Molecular Human Reproduction, Vol. 8, No. 11, 977-983,
November 2002
© 2002 European Society of Human Reproduction and Embryology
Testis and spermatogenesis |
Localization of the 16S mitochondrial rRNA in the nucleus of mammalian spermatogenic cells
1 Bios Chile Ingeniería Genética S.A., Millenium Institute for Fundamental and Applied Biology and Fundación Ciencia Para La Vida, Avenida Marathon 1943, 2 Laboratorio de Biología Celular y Molecular, Facultad de Ciencias de la Salud, Universidad Andrés Bello, Republica 252 and 3 Facultad de Medicina, Universidad de Chile, Independencia 1027, Santiago, Chile
| Abstract |
|---|
|
|
|---|
Amplification of RNA from human sperm heads yielded a fragment of 435 bp that shares 100% identity with a central region of the 16S mitochondrial rRNA. The nuclear localization in the sperm of the mitochondrial RNA was confirmed by in-situ hybridization. These results, together with the localization of the 16S mitochondrial rRNA in mouse sperm, are the first demonstration that the organelle transcript is a normal component of the mammalian gamete. The possibility that the nuclear mitochondrial RNA arises from nuclear transcription of a mitochondrial pseudogene was ruled out. To determine when during spermatogenesis the mitochondrial RNA is localized in the nucleus, in-situ hybridization of mouse and human testis was carried out. The nuclei of spermatogonia, spermatocytes and round and elongated spermatids were all positively stained. In human spermatocytes, the nuclear staining pattern was fibrillar, suggesting an association of the mitochondrial transcript with the meiotic chromosomes. These results indicate that early in spermatogenesis and before the onset of meiosis, the 16S mitochondrial rRNA is localized in the nucleus of spermatogenic cells, suggesting a process of translocation of the transcript from the mitochondria.
human/mitochondrial RNA/mouse/sperm/spermatogenesis
| Introduction |
|---|
|
|
|---|
The presence of RNA in the nucleus of mammalian gametes has been confirmed by different approaches. Using the immunogold procedure for electron microscopy, the nuclear localization of RNA in the mature sperm of rat and human has been demonstrated (Pessot et al., 1989
To characterize other RNA enriched in sperm, we used a differential screening strategy of a mouse testis cDNA library. Thus, we identified a transcript, referred to as chimeric mitochondrial RNA, containing an inverted repeat of 121 nucleotides covalently bound to the 5' end of the 16S mitochondrial rRNA (Villegas et al., 2000
, 2002
). Most interesting was the nuclear localization of this novel RNA in mouse sperm (Villegas et al., 2000
). To determine whether the unusual nuclear localization of this mitochondrial transcript is a peculiarity of the mouse sperm or if it also occurs in the sperm of other species, we investigated the localization of the 16S mitochondrial rRNA in the human gamete. Amplification by RTPCR of RNA from isolated human sperm heads and in-situ hybridization confirmed the nuclear localization of the mitochondrial transcript. The possibility that the 16S mitochondrial rRNA found in the nucleus is the result of nuclear transcription of a mitochondrial pseudogene (Hirano et al., 1997
; Wallace et al., 1997
; Kindmark et al., 2001
) was ruled out. These results suggest that the mitochondrial RNA is translocated from the organelle to the sperm nucleus. Thus, we also investigated at which stage of spermatogenesis this transfer process takes place. In-situ hybridization of human and mouse testis revealed that the 16S mitochondrial rRNA is localized in the nucleus of several types of spermatogenic cells, including spermatogonia, spermatocytes and round and elongated spermatids. Altogether, these results strongly suggest that the 16S mitochondrial rRNA is transferred from the organelle to the nucleus of spermatogenic cells by an unknown mechanism of RNA translocation and that this event occurs early in spermatogenesis prior to the meiotic prophase.
| Materials and methods |
|---|
|
|
|---|
Human sperm samples
Permission to use human semen samples from healthy donors and adult human testis biopsies was granted by the board of The Ethical and Biosafety Committee of Bios Chile I.G.S.A., and Fundación Ciencia para la Vida. The semen samples were allowed to liquefy for 1 h at room temperature, and then centrifuged at 600 g (Kubota 7930, rotor RS-200G) for 10 min at 4°C. The sediment was resuspended in phosphate-buffered saline (PBS) and centrifuged as described previously. The sperm were again resuspended in 0.5xPBS and centrifuged again at 600 g for 10 min and resuspended in PBS. The final suspension of human sperm was checked by phase contrast microscopy.
Isolation of sperm heads
Rat and mouse sperm were isolated as described previously (Vera et al., 1984
; Villegas et al., 2000
, 2002
). To isolate sperm heads, the sediment containing the sperm was resuspended in 500 µl of digestion buffer (10 mmol/l TrisHCl, pH 8.0, 10 mmol/l EDTA, 50 mmol/l NaCl and 2% SDS) after which 6 µl of 20 µg/ml of proteinase K were added. The mixture was incubated for 1015 min at 50°C (von Beroldingen et al., 1989
), diluted with 10 volumes of PBS and centrifuged at 3000 g for 10 min (Kubota 7930, rotor RS-200G). The heads were washed twice with PBS and the final preparation was monitored under phase microscopy and used immediately for extraction of RNA.
RNA extraction
RNA extraction was performed as described (Chomczynszki and Sacchi, 1987
; Villegas et al., 2000
, 2002
). Sperm or purified sperm heads were homogenized in 5 ml of a solution containing 4 mol/l guanidinium isothiocyanate, 1% Sarkosyl, 0.1 mol/l 2-mercaptoethanol and 25 mmol/l sodium citrate adjusted to pH 7.5. The mixture was incubated for 15 min at 37°C, after which one volume of water-saturated phenol (pH 5.2) and 0.2 volumes of chloroform were added, with vortexing after each addition. The mixture was centrifuged at 5000 g for 10 min at room temperature, and the aqueous upper phase was collected and precipitated with one volume of isopropyl alcohol. After 2 h at 20°C, the RNA was recovered by centrifugation at 10 000 g for 20 min at 4°C (Villegas et al., 2000
). Finally, the RNA pellet was washed twice with 70% ethanol and dissolved in sterile water treated with 0.1% diethylpyrocarbonate (Sambrook et al., 1989
). The RNA concentration was determined spectrophotometrically at 260 nm.
RTPCR reaction
Synthesis of cDNA was carried out in a final volume of 20 µl containing 50100 ng of total RNA from whole sperm, sperm heads or human testis (Clontech Labs, USA), 4 µl of 5xFirst Strand Buffer (250 mmol/l TrisHCl pH 8.3, 375 mmol/l KCl, 15 mmol/l MgCl2), 2 µl 0.1 mol/l dithiothreitol (DTT), 50 ng of random hexamers and 1 µl 10 mmol/l dNTP. The mixture was incubated for 10 min at 80°C and chilled on ice for 5 min. After a short spin, 40 IU of RNase OUTTM (Gibco, BRL) and 200 IU of M-MLV reverse transcriptase (Gibco, BRL) or 200 IU of SuperScript II (Gibco, BRL) was added to the mixture and incubated for 10 min at 25°C followed by 50 min at 37°C. For PCR, 25 µl of the cDNA reaction mixture was mixed with 5 µl of 10xPCR Buffer (200 mmol/l Tris HCl pH 8.4, 500 mmol/l KCl) 1.5 µl 50 mmol/l MgCl2, 1 µl 10 mmol/l dNTP, and 50 pmol of antisense and sense primers. The mixture was denatured for 5 min at 95°C followed by 30 cycles of 1 min at 94°C, 1 min at 58°C and 1 min at 72°C. After a final extension at 72°C for 10 min, 10 µl of the amplification reaction mixture was analysed by electrophoresis on a 2% agarose gel, stained with ethidium bromide and visualized under UV light.
The primers used and their position in the corresponding human genes were as follows. 16S mitochondrial rRNA (Anderson et al., 1981
): P1: 5' GTAGGCCTAAAAGCAGCCACCAA (21702192); P2: 5' TGATTATGCTACCTTTGCACGGT (25822604); P3: 5' ACCGTGCAAAGGTAGCATAATCA (25822604); P4: 5' GCTAAACCTAGCCCCAAACC (16711689); P5: 5' AAACCCTGTTCTTG-GGTGGGTG (32083229). 12S mitochondrial rRNA (Anderson et al., 1981
): P6: 5' CCAAACTGGGATTAGATACCCCA (10641087); P7: 5' TTGCTGAAGATGGCGGTATATA (12571276). Pro-opiomelanocortin exon 3: P8: 5' TACTCCATGGAGCACTTCCGC (521541); P9: 5' TCTGGCTCTTCTCGGAGGTCA (828848) (Takahashi et al., 1983
). ß-globin: P10: 5' TGGCCAATCTACTCCCAGG (1230); P11: 5' GGAAAATAGACCAATAGGCAG (333353) (Marotta et al., 1977
).
Isolation of human sperm genomic DNA
To isolate the highly polymerized DNA from human sperm, the mitochondrial sheath of the sperm tail was released by using a treatment employed for the isolation of the fibrous sheath (Olson et al., 1976
; Brito et al., 1989
; Brito and Burzio, 1995
). The sperm were isolated as described above and resuspended in 5 ml of a solution containing 50 mmol/l TrisHCl pH 8.0, 1% Triton X-100 and 2 mmol/l dithiothreitol (DTT) and incubated for 12 min at room temperature. After centrifugation at 3000 g for 10 min, the sediment was resuspended in 30 ml of 2.2 mol/l sucrose in PBS and centrifuged at 9000 g for 30 min at 4°C (Sorvall, rotor HB-6). The sediment, containing the heads, the fibrous sheath and the axonemes (Brito et al., 1989
; Brito and Burzio, 1995
), was resuspended in PBS and centrifuged at 3000 g for 10 min. This washing step was repeated twice to eliminate the sucrose. The sediment was resuspended again in the same solution containing 1% Triton X-100 and 2 mmol/l DTT and incubated for an additional 10 min at room temperature. After a second centrifugation step through a 2.2 mol/l sucrose cushion as described above, the final pellet was washed three times with PBS and resuspended in 6 ml of the 4 mol/l guanidinium isothiocyanate solution described above (Chomczynszki and Sacchi, 1987
; Villegas et al., 2000
, 2002
). The DNA was extracted using the standard phenol/chloroform procedure (Sambrook et al., 1989
).
The DNA was dissolved in TE buffer (10 mmol/l TrisHCl, pH 7.5 and 1mmol/l EDTA), electrophoresed on a 0.5% agarose gel for 2 h at 60 V and stained with ethidium bromide. The major band of DNA migrating
1 cm from the well was cut and the genomic DNA recovered using the ConcertTM Rapid Gel Extraction System (Gibco, BRL) according to the manufacturers instructions. The elution step was performed by incubating the spin cartridge for 3 min with 50 µl of TE buffer warmed to 80°C, followed by centrifugation. This step was repeated twice, and the final pool of 150 µl containing the genomic DNA was precipitated with 2.5 volumes of ethanol at 20°C (Sambrook et al., 1989
). After 3 h at 20°C the DNA was recovered by centrifugation, washed twice with 70% ethanol and resuspended in 50 µl of nuclease-free water.
In-situ hybridization
In-situ hybridization was carried out as described previously (Concha et al., 1993
; Villegas et al., 2000
). Smears of human sperm on slides previously coated with a mussel adhesive protein (Burzio et al., 1997
) were air-dried for 30 min at room temperature. The smears were treated with 15 mmol/l 2-mercaptoethanol in PBS, pH 7.4, for 10 min at room temperature and fixed in 4% paraformaldehyde for 10 min. The slides were washed three times with PBS for 10 min and incubated in 2xSSC (2xSSC: 0.3 mol/l NaCl, 30 mmol/l sodium citrate, pH 7.0) for 10 min at room temperature. Prehybridization was performed for 30 min at 37°C in a mixture containing 4xSSC, 10% dextran sulphate, 100 µg/ml yeast tRNA and herring sperm DNA, 50% formamide and 1xDenhardts solution (0.2 mg/ml Ficoll type 400, 0.2 mg/ml polyvinylpirrolidone, 0.2 mg/ml BSA). Hybridization was performed for 12 h at 37°C with 100 µl/slide of the prehybridization mixture containing 3.5 pmol of antisense or sense probes previously labelled at the 3' end with digoxigenin-11-dUTP (Boehringer Mannheim, Germany) and 17 IU of terminal transferase (Gibco, BRL) as described previously (Concha et al., 1993
; Villegas et al., 2000
). Then, the smears were washed first with 2xSSC and with 1xSSC for 10 min at room temperature followed by 0.5xSSC for 30 min at 45°C and finally, with 0.2xSSC for 10 min at room temperature. After the washing steps, the smears were incubated for 30 min in a blocking buffer (1% BSA, 0.3% Triton X-100 in PBS) followed by 2 h at room temperature with a monoclonal anti-digoxigenin antibody conjugated to alkaline phosphatase (Boehringer Mannheim, Germany) and diluted 1:500 in blocking buffer. Finally, the smears were washed twice with PBS and the colour reaction was carried out with 5-bromo-4-chloro-3-indolyl phosphate/Nitroblue Tetrazolium substrate mixture (DAKO, CA, USA) for 30 min at room temperature as previously described (Villegas et al., 2000
).
For in-situ hybridization of adult human or mouse testis, the tissue samples were fixed in Bouins and paraffin-embedded. Sections of
5 µm were fixed on slides coated with polylysine, and after incubation for 1 h at 60°C the paraffin was removed by four washes of 15 min each with xylol. The sections were air-dried and washed four times with PBS, incubated in 0.2 mol/l HCl for 10 min at room temperature and then thoroughly washed with PBS. The sections were then subjected to in-situ hybridization as described above. Control sections were incubated overnight at room temperature in a humid chamber with a solution containing 1 mg/ml of RNase A (Sigma, MO, USA) in PBS, and then subjected to the same in-situ hybridization protocol.
Cloning of PCR fragments
Amplified DNA fragments were purified using the Wizard purification system (Promega, WI, USA) and cloned into the vector pGEM®-T Easy (Promega) as described (Villegas et al., 2000
, 2002
). The ligation product was used to transform 100 µl of Escherichia coli HB-101 competent cells according to standard protocols (Sambrook et al., 1989
). A volume of 50100 µl of the transformation mixture was plated onto LB agar plates containing 100 µg/ml of ampicillin, 160 µg/ml of X-Gal and 0.4 mmol/l IPTG and incubated overnight at 37°C. At least 20 white colonies were selected randomly and grown overnight in 5 ml of LB broth plus 100 µg/ml of ampicillin. Plasmids were purified using the Concert Rapid Miniprep System (Gibco, BRL), and the presence of the insert was confirmed by PCR, using primers P1 and P2. Sequencing of both strands of the insert was carried out using the forward and reverse M13 primers and the dideoxy-chain termination method (Sanger and Coulson, 1975
) with a Perkin-Elmer ABI Prism 310 Genetic Analyzer (Villegas et al., 2000
, 2002
).
| Results |
|---|
|
|
|---|
Amplification from total human sperm RNA by RTPCR using primers P1 and P2, which are homologous between human, rat and mouse, was expected to yield a fragment of
440 bp corresponding to a central region of the 16S mitochondrial rRNA. As shown in Figure 1
|
Since in mouse sperm the 16S mitochondrial rRNA was found in the nucleus (Villegas et al., 2000
440 bp was obtained (Figure 2b
|
It is possible that the presence of the 16S mitochondrial rRNA in the human sperm heads might arise from contamination with mitochondrial RNA released from the organelle after treatment with proteinase K or from contaminating white blood cells. Therefore, whole human sperm smears were subjected to in-situ hybridization using primers P2 and P3 labelled with digoxigenin as probes (Concha et al., 1993
|
The unusual nuclear localization of the 16S mitochondrial rRNA might be explained by an unknown mechanism of translocation of the transcript from the organelle to the nucleus. Alternatively, the presence of this RNA in the nucleus could result from nuclear transcription of a mitochondrial pseudogene. To explore this possibility, isolation of human sperm nuclear DNA was carried out. Treatment of sperm with a solution containing 1% Triton X-100 and DTT releases the mitochondrial sheath and dissolves the outer dense fibres, leaving the sperm heads, the fibrous sheath and the axonemes as the only remaining structures (Olson et al., 1976
|
It was pertinent to ask if this unusual nuclear localization of the 16S mitochondrial rRNA also occurs in other spermatogenic cells. Accordingly, in-situ hybridization was carried out with adult mouse testis and normal human testis sections. As shown in Figure 5a
|
| Discussion |
|---|
|
|
|---|
The results presented here, together with those reported previously (Villegas et al., 2000
This novel localization could be explained as the result of transcription of a nuclear mitochondrial pseudogene. The presence of mitochondrial pseudogenes in the nuclear DNA has been reported in several organisms (Jacobs and Grimes, 1986
; Smith et al., 1992
; Arctander, 1995
), including humans (Hirano et al., 1997
; Wallace et al., 1997
). But more pertinent is a report indicating that 14 722 bp of the mitochondrial genome is inserted in human chromosome 17 (Kindmark et al., 2001
). In general, this macro mitochondrial pseudogene has an identity of
83% with various mitochondrial genes, and 87% identity with the 16S mitochondrial gene (Kindmark et al., 2001
). Since the amplicon of 440 bp obtained with RNA from isolated human sperm heads has a 100% identity with the sequence of the human 16S mitochondrial rRNA (Anderson et al., 1981
), one could argue that the nuclear mitochondrial RNA reported here does not result from the transcription of a pseudogene. However, to formally rule out this possibility, a method was developed to isolate highly polymerized nuclear human sperm DNA, involving isolation of sperm heads and purification of the DNA by electrophoresis on agarose gels. Using this DNA purified from three human sperm donors as the template for PCR, no amplification product of the 16S gene or the 440 bp fragment corresponding to the same sequence were obtained. In contrast, regions of the ß-globin and pro-opiomelanocortin genes were successfully amplified, indicating that the failure to obtain the corresponding amplicon of the putative 16S mitochondrial pseudogene was not due to problems of experimental design such as amount of template, magnesium concentration or annealing temperature. Therefore, the evidence strongly indicates that the presence of the 16S mitochondrial rRNA in the nucleus of human sperm is not the result of transcription of a mitochondrial pseudogene.
If the 16S mitochondrial rRNA is present in the nucleus of human and mouse sperm, it is pertinent to ask at what time during spermatogenesis does this localization process take place. The results presented here indicate that the RNA is localized in the nuclei of round and elongated spermatids, the direct precursors of the gamete. It is important to note that in-situ hybridization with 20 mer antisense probes corresponding to positions 1685, 2170 and 2930 of the mtDNA (Anderson et al., 1981
) yielded the same results (data not shown), suggesting that the complete mitochondrial 16S mitochondrial rRNA is present in the nuclei of spermatogenic cells. Although the hybridization signals obtained with mouse spermatocytes were weak, the nuclear staining of human spermatocytes was unequivocal. It is interesting to note that the staining pattern found in the nuclei of spermatocytes was not homogeneous, as was that observed in spermatogonia, spermatids and spermatozoa. The pattern revealed a fibrillar staining, suggesting a putative association of the mitochondrial transcript with the meiotic chromosomes. The function of this association during meiosis is not clear at the present time.
The strong staining of the nuclei of mouse and human spermatogonia indicates that the localization process occurs during spermatogonial proliferation and differentiation and before the onset of meiosis (Clermont, 1972
). The same results of in-situ hybridization were obtained with rat testis (data not shown). It would be interesting to study the localization at earlier stages of spermatogenesis in mouse fetal testis or in testes obtained from 1020 day old mice (Clermont, 1972
).
The above discussion strongly suggests that the nuclear localization of the 16S mitochondrial rRNA in spermatogenic cells is the result of an intriguing process of translocation of the transcript from the organelle to the nucleus. This hypothesis leads to several important questions; for example, how the organelle regulates the exit of the 16S mitochondrial rRNA without affecting the number of copies of the RNA needed to assemble the mitoribosomes for normal mitochondrial translation (Wallace, 1992
; Taanman, 1999
; Suzuki et al., 2001
). Another intriguing question is about the mechanism used by the RNA to exit the mitochondria. The extramitochondrial localization of the 16S mitochondrial rRNA described here is not unique, since the same transcript has been found consistently in the cytoplasm of Drosophila and Xenopus embryos (Kobayashi et al., 1993
, 1998
). In these cases, the 16S mitochondrial rRNA is tightly associated to the polar granules of the germ plasma (Kobayashi et al., 1993
, 1998
). In embryos of the ascidian Halocynthia, the mitochondrial 16S rRNA is localized in the myoplasm of precursor muscle cells (Oka et al., 1999
). However, the mechanism involved in the export of the transcript from the organelle is not understood.
At present, the significance of the nuclear localization of the 16S mitochondrial rRNA in spermatogenic cells or in the sperm nucleus is not clear. As discussed previously, the cytoplasmic localization of the 16S mitochondrial rRNA in embryos of Drosophila and Xenopus, tightly bound to polar granules (Kobayashi et al., 1993
, 1998
) is an essential event for pole cell formation and development of the germ line and abdomen formation (Blackler, 1958
; Okada et al., 1974
; Lehmann and Nüsslein-Volhard, 1986
; Kobayashi and Okada, 1989
; Kobayashi et al., 1993
, 1998
). Injection of an anti-16S rRNA ribozyme into cleavage embryos of Drosophila demonstrated that the rRNA is actively involved in the generation of pole cells, the progenitors of the germ line (Iida and Kobayashi, 1998
). Also, it was suggested that the localization of the 16S rRNA in the myoplasm of precursor cells of muscle in embryos of the ascidian Halocynthia roretzi, might play an important role in development and differentiation (Oka et al., 1999
). Therefore, one is tempted to speculate that the function of the mitochondrial transcript in the human sperm nucleus might be related to the determination of the germ line after fertilization. Recently, we have reported that the mouse chimeric mitochondrial RNA is edited from U to C (Villegas et al., 2002
). In this regard, and related to the above proposition, it is important to mention that a high proportion (75%) of the RNA in mouse sperm is edited compared with 55% in testis and
10% in somatic tissues, suggesting that this modification of the transcript might be necessary for its function in the gamete (Villegas et al., 2002
).
| Acknowledgements |
|---|
|
|
|---|
We thank Dr Pablo Valenzuela and Dr Mario Rosemblatt from the Institute for Fundamental and Applied Biology for their helpful discussions. Grants 1990230 and 2960062 from Fondecyt, and Grant P99-007-F from the MIFAB, Chile, supported this work.
| Notes |
|---|
4 To whom correspondence should be addressed at: Bios Chile I.G.S.A., Avenida Marathon 1943, Santiago, Chile. E-mail: lburzio{at}bioschile.cl
| References |
|---|
|
|
|---|
Anderson, S., Bankier, A.T., Barrell, B.G., de Bruijin, M.H.L., Coulson, A.R., Drouin, J., Eperon, I.C., Nierlich, D.P., Roe, B.A., Sanger, F. et al. (1981) Sequence and organization of the human mitochondrial genome. Nature, 290, 457465.[Medline]
Arctander, P. (1995) Comparison of a mitochondrial gene and a corresponding nuclear pseudogene. Proc. R. Soc. Lond., Biol. Sci., 262, 1319.[Medline]
Blackler, A. (1958) Contribution to the study of germ cells in the Anura. J. Embryol. Exp. Morph., 6, 491503.[Web of Science][Medline]
Brito, M. and Burzio, L.O. (1995) Isolation of the fibrous sheath of mammalian sperm flagella. In Dentler, W. and Witman, G. (eds), Methods in Cell Biology. Academic Press, New York, vol. 47, pp. 391395.[Web of Science][Medline]
Brito, M., Figueroa, J., Maldonado, E., Vera, J.C. and Burzio, L.O. (1989) The major component of the rat sperm fibrous sheath is a phosphoprotein. Gamete Res., 22, 205217.[Web of Science][Medline]
Burzio, L.O., Burzio, V.A., Silva, T., Burzio, L.A. and Pardo, J. (1997) Environmental bioadhesion: themes and applications. Curr. Opin. Biotechnol., 8, 309312.[Web of Science][Medline]
Chiang, M., Steuerwald, N., Lambert, H., Main, E.K. and Steinleitner, A. (1994) Detection of human leukocyte antigen class I messenger ribonucleic acid transcripts in human spermatozoa via reverse transcriptionpolymerase chain reaction. Fertil. Steril., 2, 276280.
Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162, 156159.[Web of Science][Medline]
Clermont, Y. (1972) Kinetics of spermatogenesis in mammals: seminiferous epithelium cycle and spermatogonial renewal. Physiol. Rev., 52, 198236.
Concha, I., Urzua, U., Yañez, A., Schroeder, R., Pessot, C. and Burzio, L.O. (1993) U1 and U2 snRNA are localized in the sperm nucleus. Exp. Cell Res., 204, 378381.[Web of Science][Medline]
Concha, I., Mancilla, J., Riveros, M. and Burzio, L.O. (1995) U1 snRNP components are present in the vegetative and generative nuclei of the pollen grain. Sex Plant Reprod., 8, 339344.
Hirano, M., Shtilbans, A., Mayeux, R., Davidson, M., Dimauro, S., Knowles, J. and Schon, E. (1997) Apparent mtDNA heteroplasmy in Alzheimers disease patients and normals due to PCR amplification of nucleus-embedded mtDNA pseudogenes. Proc. Natl. Acad. Sci. USA, 94, 1489414899.
Iida, T. and Kobayashi, S. (1998) Essential role of mitochondrially encoded large rRNA for germ-line formation in Drosophila embryos. Proc. Natl. Acad. Sci. USA, 95, 1127411278.
Jacobs, H.T. and Grimes, B. (1986) Complete nucleotide sequence of the nuclear pseudogenes for cytochrome oxidase subunit I and the large mitochondrial ribosomal RNA in the sea urchin Strongylocentrotus purpuratus. J. Mol. Biol., 187, 509527.[Web of Science][Medline]
Kindmark, A., Kilger, C., Benes, V., Haaff, T., von Haeseler, A. and Paabo, S. (2001) Homo sapiens chromosome 17 sequence containing mitochondrial genome insertion. NCBI, Access No. AF227907.
Kobayashi, S. and Okada, M. (1989) Restoration of pole-cell forming ability to UV-irradiated Drosophila embryos by injection of mitochondrial lrRNA. Development, 107, 21792188.
Kobayashi, S., Amikura, R. and Okada, M. (1993) Presence of the mitochondrial large ribosomal RNA outside mitochondria in germ plasm of Drosophila melanogaster. Science, 260, 15211524.
Kobayashi, S., Amikura, R. and Mukai, M. (1998) Localization of mitochondrial large ribosomal RNA in germ plasm of Xenopus embryos. Curr. Biol., 8, 11171120.[Web of Science][Medline]
Kramer, J. and Krawetz, S. (1997) RNA in spermatozoa: implications for the alternative haploid genome. Mol. Hum. Reprod., 3, 473478.
Kumar, G., Patel, D. and Rajesh, K. (1993) c-MYC mRNA is present in human sperm cells. Cell. Mol. Biol. Res., 39, 111117.[Web of Science][Medline]
Lehmann, R. and Nüsslein-Volhard, C. (1986) The maternal gene nanos has a central role in posterior pattern formation of the Drosophila embryo. Development, 112, 679691.
Marotta, C.A., Forget, B.G., Cohne-Solal, M., Wilson, J.T. and Weissman, S.M. (1977) Human beta-globin messenger RNA. I. Nucleotide sequences derived from complementary RNA. J. Biol. Chem., 252, 50195031.
Mascarenhas, J.P. (1993) Molecular mechanisms of pollen tube growth and differentiation. Plant Cell, 5, 13031314.
Miller, D. (1997) RNA in the ejaculate spermatozoon: a window into molecular events in spermatogenesis and a record of the unusual requirements of haploid gene expression and post-meiotic equilibration. Mol. Hum. Reprod., 3, 669676.
Miller, D., Tzang, P., Skinner, C. and Lilford, R. (1994) Differential RNA fingerprinting as a tool in the analysis of spermatozoal gene expression. Hum. Reprod., 9, 864869.
Oka, T., Amikura, R., Kobayashi, S., Yamamoto, H. and Nishida, H. (1999) Localization of the mitochondrial large ribosomal RNA in the myoplasm of the early ascidian embryo. Dev. Growth Differ., 1, 18.[Medline]
Okada, M., Kleinman, I. and Schneiderman, H. (1974) Restoration of fertility in sterilized Drosophila eggs by transplantation of polar cytoplasm. Dev. Biol., 195, 302317.
Olson, G., Hamilton, D. and Fawcett, D. (1976) Isolation and characterization of the fibrous sheath of rat epididymal spermatozoa. Biol. Reprod., 14, 517530.[Abstract]
Pessot, C., Brito, M., Figueroa, J., Concha, I.I., Yañez, A. and Burzio, L.O. (1989) Presence of RNA in the sperm nucleus. Biochem. Biophys. Res. Commun., 158, 271278.
Rohwedder, A., Liedigk, O., Schaller, J., Glander, H.J. and Werchov, H. (1996) Detection of mRNA transcripts of beta 1 integrins in ejaculated human spermatozoa by nested reverse transcriptionpolymerase chain reaction. Mol. Hum. Reprod., 2, 499505.
Sambrook, J., Fritsch, E. and Maniatis, T. (1989) Molecular Cloning, A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, New York.
Sanger, F. and Coulson, A.R. (1975) A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase. J. Mol. Biol., 94, 441457.[Web of Science][Medline]
Smith, M., Thomas, W. and Patton, W. (1992) Mitochondrial DNA-like sequence in the nuclear genome of an akodontine rodent. Mol. Biol. Evol., 9, 204215.[Abstract]
Suzuki, T., Terasaki, M., Takemoto-Hori, C., Haneda, T., Ueda, T., Wada, A. and Watanabe, K. (2001) Proteomic analysis of the mammalian mitochondrial ribosome. Identification of protein components in the 28S small subunit. J. Biol. Chem., 276, 3318133195.
Taanman, J.W. (1999) The mitochondrial genome: structure, transcription, translation and replication. Biochim. Biophys. Acta, 1410, 103123.[Medline]
Takahashi, H., Hakamata, Y., Watanabe, Y., Kikuno, R., Miyata, T. and Numa, S. (1983) Complete nucleotide sequence of the human corticotropin-beta-lipotropin precursor gene. Nucleic Acids Res., 11, 68476858.
Vera, J.C., Brito, M., Zuvic, T. and Burzio, L.O. (1984) Polypeptide composition of rat sperm outer dense fibers. A simple procedure to isolate the fibrillar complex. J. Biol. Chem., 259, 59705977.
Villegas, J., Zárraga, A.M., Müller, I., Montecinos, L., Werner, E., Brito, M., Meneses, A.M. and Burzio, L.O. (2000) A novel chimeric RNA localized in the nucleus of mouse sperm. DNA Cell Biol., 9, 578582.
Villegas, J., Müller, I., Arredondo, J., Pinto, R. and Burzio, L.O. (2002) A putative RNA editing from U to C in a mouse mitochondrial transcript. Nucleic Acids Res., 30, 18951901.
Von Beroldingen, C. H., Blake, E.T., Higuchi, R., Sensabaugh, G.F. and Erlich, H. (1989) Applications of PCR to the analysis of biological evidence. In Erlich, H.A. (ed.), PCR Technology. Principles and Applications for DNA Amplification. Stockton Press, New York, pp. 209223.
Wallace, D. C. (1992) Diseases of the mitochondrial DNA. Annu. Rev. Biochem., 61, 11751212.[Web of Science][Medline]
Wallace, D., Stugard, C., Murdock, D., Schurr, T. and Brown, M. (1997) Ancient mtDNA sequences in the human nuclear genome: a potential source of errors in identifying pathogenic mutations. Proc. Natl. Acad. Sci. USA, 94, 1490014905.
Submitted on March 20, 2001; resubmitted on May 16, 2002; accepted on August 22, 2002.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
V. A. Burzio, C. Villota, J. Villegas, E. Landerer, E. Boccardo, L. L. Villa, R. Martinez, C. Lopez, F. Gaete, V. Toro, et al. Expression of a family of noncoding mitochondrial RNAs distinguishes normal from cancer cells PNAS, June 9, 2009; 106(23): 9430 - 9434. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Villegas, V. Burzio, C. Villota, E. Landerer, R. Martinez, M. Santander, R. Martinez, R. Pinto, M. I. Vera, E. Boccardo, et al. Expression of a novel non-coding mitochondrial RNA in human proliferating cells Nucleic Acids Res., December 18, 2007; 35(21): 7336 - 7347. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Gur and H. Breitbart Mammalian sperm translate nuclear-encoded proteins by mitochondrial-type ribosomes Genes & Dev., February 15, 2006; 20(4): 411 - 416. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




-DNA-HindIII/
X-174 DNA-HaeIII standards. (b) Amplification was carried out with the highly polymerized sperm DNA. Lane 1: attempted amplification of the 435 bp fragment of the 16S rRNA gene. Lanes 2 and 3: amplification of a 341 bp fragment of the ß-globin gene (primers P10 and P11) and a 327 bp fragment of the pro-opiomelanocortin gene (primers P8 and P9) respectively. M: 100 bp ladder. The size of each fragment is shown at the sides of the gels.


