Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (16)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Marchington, D.R.
Right arrow Articles by Poulton, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Marchington, D.R.
Right arrow Articles by Poulton, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Molecular Human Reproduction, Vol. 8, No. 11, 1046-1049, November 2002
© 2002 European Society of Human Reproduction and Embryology


Reproductive genetics

No evidence for paternal mtDNA transmission to offspring or extra-embryonic tissues after ICSI

D.R. Marchington1, M.S.G. Scott Brown1, V.K. Lamb2, R.J.T. van Golde3, J.A.M. Kremer3, J.H.A.M. Tuerlings4, E.C.M. Mariman4, A.H. Balen2 and J. Poulton1,5

1 University Department of Paediatics, Level 4, John Radcliffe Hospital, Headington, Oxford, OX3 9DU, 2 Reproductive Medicine Unit, Leeds General Infirmary, Leeds, UK, 3 Department of Obstetrics and Gynaecology and 4 Department of Human Genetics, University Medical Centre Nijmegen, The Netherlands


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
There is a risk that ICSI may increase the transmission of mtDNA diseases to children born after this technique. Knowledge of the fate and transmission of paternal mitochondrial DNA is important since mutations in mitochondrial DNA have been described in oligozoospermic males. We have used an adaptation of solid phase mini-sequencing to exclude the presence of levels of paternal mtDNA >0.001% in ICSI families. This method is more sensitive than those used in previous studies and is sufficient to detect the likely paternal contribution (~0.1–0.5% from simple calculations of expected dilution during fertilization). Using this method, we were able to detect concentrations as low as 0.001% paternal mtDNA in a maternal mtDNA background. No paternal mtDNA was detected in the embryonic (blood or buccal swabs) tissue of children born after ICSI nor in extra-embryonic tissue (placenta or umbilical cord). In conclusion, we did not detect paternal mtDNA in blood, buccal swabs, placenta or umbilical cord of children born after ICSI. We have found no evidence that ICSI increases the risk of paternal transmission of mtDNA and hence of mtDNA disorders.

ICSI/mtDNA/solid phase mini-sequencing


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
It has been assumed that human mitochondrial DNA (mtDNA) is essentially maternally inherited because sperm mtDNA is selectively destroyed after fertilization (Kaneda et al., 1995Go). mtDNA mutants can cause severe diseases in humans (Suomalainen, 1997Go) and cytoplasmic male sterility (CMS, or non-functional pollen) in higher plants (Young and Hanson, 1987Go). Hence mitochondrial dysfunction might also be a feature of human male infertility and mutations in mtDNA have been described in subfertile men (Folgero et al., 1993Go).

ICSI has transformed the treatment of male infertility but has theoretical genetic risks. ICSI is an increasingly common treatment for infertility, particularly for men with low or absent sperm counts, or immotile sperm. Sperm are collected from ejaculates, or are harvested by PESA (percutaneous epididymal sperm aspiration) or by aspiration/extraction from the testis (TESA, TESE), and a single sperm is injected into an oocyte. In some centres it is used in preference to simple IVF due to its high success rate. One of the reasons for this success is that it bypasses a number of stages of natural fertilization, including zona pellucida penetration and gamete membrane fusion. There are two major concerns. First, that this may also bypass the supposed mechanism (Kaneda et al., 1995Go) by which paternal mtDNA is removed from the embryo. mtDNA is more likely to suffer free radical-induced damage than nuclear DNA (Yakes and Van Houten, 1997), so sperm that have undergone oxidative stress could deliver defective mtDNA to an oocyte even though the sperm nucleus is unaffected. Similarly, as sperm carry more mtDNA deletions than oocytes (Reynier et al., 1998Go), there is more potential for passing on mtDNA disease. Second, ICSI presumably removes much of the selection against genes for male infertility (Silber et al., 1998Go; Page et al., 1999Go; Phillipson et al., 2000Go). This is particularly important in the case of mtDNA because it has been implicated in human male infertility (Folgero et al., 1993Go; Ruiz-Pesini et al., 2000aGo,bGo). Transmission of mutated paternal mtDNA via ICSI may thus lead to progressive and debilitating disorders.

In normal individuals, the vast majority of mtDNA are identical (homoplasmy), but in mtDNA disease, heteroplasmy (coexistance of mutant and normal mtDNA) is common. Because mtDNA with a point mutation may become homoplasmic and hence the mtDNA could found a maternal lineage within a single generation—the so-called bottleneck (Blok et al., 1997Go)—small quantities of exogenous mtDNA could have a profound effect. The paternal component would comprise up to 0.5% of the 100 000 mtDNA in each oocyte, but could potentially be amplified to a significant population in the progeny because of these unique genetic effects.

Previous studies have not detected a paternal contribution to the mtDNA in offspring of ICSI pregnancies at levels >0.01–1% (Houshmand et al., 1997Go; Torroni et al., 1998Go; Danan et al., 1999Go). However, these studies did not investigate extra-embryonic tissue. This is important, because mtDNA may have an uneven distribution between different tissues in a single individual (Poulton et al., 1995Go). Differences in the ratio between wild type and mutant DNA in different tissues, so called heteroplasmy, is well known for pathogenic mtDNA in mitochondrial diseases (Taylor et al., 1997Go). If paternal mtDNA did survive after ICSI and replicate during development, this might mean that paternal mtDNA could be enriched in some tissues and diluted in others.

We have adapted solid phase mini-sequencing, a highly sensitive method for quantifying mixed populations of mtDNA, to exclude levels of as low as 0.001% paternal mtDNA. In this study, the origin of mtDNA was investigated in placenta, umbilical cord, blood and buccal swabs of children born following ICSI.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
DNA was extracted by standard methods (Sambrook et al., 1989Go). For ICSI parent–child pairs, we obtained mtDNA sequence data for a 400 bp region of the first hypervariable region of the large non-coding region. M13 tagged primers, TGTAAAACGACGGCCAGTCTCAAATGGGCCTGTCCTTG (forward primer) and CAGGAAACAGCTATGACCTTGATTTCACGGAGGATGGTG (reverse primer), were used to PCR amplify the region from nucleotides 15875 to 16421 using ABgene PCR Mastermix with 1.5mmol/l MgCl2. Five pmol of primer and 1 µl of DNA (at ~50 ng/µl) were used in a 50 µl reaction volume. Amplifications were performed for 40 cycles (1 min each at 94°C, 55°C, 72°C, with an initial denaturing step of 4 min at 94°C and a final extension of 10 min at 72°C. Sequencing reactions used standard ABI Bigdye terminator chemistry and conditions and primers corresponding to the M13 tags (TGTAAAACGACGGCCAGT and CAGGAAACAGCTATGACC). Reactions were run on an ABI 377XL Prism DNA Sequencer. Polymorphic sequence variants that could be used to distinguish between paternal and maternal mtDNA were identified. This was followed by solid phase mini-sequencing (Suomalainen and Syvanen, 1996Go). This is a highly sensitive method, involving sequence-specific incorporation of radionucleotides in a primer extension assay (see Figure 1Go). A forward primer AAGTAGCATCCGTACTAT and a 5' biotinylated reverse primer were used to PCR amplify the region of mtDNA from nucleotides 15800 to 16417 using the same conditions as for the PCR for sequencing, except that an annealing temperature of 50°C was used. 10 µl PCR product was added to 15 µl binding buffer (TE pH 8.0 with 2 mol/l NaCl) and bound to the wells of a streptavidin-coated 96-well plate (ABgene) for 1 h. Plates were washed three times with washing buffer (TE pH 8.0 with 1 mol/l NaCl). 50 µl of a PCR mix was added, followed by denaturation for 5 min at 94°C and extension at 50°C for 10 min. The PCR mix contained 1.5 mmol/l MgCl2, 0.1 IU of Taq Polymerase, 5 pmol of a primer corresponding to the 18 bp upstream of the polymorphic base change of interest and 27 nmol of a single 32P-radiolabelled dNTP corresponding to either the maternal or the paternal sequence. The plate was washed three times with washing buffer and 30 µl denaturing buffer was added [80% formamide, 10 mmol/l EDTA (pH 8.0) 1 mg/ml xylene cyanol, 1 mg/ml bromophenol blue]. The plate was heated to 95°C for 5 min and transferred to ice. Samples of 4 µl were loaded onto 1 mm thick, 8 cmx8 cm 8% acrylamide 1xTris–borate–EDTA buffer/7 mol/l urea gels and electrophoresed for 45 min at 180 V. Gels were dried under heat and vacuum and exposed to storage phosphor screens for quantification of radioactivity in a phoshorimager.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 1. Principles of solid phase mini-sequencing, utilizing a G->A base change. The region of interest is amplified by PCR using a biotinylated reverse primer, to allow immobilization of the product on a streptavidin-coated plate. Excess reagents are removed and the plate is washed. A single round of PCR is performed using a detection primer corresponding to the sequence immediately upstream of the polymorphism and a radiolabelled dNTP, corresponding to either the paternal or maternal sequence. This allows extension by 1 bp if the dNTP matches the sequence present. Separate reactions are performed to detect the two different sequences. Excess reagents are removed and the plate is washed. The primer is then removed by denaturation and electrophoresed on 8% acrylamide Tris–borate–EDTA buffer/urea gels. The gel is dried and exposed to storage phosphor screens to detect radiolabelled primer.

 

    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Eleven ICSI pregnancies were investigated. These ICSI pregnancies were all derived from ejaculated sperm. In all cases, the fathers suffered from severe oligozoospermia. DNA was extracted from placenta (n = 3), buccal swabs (n = 3) or placenta, umbilical cord and blood (n = 5). Parental DNA was extracted from either blood or buccal swabs. Sequence analysis using Bigdye cycle sequencing demonstrated that there were usable mtDNA differences in all cases (Table IGo). These were used to design sets of PCR primers that allowed the detection of the parent-specific sequences (Figure 1Go). Initially we obtained a notable background signal using solid phase mini-sequencing, and this was not abolished by washing or minor alterations in the conditions. Subsequent investigation of the cause of the background revealed the presence of short PCR products which were not specific to either parent. However, acrylamide gel electrophoresis of the products of the primer extension (Figure 2Go) revealed that there was a high degree of specificity for the product of appropriate length. All detection primers were tested on mixes of paternal and maternal DNA samples mixed at ratios lower than those expected if paternal mtDNA was present in an embryo (i.e. <0.01%) to confirm that we would detect it if present. Using this method we were able to detect <0.001% paternal mtDNA after mixing paternal mtDNA into a maternal mtDNA background (Figure 3Go). No paternal mtDNA was detected in any of the ICSI samples. As controls, buccal swab samples from eight IVF families with differing paternal/maternal polymorphisms at nucleotides 16069 (two families), 16189 (two families), 16192, 16224 and 16362 (two families) were also analysed and no evidence of paternal mtDNA transmission was found.


View this table:
[in this window]
[in a new window]
 
Table I. Polymorphic base changes used to identify maternal and paternal mtDNA
 


View larger version (23K):
[in this window]
[in a new window]
 
Figure 2. Solid phase mini-sequencing of a family in which there is a polymorphic C->T base change in paternal mtDNA at nucleotide 16 269. Radiolabelled primer was detected by phosphorimaging after solid phase mini-sequencing as described in Materials and methods. Duplicate samples were analysed in two sets of wells. The upper panel shows bands obtained by mini-sequencing using radiolabelled dTTP which corresponds to the paternal sequence. The lower panel shows bands obtained by mini-sequencing using radiolabelled dCTP which corresponds to the maternal sequence. No paternal sequence was detected in the maternal or placental samples. No maternal sequence was detected in the paternal samples. Water controls tested negative for both sequences.

 


View larger version (78K):
[in this window]
[in a new window]
 
Figure 3. Solid phase mini-sequencing of sequential dilutions of paternal mtDNA (carrying a nucleotide 16 069T polymorphism) into maternal mtDNA (nucleotide 16 069C). To determine the sensitivity of the method, paternal mtDNA was mixed with maternal mtDNA in ratios encompassing those expected in an embryo in which paternal mtDNA was present. The radiolabelled primer representing the paternal sequence was detected by phosphorimaging after solid phase mini-sequencing as described in Materials and methods. No paternal sequence was detected in a water negative control or 100% maternal mtDNA but was detectable when paternal mtDNA was mixed with maternal mtDNA down to a concentration of 0.0001%.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
In normal individuals there is generally a single population of identical mtDNA (homoplasmy). Two mechanisms probably underlie this. On the maternal side, the so-called mtDNA bottleneck during oogenesis ensures that all of the 100000 mtDNA in a normal oocyte arise from a small number or a single mtDNA founder. On the paternal side, the mitochondrial bottleneck has an anatomical basis, and it is arguable that the minute contribution of sperm mtDNA to the zygote must be fully functional if it is to win the race against other sperm to the oocyte. While it is commonly held that mtDNA is exclusively maternally inherited, paternal mtDNA has been detected in abnormal human embryos at the blastocyst stage (St John et al., 2000Go) and mouse studies have shown that paternal mitochondria may persist in the zygote for several days (Cummins et al., 1999Go). Furthermore, ICSI alters both the time course of early development of the zygote (Tesarik et al., 1994Go) and potentially the dose of the paternal contribution to mtDNA. The use of immature sperm types including epididymal and testicular sperm might increase the risk of paternal mtDNA inheritance. Between meiosis and the end of spermatogenesis there is an 8–10-fold reduction in mtDNA copy number per cell (Hecht et al., 1984Go), reducing the number of paternal mtDNA molecules available for potential transmission in mature spermatocytes. Sperm mitochondria are ubiquitinylated during spermatogenesis. This ubiquitinylation is masked during the epididymal passage but unmasked and amplified after fertilization, targeting the sperm mitochondria for destruction in the 2–4-cell embryo (Sutovsky et al., 2000Go). This process appears to be dependent on species-specific recognition, raising the possibility that in abnormal sperm development or immature sperm this recognition/destruction system may be defective.

Our adaptation of solid phase mini-sequencing has improved its sensitivity and enabled us to exclude levels of as low as 0.001% paternal mtDNA in both embryonic and extra-embryonic tissues in 11 children born following ICSI using ejaculated sperm. In fertilized oocytes, the expected level of paternal mtDNA would be 0.1–0.5%. Thus our results argue against a possible compartmentalization of the injected sperm tail in the fertilized oocyte. Such a compartmentalization could theoretically lead to relatively high levels of paternal mtDNA in either embryonic or extra-embryonic tissues. Our findings also lend further support to the results of other groups who have obtained negative results in embryonic tissues, using less sensitive techniques (Houshmand et al., 1997Go; Torroni et al., 1998Go; Danan et al., 1999Go).

Investigating the potential for paternal inheritance of mtDNA is important for two reasons. First, ICSI presumably eliminates the selection pressures that normally maintain genetic fitness (Silber et al., 1998Go; Phillipson et al., 2000Go). By eliminating the anatomical basis of the mitochondrial bottleneck, ICSI may select for mtDNA mutations causing male infertility. Second, population geneticists routinely use mtDNA haplotypes to trace population migrations and infer divergence times based on mtDNA diversity. These studies assume that mtDNA does not recombine. However, recent reanalyses suggest that this critical assumption may be incorrect (Eyre-Walker et al., 1999Go). The proposal that mtDNA might recombine requires the mixing of mtDNA from two disparate lineages. This infers co-existence of paternal and maternal mtDNA in a single cell.

In conclusion, we did not detect paternal mtDNA in blood, buccal swabs, placenta or umbilical cord of children born after ICSI. We have found no evidence that ICSI increases the risk of paternal transmission of mtDNA and hence, of mtDNA disorders.


    Acknowledgements
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
We thank the families for providing samples, the Royal Society and Wellcome Trust for financial support, Professor D.H.Barlow for advice, Dr A.Suomalainen for technical advice and I.J.de Wijs for technical assistance.


    Notes
 
5 To whom correspondence should be addressed. E-mail: Joanna.poulton{at}paediatrics.oxford.ac.uk Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Blok, R.B., Gook, D.A., Thorburn, D.R. and Dahl H.H. (1997) Skewed segregation of the mtDNA nt 8993 (T–>G) mutation in human oocytes. Am. J. Hum. Genet., 60, 1495–501.[Web of Science][Medline]

Cummins, J.M., Kishikawa, H., Mehmet, D. and Yanagimachi R. (1999) Fate of genetically marked mitochondrial DNA from spermatocytes microinjected into mouse zygotes. Zygote, 7,151–156.[Web of Science][Medline]

Danan, C., Sternberg, D., Van Steirteghem, A., Cazeneuve, C., Duquesnoy, P., Besmond, C., Goossens, M., Lissens, W. and Amselem, S. (1999) Evaluation of parental mitochondrial inheritance in neonates born after intracytoplasmic sperm injection. Am. J. Hum. Genet., 65, 463–473.[Web of Science][Medline]

Eyre-Walker, A., Smith, N.H. and Smith, J.M. (1999) How clonal are human mitochondria? Proc. R. Soc. Lond. B. Biol. Sci., 266, 477–483.[Medline]

Folgero, T., Bertheussen, K., Lindal, S., Torbergsen, T. and Oian, P. (1993) Mitochondrial disease and reduced sperm motility. Hum. Reprod., 8, 1863–1868.[Abstract/Free Full Text]

Hecht, N.B., Liem, H., Kleene, K.C., Distel, R.J. and Ho, S.M. (1984) Maternal inheritance of the mouse mitochondrial genome is not mediated by a loss or gross alteration of the paternal mitochondrial DNA or by methylation of the oocyte mitochondrial DNA. Dev. Biol., 102, 452–461.[Web of Science][Medline]

Houshmand, M., Holme, E., Hanson, C., Wennerholm, U.B. and Hamberger, L. (1997) Is paternal mitochondrial DNA transferred to the offspring following intracytoplasmic sperm injection? J. Assist. Reprod. Genet., 14, 223–227.[Web of Science][Medline]

Kaneda, H., Hayashi, J., Takahama, S., Taya, C., Lindahl, K.F. and Yonekawa, H. (1995) Elimination of paternal mitochondrial DNA in intraspecific crosses during early mouse embryogenesis. Proc. Natl Acad. Sci. USA, 92, 4542–4546.[Abstract/Free Full Text]

Page, D.C., Silber, S. and Brown, L.G. (1999) Men with infertility caused by AZFc deletion can produce sons by intracytoplasmic sperm injection, but are likely to transmit the deletion and infertility. Hum. Reprod., 14, 1722–1726.[Abstract/Free Full Text]

Phillipson, G.T., Petrucco, O.M. and Matthews, C.D. (2000) Congenital bilateral absence of the vas deferens, cystic fibrosis mutation analysis and intracytoplasmic sperm injection. Hum. Reprod., 15, 431–435.[Abstract/Free Full Text]

Poulton, J., O’Rahilly, S., Morten, K.J. and Clark, A. (1995) Mitochondrial DNA, diabetes and pancreatic pathology in Kearns-Sayre syndrome. Diabetologia, 38, 868–871.[Web of Science][Medline]

Reynier, P., Chretien, M.F., Savagner, F., Larcher, G., Rohmer, V., Barriere, P.and Malthiery, Y. (1998) Long PCR analysis of human gamete mtDNA suggests defective mitochondrial maintenance in spermatozoa and supports the bottleneck theory for oocytes. Biochem. Biophys Res. Commun., 252, 373–377.[Web of Science][Medline]

Ruiz-Pesini, E., Lapena, A.C., Diez, C., Alvarez, E., Enriquez, J.A. and Lopez-Perez, M.J. (2000a) Seminal quality correlates with mitochondrial functionality. Clin. Chim. Acta, 300, 97–105.[Web of Science][Medline]

Ruiz-Pesini, E., Lapena, A.C., Diez-Sanchez, C., Perez-Martos, A., Montoya, J., Alvarez, E., Diaz, M., Urries, A., Montoro, L., Lopez-Perez, M.J. and Enriquez, J.A. (2000b) Human mtDNA haplogroups associated with high or reduced spermatozoa motility. Am. J. Hum. Genet., 67, 682–696.[Web of Science][Medline]

Sambrook, J., Fritsch, E. and Maniatis, T. (1989) Molecular Cloning, a Laboratory Manual. Cold Spring Harbor Laboratory Press, New York, USA.

Silber, S.J., Alagappan, R., Brown, L.G. and Page, D.C. (1998) Y chromosome deletions in azoospermic and severely oligozoospermic men undergoing intracytoplasmic sperm injection after testicular sperm extraction. Hum. Reprod., 13, 3332–3337.[Abstract/Free Full Text]

St John, J., Sakkas, D., Dimitriadi, K., Barnes, A., Maclin, V., Ramey, J., Barratt, C. and De Jonge, C. (2000) Failure of elimination of paternal mitochondrial DNA in abnormal embryos. Lancet, 355, 200.[Web of Science][Medline]

Suomalainen, A. and Syvanen, A.C. (1996) Analysis of nucleotide sequence variations by solid-phase minisequencing. Mol. Biol., 65, 73–79.

Suomalainen, A. (1997) Mitochondrial DNA and disease. Ann. Med., 29, 235–246.[Web of Science][Medline]

Sutovsky, P., Moreno, R.D., Ramalho-Santos, J., Dominko, T., Simerly, C. and Schatten, G. (2000) Ubiquitinated sperm mitochondria, selective proteolysis, and the regulation of mitochondrial inheritance in mammalian embryos. Biol. Reprod., 63, 582–590.[Abstract/Free Full Text]

Taylor, R.W., Chinnery, P.F., Clark, K.M., Lightowlers, R.N. and Turnbull, D.M. (1997) Treatment of mitochondrial disease. J. Bioenerg. Biomembr., 29, 195–205.[Web of Science][Medline]

Tesarik, J., Sousa, M. and Testart, J. (1994) Human oocyte activation after intracytoplasmic sperm injection. Hum. Reprod., 9, 511–518.[Abstract/Free Full Text]

Torroni, A., D’Urbano, L., Rengo, C., Scozzari, R., Sbracia, M., Manna, C., Cavazzini, C. and Sellitto, D. (1998) Intracytoplasmic injection of spermatozoa does not appear to alter the mode of mitochondrial DNA inheritance [letter]. Hum. Reprod., 13, 1747–1749.[Free Full Text]

Yakes, F.M. and Van Houten, B. (1997) Mitochondrial DNA damage is more extensive and persists longer than nuclear DNA damage in human cells following oxidative stress. Proc. Natl Acad. Sci. USA, 94, 514–519.[Abstract/Free Full Text]

Young, E.G. and Hanson, M.R. (1987) A fused mitochondrial gene associated with cytoplasmic male sterility is developmentally regulated.Cell, 50, 41–49.[Web of Science][Medline]

Submitted on December 12, 2000; resubmitted on December 19, 2001; accepted on August 8, 2002.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Hum Reprod UpdateHome page
E.C. Spikings, J. Alderson, and J.C.St. John
Transmission of mitochondrial DNA following assisted reproduction and nuclear transfer
Hum. Reprod. Update, July 1, 2006; 12(4): 401 - 415.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
R. H. Eckel, R. Kahn, R. M. Robertson, and R. A. Rizza
Preventing Cardiovascular Disease and Diabetes: A Call to Action From the American Diabetes Association and the American Heart Association
Circulation, June 27, 2006; 113(25): 2943 - 2946.
[Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
L.J.A.M. Jacobs, G. de Wert, J.P.M. Geraedts, I.F.M. de Coo, and H.J.M. Smeets
The transmission of OXPHOS disease and methods to prevent this
Hum. Reprod. Update, March 1, 2006; 12(2): 119 - 136.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
P. Sutovsky, T. C. McCauley, M. Sutovsky, and B. N. Day
Early Degradation of Paternal Mitochondria in Domestic Pig (Sus scrofa) Is Prevented by Selective Proteasomal Inhibitors Lactacystin and MG132
Biol Reprod, May 1, 2003; 68(5): 1793 - 1800.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (16)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Marchington, D.R.
Right arrow Articles by Poulton, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Marchington, D.R.
Right arrow Articles by Poulton, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?