with the telomerase activity. In each of the endometrial carcinomas, telomerase activity was detected and the full-length transcript was found together with varying combinations of deletion splicing variants. These results suggest that regulation of splicing in the transcript encoding the hTERT reverse transcriptase domain is associated with telomerase activation in uterine tissues.
endometrium/hTERT/myometrium/splicing variant/telomerase
Introduction
The telomere protects the chromosome ends from degradation and prevents end-to-end ligation with other chromosomes. The length of the telomere is considered to be an important factor in the regulation of cell division (Harley, 1991
; Allsopp et al., 1995). Telomerase is a ribonucleoprotein which synthesizes a telomeric repeat on the ends of the chromosomes. Telomerase activity is thought to be essential in maintaining a certain telomere length in immortal cells and in somatic stem cells (de Lange, 1994). In the human, telomerase activity in most somatic cells disappears in the early stage of embryogenesis (Ulaner et al., 1998).
Human telomerase is comprised of an RNA component (hTR) and protein components including the human telomerase reverse transcriptase (hTERT). The hTERT gene consists of 16 exons and the hTERT mRNA transcript is ~4.0 kb long (Kilian et al., 1997; Meyerson et al., 1997). The hTERT protein has a molecular weight of 127kDa and contains telomerase specific motif and seven reverse transcriptase motifs. The reverse transcriptase motifs are a common structure among the reverse transcriptase group of proteins and are well conserved in species. The telomerase specific motif is a specific structure in the catalytic subunit of the telomerase (Harrington et al., 1997; Lingner et al., 1997; Nakamura et al., 1997). Telomerase activity in cells and tissues correlates well with the expression level of hTERT; therefore, hTERT is considered to be a rate-limiting determinant of telomerase activity.
To date, several alternatively spliced variants of the hTERT transcript have been reported (Kilian et al., 1997; Ulaner et al., 1998; Wick et al., 1999). Alternative splicing variants of the deletion type, alpha-deletion and beta-deletion, from the hTERT mRNA have been documented. The alpha-deletion lacks 36 nucleotides from the 5' end of exon 6, and the beta-deletion entirely lacks exon 7 and exon 8 (Killian et al., 1997; Ulaner et al., 1998). Insertion types of alternative splicing variants, i.e. the 38 nucleotide insertion of intron 4, the partial insertion of intron 11, the 159 nucleotide insertion of intron 14, and the replacement of the complete exon 15 and the 5'-part of exon 16 with the first 600 nucleotides of intron 14 have also been reported (Killian at al., 1997; Wick et al., 1999).
Telomerase activity in the endometrium varies throughout the menstrual cycle. We and others have shown that its telomerase activity in the endometrium increases toward the end of the proliferative phase and decreases to nothing in the secretory phase (Kyo et al., 1997; Yokoyama et al., 1998a,b). Most endometrial carcinomas are telomerase positive, whereas the myometrium is generally telomerase negative (Yokoyama et al., 1998a). In these tissues, the expression of the alternatively spliced variants of hTERT is not known well. The change in telomerase activity of the endometrium during the menstrual cycle might be regulated by not only the level of hTERT, but also the alternative splicing of the hTERT gene. This possibility prompted us to study the expression pattern of the hTERT splicing variants and its relationship to the telomerase activity in these tissues.
Materials and methods
Patient background and sample preparation
A total of 59 tissue samples, comprised of 13 samples of the proliferative endometrium, 14 samples of the secretory endometrium, 18 samples of the endometrial carcinoma and 14 samples of the myometrium were studied. All the normal endometrial and myometrial tissues were taken from patients with regular menstruation. The study was approved by the local ethics commitee and informed consent was obtained from all the patients. The mean ± SD age of each group was 43.0 ± 4.2, 42.9 ± 3.3, 56.5 ± 9.0 and 43.29 ± 2.1 years respectively. These tissues were removed from the resected uterus immediately after surgery, snap-frozen in liquid nitrogen and stored at –80°C until the study. All patients underwent hysterectomy due to pelvic endometriosis, uterine leiomyoma or endometrial carcinomas.
Telomerase determination
Approximately 100 mg of tissue was washed in buffer (10 mmol/l HEPES–KOH pH 7.5, 1.5 mmol/l MgCl2, 10 mmol/l KCl, and 1 mmol/l dithiothreitol) and then homogenized in 200 µl of a cell lysis buffer [10 mmol/l Tris–HCl pH 7.5, 1 mmol/l MgCl2, 1 mmol/l EGTA, 0.1 mmol/l benzamidine, 5 mmol/l ß-mercaptoethanol, and 0.5% 3-((3-cholamidopropyl)dimethylammonio)-1-propanesulphonate (CHAPS; Wako Chemical Industries, Inc., Osaka, Japan) and 10% glycerol], and incubated on ice for 30 min. The tissue homogenates were then centrifuged at 12 000 g for 20 min at 4°C. The supernatant was recovered and snap-frozen in liquid nitrogen and stored at –80°C. The concentration of protein was measured with protein assay dye (Bio-Rad Laboratories, Hercules, CA, USA).
Telomerase activity was determined by the telomeric repeat amplification protocol (TRAP) using a TRAPEZE Telomerase detection kit (Oncor, Gaithersburg, MD, USA). Briefly, 2 µl of tissue extract was mixed with a TRAP reaction mix consisting of the TS primer (5'-AATCCGTCGAGCAGAGTT) 5' end-labelled with [
-32P]ATP, 50 µmol/l of dNTP mix, a TRAP primer mix (RP primer, K1 primer, and TSK1 template), 2 IU Taq DNA polymerase in 20 mmol/l Tris–HCl, pH 8.3, 1.5 mmol/l MgCl2, 63 mmol/l KCl, 1 mmol/l EGTA, 0.05% Tween 20, and 0.01% bovine serum albumin, were prepared and incubated at 30°C for 30 min. Polymerase chain reaction (PCR) was then performed as follows: 25 cycles of 94°C for 30 s and 60°C for 30 s. The PCR products were electrophoresed in a 12% acrylamide gel and autoradiographed.
RT–PCR for the determination of splicing variation
Total RNA was extracted from ~100 mg of tissue by Isogene (Nippon Gene Inc., Tokyo, Japan). cDNA was synthesized using the First-Strand cDNA Synthesis Kit (Pharmacia-Biotech). In brief, 8 µl of total RNA (~5 µg) was mixed with 1 µl (200 ng) of random primer, 1 µl of 200 mmol/l dithiothreitol solution and 5 µl of Bulk First-Strand reaction mix containing murine reverse transcriptase and dNTP mix. The mixture was incubated at 37°C for 1 h. The obtained cDNA was stored at –80°C until the study.
The mRNA transcript encoding reverse transcriptase domain of the hTERT was amplified by reverse transcription (RT)–PCR and nested PCR. The first round PCR and nested PCR were performed with the following primer sets: GTCTCACCTCGAGGGTGAAG (HT1875F) and CTGATGGAGGTCCGGGCATAG (HT2781R), and GCCTGAGCTGTACTTTGTCAA (HT2026F) and CGCAAACAGCTTGTTCTCCATGTC (HT2482R). The position of the primers on the reverse transcriptase domain of the hTERT gene is shown in Figure 1. The first round of PCR was performed under the following conditions: 96°C for 3 min followed by 20 cycles of 96°C for 20 s, 55°C for 20 s and 72°C for 20 s. The nested PCR was performed under the following conditions: 96°C, 3 min followed by 20 cycles of 96°C for 20 s, 55°C for 20 s and 72°C for 20 s. The PCR products were electrophoresed on a 2.5% agarose gel.
|
The PCR products were analysed by the direct sequence reaction or BamHI restriction enzyme digestion. To analyse the sequence of the PCR products, Cy5-labelled primers (GCTGCAGAGCAGCGTGGAGAGGAT) were obtained, and a sequence reaction was performed with a CircumVentTM Thermal Cycle Dideoxy DNA Sequencing kit (New England Biolabs, Inc., Beverly, MA, USA). Briefly, the PCR products of ~25 ng were mixed with 0.4 pmol of the sequence primer, CircumVentTM deoxy/dideoxy sequencing mix and 0.5 unit of VentRTM (exo-) DNA polymerase in 6.2 µl of 20 mmol/l Tris–HCl, pH 8.8, 10 mmol/l KCl, 10 mmol/l (NH4)2SO4, 5 mmol/l MgSO4 and 3% Triton X-100 in a 0.5 ml PCR tube. PCR was performed for 20 cycles at 95°C for 20 s, 55°C for 20 s and 72°C for 20 s. To each tube, 4 µl of deionized formamide saturated with dextran blue was added. 10 µl of the sample was loaded on an 8% acrylamide–7 mol/l urea gel immediately after heating at 80°C for 2 min. The gel electrophoresis and sequence reading were performed with an ALFexpressTM DNA Sequencer (Amersham Pharmacia Biotech, Inc., Tokyo, Japan).
The restriction site of BamHI on the hTERT gene exists within the exon 9 as shown in Figure 1
.
Results
RT–PCR and the nested PCR produced fragments of 457, 421, 275 and 239 bp in length. The sequence analyses showed that the 457 bp fragment was full length, that the 421 bp fragment lacked 36 nucleotides from the starting nucleotide of exon 6 (alpha-deletion), that the 275 bp fragment lacked 182 bp comprising the entire of exon 7 and exon 8 (beta-deletion), and that the 239 bp fragment was the result of both deletions (Figure 1). In each case, we confirmed that the BamHI restriction enzyme digested the 457, 421, 275 or 239 bp fragments into 76 and 385, 76 and 349, 76 and 203, or 76 and 167 bp fragments respectively.
In the myometrium, telomerase activity was found in three of 14 cases. The full-length PCR product of the 457 bp was found only in the cases with positive telomerase activity. All the cases with negative telomerase activity showed the 275 and/or 231 bp fragments. The 275 bp fragment was most frequently observed, irrespective of the telomerase activity (Figure 2).
|
In the proliferative endometrium, the telomerase activity was found in 11 of 13 cases. The cases of negative telomerase activity were categorized into the early proliferative phase. In all the cases, the 457 bp and 275 bp PCR products were observed. In some cases, the 429 bp fragment or the 239 bp fragment was recognized (Figure 3
).
|
In the secretory endometrium, telomerase activity was found in six of 14 cases. The full-length PCR product was found in most cases, but a strong signal was obtained in the cases with positive telomerase activity. The 275 bp fragment was frequently found as a strong signal. In all except one of the negative telomerase activity cases, the 457 bp fragment was faint but the 275 or 239 bp fragment was clear (Figure 4
).
|
In all the endometrial carcinomas, telomerase activity and the full-length PCR product were observed. The alternative splicing variants were also observed in all the cases (Figure 5
).
|
Discussion
hTERT is a rate-limiting determinant of telomerase activity, and the expression of hTERT mRNA principally depends on the activity of the hTERT gene promoter. The promoter is regulated by a number of transcription factors such as c-Myc, SP-1 (Horikawa et al., 1999; Takakura et al., 1999; Wu et al., 1999), and the oestrogen receptor (Kyo et al., 1999). We observed that the presence of the full-length transcript for the reverse transcriptase domain of hTERT correlated well with the positive telomerase activity in the endometrial and myometrial samples.
The signal strength of the full-length transcript as observed by PCR did not, however, show a correlation with the telomerase activity in the examined tissues. In a few cases, a negative relationship between the expression of the full-length transcript and telomerase activity was actually observed.
To detect the splicing variants, we performed two rounds of PCR. Such a procedure can detect extremely low levels of nucleic acids, but sacrifices quantification of the target molecule. To semi-quantify the transcript by PCR, strict PCR conditions would be required. In addition, as the telomerase detection assay is a PCR-based method, one would need to standardize the assay for the best quantification of telomerase activity by adjusting the protein concentration of the tissue extract, eliminating inhibitors of the assay from the tissue extract, and optimizing the PCR conditions. These difficulties in quantification could partially contribute to any discrepancies between hTERT mRNA levels and telomerase activity.
The endometrium is composed of many kinds of cells with variable telomerase activity. We have previously demonstrated that the positive telomerase activity of the human endometrium is attributed to the epithelial cells, and not to stromal cells, and that its activity is associated with the proliferative activity of the epithelial cells in culture (Yokoyama et al., 1998b). Besides these major cells, lymphocytes harbour in the endometrium and other inflammatory cells occasionally infiltrate it. Lymphocytes (Pan et al., 1997), leukocytes (Buchkovich and Greider, 1996) and endothelial cells (Hsiao et al., 1997) are known to be telomerase positive. These cell constituents would vary in places or under physiological conditions of the tissue. This variation might also contribute to the discrepancy between telomerase activity and expression level of the full-length hTERT transcript.
We observed positive telomerase activity in three myometrial samples. We have previously demonstrated that most myometria are telomerase negative (Yokoyama et al., 1998c). Another laboratory has also supported our observation (Ulaner et al., 2000). However, the myometrium occasionally contains islands of endometrial tissue, known as adenomyosis, and this tissue sometimes contains inflammatory cells. As we did not investigate the cellular constituents of each examined sample, the contamination of the samples with endometrial tissue or other telomerase positive cells may have resulted in a positive telomerase activity. It is also possible that in the myometrial samples with positive telomerase, oestrogenic activation of the telomerase may have occurred, as the oestrogen receptor is an activator of hTERT transcription (Kyo et al., 1999) and is expressed in the myometrium.
The alpha-deletion of the hTERT mRNA will result in a partial defect in the motif A of the hTERT protein, resulting in serious defect of the hTERT protein. The beta-deletion will cause protein truncation. Either of these deletions in the hTERT mRNA will result in dysfunction of the hTERT protein. In fact, it has been demonstrated that the expression of these splicing variants is associated with the poor maturity of the human oocytes, preimplantation embryos, and blastocysts (Brenner et al., 1999).
The telomerase activity of the human endometrium varies during the menstrual cycle, and we observed the expression of the full-length transcript during the telomerase active period. Because telomerase is up-regulated during periods of active proliferation of the epithelial cells, telomerase activation appears to be affected by oestrogen in the endometrium. Telomerase would be essential for the endometrium to maintain its proliferative activity during the reproductive period. On the contrary, steady-state levels of the splicing variants were observed throughout the menstrual cycle. The beta-deletion type of the splicing variants was frequently observed irrespective of the telomerase activity, and the alpha-deletion type was occasionally detected.
Basal expression of the splicing variants was also observed in the myometria. It has been reported that the beta-deletion type of the splicing variant is expressed in some myometria and endometria showing negative telomerase activity (Ulaner et al., 2000). Taken together, it is suggested that the splicing variants of the hTERT mRNA, especially the beta-deletion type of splicing variant, are basally expressed in the uterus. Although the cellular origin of these splicing variants remains to be clarified, it is possible that some regulation by which alternative splicing is set into the regular state exists in the endometrium and myometrium. Our observations suggest that the telomerase activity of uterine tissues is regulated by not only the activity of the hTERT gene promoter, but also by the alternative splicing arising within the area encoding the reverse transcriptase domain of hTERT.
Notes
1 To whom correspondence should be addressed. E-mail: yokoyama{at}cc.gifu-u.ac.jp 
References
Allsopp, R.C., Chang, E., Kashefi-Aazam, M. et al. (1995) Telomere shortening is associated with cell division in vitro and in vivo. Exp. Cell Res., 220, 194–200.[Web of Science][Medline]
Brenner, C.A., Wolny, Y.M., Adler, R.R. et al. (1999) Alternative splicing of the telomerase catalytic subunit in human oocytes and embryos. Mol. Hum. Reprod., 5, 845–850.
Buchkovich, K.J. and Greider, C.W. (1996) Telomerase regulation during entry into the cell cycle in normal human T cells. Mol. Biol. Cell, 7, 1443–1454.[Abstract]
de Lange, T. (1994) Activation of telomerase in a human tumor. Proc. Natl Acad. Sci. USA, 91, 2882–2885.
Harley, C.B. (1991) Telomere loss: mitotic clock or genetic time tomb? Mutn Res., 256, 271–282.
Harrington, L., Zhou, W., McPhail, T. et al. (1997) Human telomerase contains evolutionarily conserved catalytic and structural subunits. Genes Dev., 11, 3109–3115.
Horikawa, I., Cable, P.L., Afshari, C. et al. (1999) Cloning and characterization of the promoter region of human telomerase reverse transcriptase gene. Cancer Res., 59, 826–830.
Hsiao, R., Sharma, H.W., Ramakrishnan, S. et al. (1997) Telomerase activity in normal human endothelial cells. Anticancer Res., 17, 827–832.[Web of Science][Medline]
Kilian, A., Bowtell, D.D., Abud, H.E. et al. (1997) Isolation of a candidate human telomerase catalytic subunit gene, which reveals complex splicing patterns in different cell types. Hum. Mol. Genet., 6, 2011–2019.
Kyo, S., Takakura, M., Kohama, T. et al. (1997) Telomerase activity in human endometrium. Cancer Res., 57, 610–614.
Kyo, S., Takakura, M., Kanaya, T. et al. (1999) Estrogen activates telomerase. Cancer Res., 59, 5917–5921.
Lingner, J., Hughes, T.R., Shevchenko, A. et al. (1997) Reverse transcriptase motifs in the catalytic subunit of telomerase. Science, 276, 561–567.
Meyerson, M., Counter, C.M., Eaton, E.N. et al. (1997) hEST2, the putative human telomerase catalytic subunit gene, is up-regulated in tumor cells and during immortalization. Cell, 90, 785–795.[Web of Science][Medline]
Nakamura, T.M., Morin, G.B., Chapman, K.B. et al. (1997) Telomerase catalytic subunit homologs from fission yeast and human. Science, 277, 955–959.
Pan, C., Xue, B.H., Ellis, T.M. et al. (1997) Changes in telomerase activity and telomere length during human T lymphocyte senescence. Exp. Cell Res., 231, 346–353.[Web of Science][Medline]
Takakura, M., Kyo, S., Kanaya, T. et al. (1999) Cloning of human telomerase catalytic subunit (hTERT) gene promoter and identification of proximal core promoter sequences essential for transcriptional activation in immortalized and cancer cells. Cancer Res., 59, 551–557.
Ulaner, G.A., Hu, J.F., Vu, T.H. et al. (1998) Telomerase activity in human development is regulated by human telomerase reverse transcriptase (hTERT) transcription and by alternate splicing of hTERT transcripts. Cancer Res., 58, 4168–4172.
Ulaner, G.A., Hu, J.F., Vu, T.H. et al. (2000) Regulation of telomerase by alternate splicing of human telomerase reverse transcriptase (hTERT) in normal and neoplastic ovary, endometrium and myometrium. Int. J. Cancer, 85, 330–335.[Web of Science][Medline]
Wick, M., Zubov, D. and Hagen, G. (1999) Genomic organization and promoter characterization of the gene encoding the human telomerase reverse transcriptase (hTERT). Gene, 232, 97–106.[Web of Science][Medline]
Wu, K.J., Grandori, C., Amacker, M. et al. (1999) Direct activation of TERT transcription by c-MYC. Nat. Genet, 21, 220–224.[Web of Science][Medline]
Yokoyama, Y., Takahashi, Y., Shinohara, A. et al. (1998a) Telomerase activity in the female reproductive tract and neoplasms. Gynecol. Oncol., 68, 145–149.[Web of Science][Medline]
Yokoyama, Y., Takahashi, Y., Shinohara, A. et al. (1998b) Telomerase activity is found in the epithelial cells but not in the stromal cells in human endometrial cell culture. Mol. Hum. Reprod., 4, 985–989.
Yokoyama, Y., Takahashi, Y., Morishita, S. et al. (1998c) Telomerase activity in the human endometrium throughout the menstrual cycle. Mol. Hum. Reprod., 4, 173–177.
Submitted on January 3, 2001; accepted on June 25, 2001.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  R. Hrdlickova, J. Nehyba, A. S. Liss, and H. R. Bose Jr. Mechanism of Telomerase Activation by v-Rel and Its Contribution to Transformation J. Virol., January 1, 2006; 80(1): 281 - 295. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-S. Cong, W. E. Wright, and J. W. Shay Human Telomerase and Its Regulation Microbiol. Mol. Biol. Rev., September 1, 2002; 66(3): 407 - 425. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||